Multiplex PCR (Polymerase Chain Reaction) kit and method for quantitatively detecting bacterium concentration of multiple to-be-detected target pathogens by internal standard method
By designing an internal standard quantitative nucleic acid sequence and fluorescent PCR technology in a multiplex PCR kit, the problem of simultaneous quantification of multiple target pathogens was solved, achieving accurate detection of multiple target pathogens and correction of experimental errors, and making it suitable for multiplex detection of complex samples.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-17
- Publication Date
- 2026-03-13
AI Technical Summary
Existing methods for relative quantification of nucleic acids involving internal standards cannot meet the need for simultaneous quantitative detection of multiple target pathogens, and there are problems with experimental error and sample variation.
Design a multiplex PCR kit containing an internal standard quantitative nucleic acid sequence for amplifying the bacterial concentration of multiple target pathogens. By using internal standard probes and fluorescent PCR technology, establish the concentration relationship between multiple targets and the internal standard, correct experimental errors and sample variations, and achieve simultaneous quantification of multiple targets.
It enables precise quantitative detection of multiple targets in the same reaction well, corrects experimental errors, and improves the accuracy and repeatability of detection results, making it suitable for multiplex detection of complex samples.
Smart Images

Figure CN121653232A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of bacterial concentration determination of target pathogens, and more particularly to a multiplex PCR kit for quantitative detection of bacterial concentration of multiple target pathogens using an internal standard method. Background Technology
[0002] The core of bacterial concentration determination is divided into direct counting methods and indirect estimation methods. Direct counting methods include: plate counting (colony forming unit method, CFU), the gold standard, which counts only viable bacteria, providing accurate results but is time-consuming (requiring 18-24 hours of incubation), suitable for scenarios requiring precise quantification; and hemocytometer method (direct counting under a microscope), which utilizes the fixed volume of a hemocytometer to directly count the total number of bacteria (viable + dead bacteria) under a microscope. This method is simple to operate but cannot distinguish between live and dead bacteria, suitable for rough estimation or pure bacterial cultures.
[0003] Indirect estimation methods include: turbidimetry (spectrophotometry), which utilizes the positive correlation between bacterial concentration and absorbance (OD value). The absorbance at a specific wavelength (usually 600 nm) is measured using a spectrophotometer, and the concentration is calculated using a standard curve. This method requires no cultivation and is suitable for real-time monitoring, but it is affected by bacterial purity and particulate impurities, requiring prior calibration. Dry weight method (biomass conversion), which involves centrifuging to collect the bacterial culture, washing, and drying to constant weight, then indirectly calculating the concentration (unit: g / L) from the dry weight of the cells. Fluorescent staining method, which uses live-cell-specific fluorescent dyes for staining and flow cytometry for counting; this method can distinguish between live and dead bacteria, offering high accuracy but requiring expensive equipment. Metabolite method, which indirectly estimates the cell mass by detecting the concentration of metabolites such as lactic acid and ethanol in the bacterial culture; this method is suitable for specific fermentation systems.
