Primer probe composition for detecting KPC type carbapenem drug resistance gene and application
By designing highly conserved site primers and TaqMan probes and optimizing the qPCR reaction system, the problems of long detection time, missed detection, and cross-reaction in KPC-type carbapenem resistance gene detection were solved, achieving rapid, accurate, and highly sensitive detection results.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-05
- Publication Date
- 2026-03-13
AI Technical Summary
Existing methods for detecting KPC-type carbapenem resistance genes suffer from problems such as long detection time, missed detection of some subtypes, cross-reactivity with other carbapenemase genes, and insufficient sensitivity.
We designed highly conserved primers and specific TaqMan probes covering all subtypes, optimized the qPCR reaction system, and constructed a rapid, accurate, highly specific, and highly sensitive detection platform.
It enables testing to be completed within 45 minutes, significantly improving the sensitivity and coverage of the test. It is suitable for clinical screening, hospital infection monitoring, and environmental sample testing, and has high specificity and repeatability.
Smart Images

Figure CN121653273A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological detection technology, specifically to a primer-probe composition for detecting KPC-type carbapenem resistance genes and its application. Background Technology
[0002] Carbapenems, due to their broad-spectrum, high efficacy, and strong stability, are widely used in the treatment of severe Gram-negative bacterial infections and are considered one of the important last-line drugs for the clinical treatment of drug-resistant infections. However, in recent years, with the rapid spread of carbapenemases in Enterobacteriaceae, the efficacy of carbapenems has been seriously threatened, and their resistance mechanisms have become a major concern in the global public health field. Among the many types of carbapenemases, KPC (Klebsiella pneumoniae carbapenemase) enzymes have attracted much attention due to their rapid spread, wide host range, and high resistance levels. KPC genes are mostly carried on mobile genetic elements such as plasmids, which can be horizontally transferred between different strains, leading to the spread of resistance and significantly increasing the difficulty of clinical infection treatment.
[0003] Currently, over 50% of carbapenem-resistant Enterobacteriaceae carry the KPC gene, making it one of the most prevalent carbapenem resistance genes globally. The KPC gene exhibits frequent mutations and numerous subtypes. As of 2025, international databases have included over 270 KPC subtypes, with sequence differences between subtypes but retaining a certain degree of conserved regions. This characteristic presents challenges for molecular detection: improperly designed detection systems may miss some subtypes or exhibit cross-reactivity with other carbapenemase genes. Therefore, constructing rapid detection methods that can simultaneously cover all KPC subtypes and rigorously distinguish other resistance genes is a crucial research direction in the field of molecular diagnostics.
[0004] Current methods for KPC detection mainly include phenotypic assays, conventional PCR, electrophoresis analysis, and commercial molecular detection platforms. Phenotypic assays, such as the modified Hodge assay and the Carba NP assay, rely on the enzymatic performance of the strain. Although they can reflect enzyme activity, the procedures are complex, highly susceptible to subjective judgment, and require long incubation times (usually 24–48 hours), making them difficult to meet the clinical demand for rapid detection. Conventional PCR can provide results within hours, but still requires electrophoresis interpretation, which carries the risk of contamination due to opening the sample, inaccurate quantification, and difficulty in accurately distinguishing nonspecific amplifications in complex samples. Furthermore, because PCR amplification is highly dependent on primer sequences, insufficient primer coverage may prevent the identification of some KPC subtypes, leading to false negatives.
[0005] In recent years, real-time quantitative PCR (qPCR) technology has been widely used in the molecular diagnosis of pathogenic microorganisms due to its advantages such as high sensitivity, high specificity, closed-tube operation, and quantitative detection. In multiple drug resistance gene detection systems, TaqMan probes have shown superior specificity compared to SYBR Green probes because their signal generation depends on a perfect match between the probe sequence and the target, effectively reducing false positives caused by non-specific amplification. However, to achieve accurate coverage of all KPC subtypes, it is necessary to screen for highly conserved sites from massive sequence alignments and strictly eliminate the risk of cross-binding with other carbapenemases such as NDM, VIM, IMP, and OXA sequences. Currently, the number of primer-probe systems covering multiple KPC subtypes is limited, and some methods have shortcomings in sensitivity or specificity. Furthermore, the sensitivity of different detection systems in existing literature varies significantly, with most methods having a detection limit of tens to hundreds of copies / μL, which is insufficient for high-sensitivity scenarios (such as environmental sample monitoring or early infection screening). Summary of the Invention
[0006] To address the aforementioned problems, this invention aims to provide a primer and probe composition for detecting KPC-type carbapenem resistance genes and its applications. By constructing primers covering all subtypes with highly conserved sites and specific TaqMan probes, and optimizing the qPCR reaction system, rapid, accurate, highly specific, and highly sensitive detection of KPC is achieved.
[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: On the one hand, a primer-probe composition for detecting KPC-type carbapenem resistance genes, the primer-probe composition comprising: Primer pairs, including a forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer is shown in SEQ ID NO:1 and the nucleotide sequence of the reverse primer is shown in SEQ ID NO:2; The probe has the nucleotide sequence shown in SEQ ID NO:3.
[0008] Secondly, the 5′ end of the probe is labeled with a fluorescent group, which is selected from FAM, VIC, HEX, CY5, and TET. The 3′ end of the probe is labeled with a quenching group, which is selected from BHQ1, BHQ2, TAMRA, and MGB.
[0009] Thirdly, the final concentration of both the forward and reverse primers in the real-time fluorescence PCR reaction system was 0.3 μmol / L.
[0010] Fourthly, the final concentration of the probe in the real-time fluorescence PCR reaction system was 0.10 μmol / L.
[0011] Fifthly, a real-time fluorescent PCR kit for detecting KPC-type carbapenem resistance genes, characterized in that the kit includes a primer-probe composition for detecting KPC-type carbapenem resistance genes.
[0012] Sixthly, the real-time fluorescence PCR kit also includes: The fluorescent PCR premix contains Taq DNA polymerase and dNTPs; Positive control sample, which contains bacterial genomic nucleic acid containing the blaKPC gene; Negative control sample, which is bacterial genomic nucleic acid that does not contain blaKPC; Nuclease-free water; Instruction manual.
[0013] Seventhly, a non-diagnostic or therapeutic method for detecting KPC-type carbapenem resistance genes, comprising the following steps: Nucleic acid is extracted from the sample to be tested to obtain a sample DNA template; Configure the reaction system, which includes: primer and probe composition for detecting KPC carbapenem resistance gene, fluorescent PCR premix, DNA template, quality control nucleic acid template, nuclease-free water or real-time fluorescent PCR kit for detecting KPC carbapenem resistance gene. The prepared reaction system was placed in a real-time fluorescence quantitative PCR instrument for amplification, and the fluorescence signal was monitored in real time. The presence of the KPC gene in the sample to be tested can be determined based on the amplification curve or the cycle threshold.
[0014] The eighth aspect, the amplification procedure includes: Pre-denaturation: 95 ℃, 2 minutes; The loop repeats 40 times, each time including: Denaturation at 95°C for 8 seconds; Annealing / extending at 62 °C for 5 seconds, and acquiring fluorescence signals at this temperature.
[0015] Ninthly, the lowest detection limit of the method is 0.04 copies / μL.
[0016] The tenth aspect is the application of a real-time fluorescence PCR kit for detecting KPC-type carbapenem resistance genes in the detection of KPC-type carbapenem resistance genes in non-diagnostic or non-therapeutic cases.