[0004] Internal standard quantification (ECQ) has become one of the best solutions for quantification because it eliminates the need for additional standard curve preparation and simplifies result analysis. Unlike conventional relative nucleic acid quantification methods, which calculate the concentration of the sample based on the linear relationship between the sample's Ct value and the logarithm of its concentration, internal standard-based relative nucleic acid quantification methods calculate the unknown sample concentration either based on the mathematical relationship between the difference in Ct values between the internal standard and the target and the logarithm of the ratio of the target to the internal standard concentration, or based on the linear relationship between the ratio of the target to the internal standard's Ct value and the logarithm of the target concentration. Thus, compared to conventional relative nucleic acid quantification methods, internal standard-based methods introduce the internal standard into the calculation process, which not only monitors the nucleic acid extraction and amplification processes but also compensates for and corrects for target loss during nucleic acid extraction or target inhibition during nucleic acid amplification. Furthermore, internal standard-based relative nucleic acid quantification methods do not require the plotting of a standard curve for each experiment; only one standard curve needs to be plotted for each batch of kits at the time of manufacture, and this standard curve can be used to calculate the concentration when measuring unknown samples. However, the currently available methods for relative quantification of nucleic acids involving internal standards only achieve the quantitative detection of one target in the same reaction tube through the internal standard, which cannot meet the requirements for the quantitative detection of multiple targets in a sample. Summary of the Invention
[0005] To address the aforementioned problems, this invention provides a multiplex PCR kit for the quantitative detection of bacterial concentrations of multiple target pathogens using an internal standard method. The detection PCR kit includes an internal standard quantitative nucleic acid sequence, which is used for the quantitative detection of bacterial concentrations of all target pathogens using an internal standard method. The internal standard quantitative nucleic acid sequence is designed and synthesized based on the amplicon sequences and lengths of all target pathogens. The internal standard quantitative nucleic acid sequence includes upstream and downstream primer sequences for amplifying the amplicon sequence of each target pathogen and an internal standard probe sequence that does not overlap with the amplicon sequence of the target pathogen. The internal standard probe sequence is located between all upstream primer sequences and all downstream primer sequences; the sequence length between the first base of the upstream primer and the last base of the downstream primer used to amplify the amplicon sequence of each target pathogen in the internal standard quantitative nucleic acid sequence differs from the length of the corresponding target pathogen amplicon sequence by no more than ±5 bp; the multiplex PCR kit also includes an internal standard probe sequence for detecting the internal standard quantitative nucleic acid sequence and a probe sequence for detecting the amplicon sequence of each target pathogen, with different fluorescent markers for each probe, detected in different fluorescence channels of the PCR instrument.
[0006] In one embodiment, the internal standard quantitative nucleic acid sequence is a DNA sequence or an RNA sequence.
[0007] In one embodiment, a multiplex PCR detection method is provided for the quantitative detection of bacterial concentration of multiple target pathogens using an internal standard method, wherein the multiplex PCR detection method uses the aforementioned multiplex PCR kit.
[0008] In one embodiment, the detection method includes determining the copy number concentration of a fixed concentration of internal standard quantitative nucleic acid sequence corresponding to the bacterial concentration of each of a plurality of target pathogens, i.e., serially diluting the standard of each target pathogen with known bacterial concentration within a linear range, adding the fixed concentration of internal standard quantitative nucleic acid sequence to each of the above standards in a certain proportion, performing nucleic acid extraction and purification, detecting the extracted nucleic acid using a multiplex reaction solution, statistically analyzing the Ct values at different concentrations of the standard for each target pathogen, and using log for different concentrations of the standard for each target pathogen. 10 A standard curve was plotted with the logarithm as the x-axis and the detection Ct values at different concentrations of the standard as the y-axis. The slope and intercept of the standard curve for each target pathogen were calculated. Furthermore, the detection Ct values of each internal standard quantitative nucleic acid sequence for each target pathogen were statistically analyzed. Based on the formula: N 0内标 =10^((internal standard Ct mean - intercept) / slope), to obtain the copy number concentration of the fixed concentration of internal standard quantitative nucleic acid sequence corresponding to the bacterial concentration N of each pathogen. 0内标 Then, under the same PCR amplification conditions and with the same fixed concentration of internal standard for quantifying nucleic acid sequence copy number, according to N... 0靶标 =2 (Ct内标-Ct靶标) ×N 0内标 The bacterial concentration of each pathogen among multiple target pathogens was calculated.
[0009] This invention employs a multi-target internal standard quantification method using fluorescence PCR technology. It is a molecular quantification technique that simultaneously detects multiple target sequences and introduces internal standards. By designing multi-target internal standard quantification DNA or RNA sequences, these sequences are added during sample nucleic acid extraction. A concentration relationship between multiple targets and internal standard sequences is established. Internal standard genes at known concentrations are added to the sample to be tested. A formula is established between the concentrations of internal standard genes and target genes. Using the concentration of one internal standard gene and the detection and concentration calculation methods for multiple target samples, the concentrations of multiple target genes in the sample to be tested are calculated. Compared with existing technologies, this invention has the following advantages.