[0017] Compared with existing technologies, the primer and probe composition for detecting KPC-type carbapenem resistance genes and its application in this invention bring the following significant advantages: 1. This invention, by comparing the sequences of all KPC subtypes, screens out highly conserved and optimally specific target regions. The designed primers and TaqMan probes can cover all KPC subtypes in the existing database, effectively avoiding the false negative problem that is prone to occur in conventional detection methods. This composition exhibits consistent amplification characteristics among different KPC positive strains, significantly improving the inclusiveness and reliability of detection; 2. The TaqMan qPCR system constructed in this invention exhibits extremely high specificity. Its primers and probes have undergone rigorous cross-alignment verification and do not exhibit non-specific binding to common carbapenemase genes such as NDM, VIM, IMP, and OXA. Experiments have confirmed 100% specificity. Compared to traditional PCR or SYBR Green detection modes, this system effectively avoids false positive signals, ensuring the accuracy and reproducibility of result interpretation. 3. The qPCR system established in this invention, after optimization of reaction conditions, achieves ultra-high sensitivity, with a detection limit of 0.04 copies / μL and a linear range covering 0.06–5.89 × 10⁻⁶. 5 copies / μL (8 orders of magnitude), linear correlation coefficient R ²≥0.999, amplification efficiency 98.612%. Its excellent quantitative performance makes it suitable for accurate detection of samples with different concentration gradients, especially for early infection screening and low-load sample detection; 4. The KPC gene detection kit developed in this invention includes primers, probes, premixed solutions, and quality control materials. It can complete the detection within 45 minutes. The overall operation is simple, and the closed-tube operation reduces the risk of contamination. It exhibits good repeatability (CV < 5%). This kit is suitable for clinical samples, environmental samples, and pure colonies, and can meet the needs of various application scenarios such as hospital infection control monitoring, drug-resistant bacteria tracing, and public health screening. It has significant application value and promotion potential. Attached Figure Description
[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0019] Figure 1 This is the melting curve diagram in Embodiment 2 of the present invention, with the horizontal axis representing temperature and the vertical axis representing the negative derivative of the fluorescence signal (–dF / dT). Figure 2 This is an electrophoresis image of the annealing temperature optimization in Embodiment 3 of the present invention (Agilent 4150 TapeStation automated electrophoresis platform). Figure 3This is a primer concentration optimization graph in Example 3 of the present invention. The horizontal axis represents the primer concentration in the system, and the vertical axis represents the corresponding cycle threshold (Ct value). Figure 4 This is a graph showing the probe concentration optimization in Example 3 of the present invention. The horizontal axis represents the probe concentration in the system, and the vertical axis represents the corresponding Ct value. Figure 5 This is a diagram showing the amplification of the KPC-positive pneumonia Klebsiella pneumoniae genome at different concentrations in Example 4 of this invention; Figure 6 This is a standard curve obtained by qPCR detection using the primers and probes described in Example 4 of the present invention.
[0020] Figure 7 This is the amplification curve of 21 repeated qPCR tests performed using the primers and probes in Example 4 of the present invention at a KPC concentration of 0.04 copies / μL. Detailed Implementation
[0021] This application proposes a primer-probe composition for detecting KPC-type carbapenem resistance genes and its application, mainly to solve the problems of long detection time, missed detection of some subtypes, cross-reactivity with other carbapenemase genes, and insufficient sensitivity in existing KPC gene detection technologies. Figure 1-7 As shown, this application systematically compares all KPC subtypes using bioinformatics to screen highly conserved and discriminative specific target regions, and designs a pair of specific primers and a TaqMan probe based on these regions. Simultaneously, by optimizing the qPCR reaction system, annealing temperature, and primer / probe concentrations, a highly efficient, stable, and rapid quantitative PCR detection platform is constructed. This enables rapid amplification and accurate identification of KPC, allowing detection to be completed within 45 minutes. While maintaining specificity, it significantly improves detection sensitivity and coverage, making it suitable for various applications such as clinical screening, hospital infection control, and environmental sample testing.
[0022] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading the teachings of this invention, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.
[0023] Example 1 Primer and probe design and synthesis were based on conserved sequences of all KPC gene subtypes in GenBank. Specific primers and TaqMan probes were designed using primer design software (Primer Express 3.0.1). Specificity was verified by BLAST to ensure that they matched only the KPC gene sequence. However, dimers may form between the designed primers and / or probes, and to ensure the specificity of the design in complex systems, the primers, probes, and reaction systems were designed, optimized, and repeatedly tested for verification.
[0024] The designed primer pairs and probes are as follows: Forward primer (SEQ ID NO: 1): 5'-CTGACCAACCTCGTCGCGGAA-3' Reverse primer (SEQ ID NO: 2): 5'-CGCCTGAGCCGGTATCCATC-3' TaqMan probe (SEQ ID NO: 3): 5'-[FAM]ATGGAGCCGCCAAAGTCCTGT [BHQ1]-3', the above oligonucleotide was synthesized by a professional biotechnology company and purified by HPLC.
[0025] Example 2: Primer Specificity Verification Using KPC gene-positive Klebsiella pneumoniae nucleic acid as a template, a 25 µL fluorescent PCR system was used, with 1 µL of 0.93 ng / µL (qubit quantification) template added. The remaining components of the PCR system included: 2×Rapid Taq Master Mix, 0.2 µmol / L forward primer, 0.2 µmol / L reverse primer, SYBR Green I 0.2X, 2.5 mmol / L MgCl2, and the remainder was nuclease-free water.
[0026] Amplification program Place the above reaction tubes in a real-time PCR instrument (Hongshi) and perform the following cycles: Pre-denaturation at 95 ℃ for 2 min; 95 ℃ for 8 s, 60 ℃ for 15 s, for a total of 45 cycles; Finally, melting curves were collected at 95 ℃ for 15 s, 45 ℃ for 1 min, and 95 ℃ with a heating rate of 0.03 ℃ / s.
[0027] The melting curve results are as follows Figure 1 As shown, a single melting peak appeared only at 84.3 °C, and no primer dimer melting peak was observed in the 75–82 °C range, proving that there was no nonspecific amplification in the system.
[0028] Example 3: Optimization of Fluorescent PCR System Determining the annealing temperature: Lower annealing temperatures can increase primer-template binding efficiency, thereby increasing amplification. However, they can also lead to non-specific binding and amplification of primers in complex genomes. Therefore, choosing an appropriate annealing temperature is crucial for the reaction system. Figure 2 As shown, by optimizing the annealing temperature of the low target concentration system (KPC gene concentration 1700 copies / reaction), 62℃ was finally determined as the optimal annealing temperature of the system, which means that there is no non-specific amplification under low template conditions and the amplification efficiency is high.
[0029] Primer final concentration optimization: like Figure 3 As shown, FAM / BHQ1 hydrolysis probe was immobilized at 0.4 µmol / L, and KPC-positive bacterial genomic DNA (1.7 × 10⁻⁶) was used. 7 Using a copy / reaction method as a template, eleven concentration gradients (0.05 µmol / L, 0.10 µmol / L, 0.20 µmol / L, 0.30 µmol / L, 0.40 µmol / L, 0.50 µmol / L, 0.60 µmol / L, 0.70 µmol / L, 0.80 µmol / L, 0.90 µmol / L, and 1.0 µmol / L) were set in a 25 µL system, with each gradient replicated three times. Ct values, melting curves, and 4150 TapeStation electrophoresis images were used as evaluation metrics. The results showed that the optimal final primer concentration was 0.30 μmol / L.
[0030] Optimization of probe final concentration: like Figure 4 As shown, keeping the upstream and downstream primers at 0.4 µmol / L, and using the same template and reaction conditions, eleven concentration gradients were set for the probe: 0.05 µmol / L, 0.10 µmol / L, 0.20 µmol / L, 0.30 µmol / L, 0.40 µmol / L, 0.50 µmol / L, 0.60 µmol / L, 0.70 µmol / L, 0.80 µmol / L, 0.90 µM, and 1.0 µmol / L, with each gradient repeated three times. The evaluation metrics "fluorescence plateau height" and "signal-to-noise ratio (SNR)" were added. The results showed that the fluorescence signal was insufficient at concentrations <0.10 μmol / L, and the background was elevated at concentrations >0.20 μmol / L. The 0.10 μmol / L group had the lowest average Ct value (14.58 ± 0.18) and the highest average Rn value; therefore, the optimal final probe concentration was determined to be 0.10 μmol / L.