[0010] 1. The method of the present invention uses an internal standard probe and an internal standard quantitative nucleic acid sequence to achieve quantitative detection of multiple target bacterial solutions in one reaction well.
[0011] 2. Correcting experimental errors and improving the accuracy of quantitative results: The internal standard undergoes the nucleic acid extraction process simultaneously with the sample, which can correct for losses caused by differences in extraction reagents and operations (such as inefficient lysis and adsorption loss).
[0012] 3. Standardize loading variation and correct loading volume error: Manual loading (e.g., pipetting error) or differences in sample viscosity may cause fluctuations in template volume. Internal standards can standardize loading differences between different samples; the formula is: target concentration = 2 (Ct 内标-Ct靶标) × Internal standard concentration, the effect of sample volume is offset by ΔCt.
[0013] 4. Improve repeatability and comparability: Internal standards can reduce the variability caused by different experimental batches, operators or instrument fluctuations, making cross-platform data more comparable; Applicable to complex samples: For samples with complex components such as blood, feces, and sputum, internal standards can correct for matrix effects and avoid false negatives / false positives.
[0014] 5. Quality control and result verification, and determination of experimental validity: If the internal standard does not amplify, it indicates sample extraction failure or severe inhibition, and the result is invalid and needs to be retested. Distinguishing between true and false negatives: If the target is not detected, normal amplification of the internal standard can rule out technical errors and confirm a "true negative". Attached Figure Description
[0015] To more clearly illustrate the technical solutions in the embodiments of this application, the accompanying drawings used in the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments recorded in this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0016] Figure 1 This is the standard curve diagram of Streptococcus pneumoniae of the present invention; Figure 2 The standard curve of Haemophilus influenzae according to the present invention; and Figure 3 This is a standard curve diagram of Klebsiella pneumoniae for the present invention. Detailed Implementation
[0017] To enable those skilled in the art to better understand the technical solutions in this application, the present invention will be further described below with reference to embodiments. Obviously, the embodiments are merely examples and should not be construed as limiting the present invention. Based on the embodiments in this application, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of this application. The experimental methods used in this invention are all conventional methods, and the experimental equipment, materials, reagents, etc. used can all be obtained commercially.
[0018] Unless otherwise specified, the methods described in the following examples are conventional in the art. All reagents used in the examples are commercially available. Reaction buffers and detection enzyme solutions were purchased from specialized raw material companies; primers and probes used were synthesized by Shanghai Bioengineering Technology Service Co., Ltd.
[0019] Example 1: Specific Implementation Steps of the Method of the Invention This invention introduces a competitive internal standard that is highly similar to the target gene but has a different probe binding region, enabling the simultaneous and specific quantification of multiple targets in the same reaction system and correcting for errors throughout the experimental process. The internal standard and the target use the same upstream and downstream primers to ensure consistent amplification efficiency. Simultaneously, the internal standard's intermediate sequence differs from the target probe binding region, allowing it to be recognized only by the internal standard-specific probe, thus avoiding signal cross-recognition. The specific implementation steps of this invention are illustrated through the development process of quantitative detection reagents for Streptococcus pneumoniae, Haemophilus influenzae, and Klebsiella pneumoniae.
[0020] 1. Synthesis of DNA sequences for internal standard quantification Based on the amplicon sequences of Streptococcus pneumoniae (SP), Haemophilus influenzae (HI), and Klebsiella pneumoniae (KPN), an internal standard quantitative DNA sequence was designed and synthesized. This sequence contains upstream and downstream primer sequences for amplifying the amplicon sequences of Streptococcus pneumoniae (SP), Haemophilus influenzae (HI), and Klebsiella pneumoniae (KPN), and an internal standard probe sequence that does not overlap with the amplicon sequences of the target pathogens. The internal standard probe sequence is located between all upstream and downstream primer sequences, in the middle of each target amplicon sequence. The specific sequence is shown in SEQ ID No. 1: CACTCAACTGGGAATCCG CTTTTAATGAATTAAAACGTATCAAAACGGCTTATCCCGACAGCCCGG AGCGCAGTGACTTTCTCAGCAACATGTCGGTTTTTCAAATAGTAC ACCGGCTGGGGATCCA A GACCCAAAGGGTTATTGGGTAA A GCGGTTGGAATGCTGAGA CC The primer and probe sequences for Streptococcus pneumoniae, Haemophilus influenzae, and Klebsiella pneumoniae, as well as the internal standard probe sequences, are shown in Table 1.
[0021] Table 1
[0022] 2. Prepare reaction solution by combining target primer / probe and internal standard probe sequences. The composition of reaction solutions containing primer and internal standard probe sequences for Streptococcus pneumoniae, Haemophilus influenzae, and Klebsiella pneumoniae is shown in Table 2.
[0023] Table 2
[0024] 3. Establish concentration relationships between multiple target and internal standard sequences. The known concentrations of Streptococcus pneumoniae, Haemophilus influenzae, and Klebsiella pneumoniae strains were increased from 10... 8 CFU / mL serially diluted to 10 3 CFU / mL, repeated 3 times, with the internal standard quantified DNA diluted to 10 according to the assay concentration. 5 Copies / mL were added to different concentrations of bacterial strains at a ratio of 10:1 (strain volume: internal standard quantified DNA volume) for nucleic acid extraction and purification. The extracted nucleic acids were then detected using multiplex reaction buffer. The Ct values for Streptococcus pneumoniae, Haemophilus influenzae, and Klebsiella pneumoniae were statistically analyzed. Standard curves were plotted using the concentrations and Ct values of Streptococcus pneumoniae, Haemophilus influenzae, and Klebsiella pneumoniae, respectively, and the slope and intercept of each target were calculated. The Ct values of each internal standard under different targets were statistically analyzed, and the mean Ct value was calculated. The relationship between the internal standard quantified DNA sequence and the concentration of each target was calculated using the slope and intercept of each target standard. The statistical analysis of the Ct values of each strain concentration and the Ct values of the internal standard is shown in Table 3. The calculated slopes and intercepts for different strains yielded the results for Streptococcus pneumoniae, Haemophilus influenzae, and Klebsiella pneumoniae, as shown in Table 4.
[0025] Table 3
[0026] Table 4
[0027] Standard curves were established using standards for each strain. The relationship between the detection value of the internal standard and the target concentration for each target was calculated using the formula: "Target concentration relationship = 10^((internal standard Ct mean - intercept) / slope". The results are shown in the table above.
[0028] 4. Methods for detecting and calculating the concentration of multiple target samples.
[0029] By establishing the concentration relationship between multiple targets and internal standard sequences as described above, the concentration of each target corresponding to the internal standard quantitative DNA sequence is determined. The target concentration is then calculated by establishing a method for calculating target concentration based on amplification efficiency.
[0030] Calculations are based on the core formula of fluorescent PCR: Under ideal conditions, the amount of product doubles per PCR cycle (efficiency E=100%), therefore the amplification formula is: N n =N0×2 n N n : Number of copies after the nth iteration, N0: Initial number of copies.
[0031] When fluorescence reaches the threshold (Ct value): Nthreshold =N0×2 Ct Internal standard quantitative ratio of DNA or RNA sequence to target For both target and internal control quantitative DNA or RNA sequences, the initial copy number required to reach the same fluorescence threshold satisfies the following:
[0032] The initial target concentration was obtained after deformation: N 0靶标 =2 (Ct内标-Ct靶标) ×N 0内标 The concentration of each target in the sample can be calculated by the difference in Ct values between each target and the internal standard, and the relationship between the concentrations of the target and the internal standard. The calculation methods for the concentrations of Streptococcus pneumoniae, Haemophilus influenzae, and Klebsiella pneumoniae are shown in Table 5.