[0031] Therefore, the optimal annealing temperature in the PCR reaction system was determined to be 62 °C, the final concentration of both upstream and downstream KPC primers was 0.3 μmol / L, and the final concentration of the KPC probe was 0.1 μmol / L. Under these conditions, the amplification efficiency was the highest, and there were no non-specific signals.
[0032] PCR amplification program In order to obtain detection results quickly, we designed the amplification procedure as a two-step method. After comparison with the three-step method, there was no significant difference. After multiple rounds of experimental verification and optimization of the reaction time, we determined that the following procedure (Table 1) can obtain accurate detection results in the shortest time.
[0033] Table 1 Amplification Procedure
[0034] Example 4: Analysis of Method Performance The following experiments all use the final system from Example 3. System specificity analysis: Plasmid DNA containing the KPC, IMP, OXA, NDM, and VIM genes, as well as a mixed template, were synthesized and tested. The results showed that only the KPC sample exhibited a typical S-shaped amplification curve, while other samples showed no amplification, demonstrating the extremely high specificity of the method of this invention (see Table 2).
[0035] Table 2 Specificity test results of this detection system
[0036] In addition, genomic nucleic acids from nine different strains (Escherichia coli, Klebsiella pneumoniae, Legionella, Vibrio parahaemolyticus, Staphylococcus aureus, Salmonella, Campylobacter jejuni, Listeria monocytogenes, and Bacillus cereus) were extracted and analyzed individually and in combination. The results showed that strains lacking the KPC gene were all negative, while strains containing only the KPC gene exhibited typical S-shaped amplification curves, further demonstrating the specificity and anti-interference ability of the analytical method. All strains were isolated and cultured at our center and identified by flight mass spectrometry, with genomic nucleic acids extracted using a simple thermal lysis method.
[0037] 2. Optimize system sensitivity, amplification efficiency, and standard curve: After accurately quantifying the KPC-2 gene-containing Klebsiella pneumoniae genomic DNA using a Qubit fluorescence quantitative analyzer, perform 10-fold serial dilutions (concentration range 5.89 × 10⁻⁶). 5 Up to 0.06 copies / μL) were used as standards for qPCR detection. A standard curve was plotted with the logarithm of the standard copy number on the x-axis and the Ct value on the y-axis. The results showed ( Figure 5-6 ), from 0.06 to 5.89 × 10 5 The linear relationship is significant within the range of copies / μL. R²=0.999), the regression equation is amplification efficiency The detection rate was 98.612%, which meets the ideal efficiency range (90%~110%) for quantitative analysis. Furthermore, to validate the method's detection limit, a low-concentration sample (0.04 copies / μL) was repeatedly tested 21 times, establishing the method's detection limit (LoD) as 0.04 copies / μL (100% detection rate). Figure 7 ).
[0038] 3. Precision: To evaluate the repeatability of the method, high (5.9 × 10⁻⁶) values were respectively tested. 5 (Copies / μL), in (6.1×10) 3 Precision was tested using standards at three concentrations: 5 copies / μL, 10 copies / μL, and 5 copies / μL. Precision was calculated using 11 replicate assays in the same run. Results showed that the coefficient of variation (CV) for all Ct values was less than 5% (CV ranged from 1.76% to 2.55%). This result meets industry requirements for qPCR precision (CV < 5%), indicating that the present invention exhibits excellent repeatability and stability under different experimental conditions (Table 3).
[0039] Table 3. Precision of real-time quantitative PCR at different genome concentrations
[0040] Example 5: Comparison of Real-time Quantitative PCR Detection and Sequencing Results of Isolated Strains Twenty-five drug-resistant bacterial strains were isolated from the wastewater environment. Among them, five KPC-positive strains were detected by PCR, and the results were completely consistent with the sequencing results. The detection results for non-KPC genes were all negative. Therefore, the actual sample detection rate of this method was 100%, and it has strong specificity (Table 4). In addition, in the simulated samples of fecal and wastewater metagenomics, samples without KPC genes were all negative. The CT value of the wastewater genome sample with KPC gene added was 22.46 ± 0.23 (positive), and the CT value of the fecal metagenomic sample with KPC gene added was 23.18 ± 0.16, further demonstrating its high resistance to interference and specificity.
[0041] Table 4. Consistency between the real sample detection results and sequencing results of this method
[0042] SEQ ID NO: 1 5'-CTGACCAACCTCGTCGCGGAA-3' SEQ ID NO: 2 5'-CGCCTGAGCCGGTATCCATC-3' SEQ ID NO: 3 ATGGAGCCGCCAAAGTCCTGT SEQ ID NO: 4 ATGTCACTGTATCGCCGTCTAGTTCTGCTGTCTTGTCTCTCATGGCCGCTGGCTGGCTTTTCTGCCACCGCGCTGACCAACCTCGTCGCGGAACCATTCGCTAAACTCGAACAGGACTTTGGCGGCTCCATCGGTGTGTACGCGATGGATACCGGCTCAGGCGCAACTGTAAGTTACCGCGCTGAGGAGCGCTTCCCACTGTGCAGCTCATTCAAGGGCTTTCTTGCTGCCGCTGTGCTGGCTCGCAGCCAGCAGCAGGCCGGCTTGCTGGACACACCCATCCGTTACGGCAAAAATGCGCTGGTTCCGTGGTCACCCATCTCGGAAAAATATCTGACAACAGGCATGACGGTGGCGGAGCTGTCCGCGGCCGCCGTGCAATACAGTGATAACGCCGCCGCCAATTTGTTGCTGAAGGAGTTGGGCGGCCCGGCCGGGCTGACGGCCTTCATGCGCTCTATCGGCGATACCACGTTCCGTCTGGACCGCTGGGAGCTGGAGCTGAACTCCGCCATCCCAGGCGATGCGCGCGATACCTCATCGCCGCGCGCCGTGACGGAAAGCTTACAAAAACTGACACTGGGCTCTGCACTGGCTGCGCCGCAGCGGCAGCAGTTTGTTGATTGGCTAAAGGGAAACACGACCGGCAACCACCGCATCCGCGCGGCGGTGCCGGCAGACTGGGCAGTCGGAGACAAAACCGGAACCTGCGGAGTGTATGGCACGGCAAATGACTATGCCGTCGTCTGGCCCACTGGGCGCGCACCTATTGTGTTGGCCGTCTACACCCGGGCGCCTAACAAGGATGACAAGCACAGCGAGGCCGTCATCGCCGCTGCGGCTAGACTCGCGCTCGAGGGATTGGGCGTCAACGGGCAGTAA SEQ ID NO: 5 CAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAGAAAAGGAAAAGTATGAGCAAGTTATCTGTATTCTTTATATTTTTGTTTTGCAGCATTGCTACCGCAGCAGAGTCTTTGCCAGATTTAAAAATTGAAAAGCTTGATGAAGGCGTTTATGTTCATACTTCGTTTGAAGAAGTTAACGGGTGGGGCGTTGTTCCTAAACATGGTTTGGTGGTTCTTGTAAATGCTGAGGCTTACCTAATTGACACTCCATTTACGGCTAAAGATACTGAAAAGTTAGTCACTTGGTTTGTGGAGCGTGGCTATAAAATAAAAGGCAGCATTTCCTCTCATTTTCATAGCGACAGCACGGGCGGAATAGAGTGGCTTAATTCTCGATCTATCCCCACGTATGCATCTGAATTAACAAATGAACTGCTTAAAAAAGACGGTAAGGTTCAAGCCACAAATTCATTTAGCGGAGTTAACTATTGGCTAGTTAAAAATAAAATTGAAGTTTTTTATCCAGGCCCGGGACACACTCCAGATAACGTAGTGGTTTGGTTGCCTGAAAGGAAAATATTATTCGGTGGTTGTTTTATTAAACCGTACGGTTTAGGCAATTTGGGTGACGCAAATATAGAAGCTTGGCCAAAGTCCGCCAAATTATTAAAGTCCAAATATGGTAAGGCAAAACTGGTTGTTCCAAGTCACAGTGAAGTTGGAGACGCATCACTCTTGAAACTTACATTAGAGCAGGCGGTTAAAGGGTTAAACGAAAGTAAAAAACCATCAAAACCAAGCAACTAAATTTCTAACAAGTCGTTGCAGCAACGTACGTGGCTGGACAGTTTGTAAGTTGCGCTTTTGTGGTTCGTCGCAAAGTATTCCACAACGCGCAACTTCAA