[0033] Table 5
[0034] Example 2: Detection of bacterial strain samples I. Detection Results of Different Strains Twelve KPN standard strains, SP standard strains, and HI standard strains at different concentrations were selected, along with 45 mixed standard strain samples. The prepared 10 5 Copies / mL of internal standard were added to samples of different concentrations of bacterial strains at a ratio of 10:1 (strain volume:internal standard quantified DNA volume). Nucleic acid extraction and purification were performed. The extracted nucleic acid was detected using a multiplex reaction solution. The Ct values of each target detection and the internal standard detection were statistically analyzed. The concentrations of each standard strain were calculated using the method described in Table 5 ("Calculation Method for Concentrations of Streptococcus pneumoniae, Haemophilus influenzae, and Klebsiella pneumoniae"). If the difference between the logarithm of the detected concentration and the logarithm of the strain concentration was <0.45, the detected value was considered to be highly consistent with the strain concentration. The results are shown in Tables 6-1 and 6-2 below. Tables 6-1 and 6-2 show the Ct values of internal standard quantification and the calculated concentration values of each bacterial strain sample. This method was used to detect 45 mixed bacterial culture samples of 12 different concentrations of KPN, SP, and HI strains. The concentration of each strain was calculated by detecting the Ct value of the internal standard and establishing the target concentration relationship. The difference between the logarithm of the detected concentration and the logarithm of the strain concentration was statistically analyzed. The difference was less than 0.45. The detection concentration of each standard strain using the multi-target pathogen internal standard quantification method was consistent with the standard concentration.
[0035] Table 6-1
[0036] Table 6-2
[0037] Detection results of sample in Example 3 Thirty-two clinical specimens were tested using a multiplex internal standard detection reagent for Streptococcus pneumoniae, Haemophilus influenzae, and Klebsiella pneumoniae. Ten prepared reagents were then used. 5 Copies / mL internal standard were added to samples of different concentrations of bacterial strains at a ratio of 10:1 (clinical sample volume: internal standard quantitative DNA volume) for nucleic acid extraction and purification. The extracted nucleic acids were then detected using a multiplex reaction solution. The Ct values for each target detection and the Ct value for the internal standard detection were statistically analyzed. The detection concentrations of each sample calculated using Table 5 were compared with the theoretical concentrations using regression analysis and t-paired t-tests to evaluate the consistency of the results.
[0038] Of the 32 samples, 14 were positive for Streptococcus pneumoniae. Linear regression analysis was performed in SPSS using the logarithm of the theoretical concentration and the logarithm of the sample concentration of Streptococcus pneumoniae. The analysis showed an R-value of 0.998, indicating a very high correlation between the theoretical and sample concentrations of Streptococcus pneumoniae; R² = 0.996, indicating an excellent fit between the two concentration models. Analysis of variance showed F = 2800.856, with a significance level of p = 0.000, indicating that the regression model was highly significant overall. The constant term (intercept) was -0.042, with p = 0.747, indicating no significant difference between the sample concentration and the theoretical concentration of 0. The theoretical concentration coefficient was 1.032, with p = 0.000, highly significant: for every 1 unit increase in theoretical concentration, the sample concentration was expected to increase by 1.032 units. The standardized coefficient Beta = 0.999 indicates that the theoretical concentration has an almost completely positive effect on the sample concentration, and the sample concentration of Streptococcus pneumoniae detected by multiplex internal standard detection reagents is consistent with the theoretical concentration.
[0039] Of the 32 samples, 29 were positive for Klebsiella pneumoniae. Linear regression analysis was performed in SPSS using the logarithm of the theoretical concentration and the logarithm of the sample concentration of Klebsiella pneumoniae. The results showed R=0.995, indicating an almost positive correlation between the theoretical concentration and the sample concentration; R²=0.991, indicating an excellent fit between the two concentration models. Analysis of variance showed F=2906.153, with a significance level of p=0.000, indicating that the regression model was highly significant overall. The constant term (intercept) was -0.397, significant (p=0.001), and the sample concentration was significantly negative (-0.397) when the theoretical concentration was 0. The theoretical concentration coefficient was 1.047, which was highly significant (p<0.001), and the standardized coefficient Beta was 0.995. This indicates that the theoretical concentration has an almost completely positive effect on the sample concentration, and the sample concentration of Klebsiella pneumoniae calculated by the multiplex internal standard detection reagent is consistent with the theoretical concentration.
[0040] Of the 32 samples, 19 were positive for Haemophilus influenzae. Linear regression analysis was performed in SPSS using the logarithm of the theoretical concentration and the logarithm of the sample concentration of Haemophilus influenzae. The results showed R=0.995, indicating an almost positive correlation between the theoretical concentration and the sample concentration; R²=0.991, indicating an excellent fit between the two concentration models. Analysis of variance showed F=1867.953, with a significance level of p=0.000, indicating a highly significant regression model overall. The regression coefficients showed a constant term (intercept) of -0.117, which was not significant (p=0.266), while the theoretical concentration coefficient was 0.980, which was highly significant (p<0.001). The standardized coefficient Beta=0.995, indicating that the theoretical concentration had an almost completely positive impact on the sample concentration, demonstrating that the sample concentration of Haemophilus influenzae calculated by the multiplex internal standard detection reagent is consistent with the theoretical concentration.
[0041] Example 4: Validation of the accuracy of internal standard detection by different amplicon lengths of the internal standard product The accuracy of the sample results was verified according to the method in Example 1 using amplicon sequences of different lengths synthesized according to Table 7 below. Table 8 shows the consistency analysis results of the target strain concentration calculated using internal standard sequence 1 (amplicon sequence length on internal standard - single target length - 15 bp), Table 9 shows the consistency analysis results of the target strain concentration calculated using internal standard sequence 2 (amplicon sequence length on internal standard - single target length - 5 bp), Table 10 shows the consistency analysis results of the target strain concentration calculated using internal standard sequence 3 (amplicon sequence length on internal standard equal to single target length), Table 11 shows the consistency analysis results of the target strain concentration calculated using internal standard sequence 4 (amplicon sequence length on internal standard + single target length + 5 bp), and Table 12 shows the consistency analysis results of the target strain concentration calculated using internal standard sequence 5 (amplicon sequence length on internal standard + single target length + 15 bp).
[0042] Table 7
[0043] Table 8
[0044] As shown in Table 8, when the length of the amplicon sequence of the internal standard quantitative nucleic acid sequence is 15 bp shorter than the length of the target amplicon sequence, the absolute value of the calculated result is greater than 0.45 compared to the logarithmic value of the theoretical concentration, indicating inconsistency between the internal standard quantitative result and the actual result.
[0045] Table 9
[0046] As shown in Table 9, when the length of the amplicon sequence of the internal standard quantified DNA / RNA sequence is 5 bp shorter than the length of the target amplicon sequence, the absolute value of the calculated result and the logarithm of the theoretical concentration is less than 0.45, indicating that the quantification result of the internal standard is consistent.
[0047] Table 10
[0048] Table 10 shows that when the length of the amplicon sequence of the internal standard quantified DNA / RNA sequence is consistent with the length of the target amplified sequence, the absolute value of the calculated result and the logarithm of the theoretical concentration is less than 0.45, indicating that the quantification result of the internal standard is consistent.
[0049] Table 11
[0050] As can be seen from the results in Table 11, when the length of the amplicon sequence of the internal standard quantified DNA / RNA sequence is more than 5 bp longer than the length of the target amplicon sequence, the absolute value of the calculated result and the logarithm of the theoretical concentration is less than 0.45, which is consistent with the quantification result of the internal standard.
[0051] Table 12
[0052] As can be seen from Table 12, when the length of the amplicon sequence of the internal standard quantification DNA / RNA sequence is 15 bp longer than the length of the target amplicon sequence, the absolute value of the calculated result and the logarithmic value of the theoretical concentration are greater than 0.45, indicating that the quantification result of the internal standard is inconsistent.
[0053] As can be seen from Tables 8-12, when the length of the amplicon sequence of the internal standard quantified DNA / RNA sequence is consistent with that of the target amplified sequence or the length difference is no more than 5 bp (+5b / -5bp), the concentration value detected by the method of internal standard quantification for multiple target pathogens is consistent with the theoretical concentration.
[0054] It should be understood that the disclosed invention is not limited to the specific methods, schemes, and substances described, as these are all subject to variation. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to limit the scope of the invention, which is limited only by the appended claims.
[0055] Those skilled in the art will also recognize, or be able to identify, many equivalents of the specific embodiments of the invention described herein using no more than conventional experiments. These equivalents are also included in the appended claims.
Claims
1. A multiplex PCR kit for quantitative detection of bacterial concentrations of multiple target pathogens using an internal standard method, characterized in that, The detection PCR kit includes an internal standard quantitative nucleic acid sequence, which is used for the internal standard method of quantitative detection of bacterial concentration of all target pathogens. The internal standard quantitative nucleic acid sequence is designed and synthesized based on the amplicon sequences and lengths of all target pathogens. The internal standard quantitative nucleic acid sequence includes the sequences of upstream and downstream primers for amplifying the amplicon sequence of each target pathogen and an internal standard probe sequence that does not overlap with the amplicon sequence of the target pathogen. The internal standard probe sequence is located between all upstream primer sequences and all downstream primer sequences. The length of the sequence between the first base of the upstream primer and the last base of the downstream primer for amplifying the amplicon sequence of each target pathogen in the internal standard quantitative nucleic acid sequence does not differ from the length of the corresponding target pathogen amplicon sequence by more than ±5 bp. The multiplex PCR kit also includes an internal standard probe sequence for detecting the internal standard quantitative nucleic acid sequence and a probe sequence for detecting the amplicon sequence of each target pathogen, with different fluorescent markers for each probe, and detection in different fluorescence channels of the PCR instrument.
2. The multiplex PCR kit according to claim 1, characterized in that, The internal standard quantitative nucleic acid sequence is a DNA sequence or an RNA sequence.
3. A multiplex PCR detection method for quantitative detection of bacterial concentrations of multiple target pathogens using an internal standard method, characterized in that, The multiplex PCR detection method uses the multiplex PCR kit described in claim 1.
4. The multiplex PCR detection method according to claim 3, characterized in that, The detection method includes determining the copy number concentration of a fixed concentration of internal standard quantitative nucleic acid sequence corresponding to the bacterial concentration of each of the multiple target pathogens; serially diluting the standard of each target pathogen with known bacterial concentration within a linear range; adding the fixed concentration of internal standard quantitative nucleic acid sequence to each of the above standards in a certain proportion; performing nucleic acid extraction and purification; detecting the extracted nucleic acid using a multiplex reaction solution; statistically analyzing the Ct values at different concentrations of the standard for each target pathogen; and using log for different concentrations of the standard for each target pathogen. 10 A standard curve was plotted with the logarithm as the x-axis and the detection Ct values at different concentrations of the standard as the y-axis. The slope and intercept of the standard curve for each target pathogen were calculated. Furthermore, the detection Ct values of each internal standard quantitative nucleic acid sequence for each target pathogen were statistically analyzed. Based on the formula: N 0内标 =10^((internal standard Ct mean - intercept) / slope), to obtain the copy number concentration of the fixed concentration of internal standard quantitative nucleic acid sequence corresponding to the bacterial concentration N of each pathogen. 0内标 Then, under the same PCR amplification conditions and the same fixed concentration of internal standard for quantifying nucleic acid sequence copy number, according to N... 0靶标 =2 (Ct内标-Ct靶标) ×N 0内标 The bacterial concentration of each pathogen among multiple target pathogens was calculated.