SEQ ID NO: 6 ATGAATAAATATTTTACTTGCTATGTGGTTGCTTCTCTTTTTCTTTCTGGTTGTACGGTTCAGCATAATTTAATAAATGAAACCCCGAGTCAGATTGTTCAAGGACATAATCAGGTGATTCATCAATACTTTGATGAAAAAAACACCTCAGGTGTGCTGGTTATTCAAACAGATAAAAAAAATTAATCTATATGGTAATGCTCTAAGCCGCGCAAATACAGAATATGTGCCAGCCTCTACATTTAAAATGTTGAATGCCCTGATCGGATTGGAGAACCAGAAAACGGATATTAATGAAATATTTAAATGGAAGGGCGAGAAAAGGTCATTTACCGCTTGGGAAAAAGACATGACACTAGGAGAAGCCATGAAGCTTTCTGCAGTCCCAGTCTATCAGGAACTTGCGCGACGT ATCGGTCTTGATCTCATGCAAAAAAGAAGTAAAACGGTATTGGTTTCGGTAATGCTGAAATTGGACAGCAGGTTGATAATTTCTGGTTGGTAGGACCATTAAAGGTTACGCCTATTCAAGAGGTAGAGTTTGTTTCCCAATTAGCACATACACAGCTTCCATTTAGTGAAAAAGTGCAGGCTAATGTAAAAAATATGCTTCTTTTAGAAGAGAGTAATGGCTACAAAATTTTTGGAAAGACTGGTTGGGCAATGGATATAAAACCACAAGTGGGCTGGTTGACCGGCTGGGTTGAGCAGCCAGATGGAAAAATTGTCGCTTTTGCATTAAAATATGGAAATGCGGTCAGAAATGCCGGCATCTATACGTAATGTATTATTGATGAAATCATTAAAACAGCTGAATATTATTTAA SEQ ID NO: 7 ATTCGCCCCATATTTTTGCTACAGTGAACCAAATTAAGATCATCTATTTACTAGGCCTCGCATTTGCGGGGTTTTTAATGCTGAATAAAAGGAAAACTTGATGGAATTGCCCAATATTATGCACCCGGTCGCGAAGCTGAGCACCGCATTAGCCGCTGCATTGATGCTGAGCGGGTGCATGCCCGGTGAAATCCGCCCGACGATTGGCCAGCAAATGGAAACTGGCGACCAACGGTTTGGCGATCTGGTTTTCCGCCAGCTCGCACCGAATGTCTGGCAGCACACTTCCTATCTCGACATGCCGGGTTTCGGGGCAGTCGCTTCCAACGGTTTGATCGTCAGGGATGGCGGCCGCGTGCTGTTGGTCGATACCGCCTGGACCGATGACCAGACCGCCCAGATCCTCAACTGGATCAAGCAGGAGATCAACCTGCCGGTCGCGCTGGCGGTGGTGACTCACGCGCATCAGGACAAGATGGGCGGTATGGACGCGCTGCATGCGGCGGGGATTGCGACTTATGCCAATGCGTTGTCGAACCAGCTTGCCCCGCAAGAGGGGCTGGTTGCGGCGCAACACAGCCTGACTTTCGCCGCCAATGGCTGGGTCGAACCAGCAACCGCGCCCAACTTTGGCCCGCTCAAGGTATTTTACCCCGGCCCCGGCCACACCAGTGACAATATCACCGTTGGGATCGACGGCACCGACATCGCTTTTGGTGGCTGCCTGATCAAGGACAGCAAGGCCAAGTCGCTCGGCAATCTCGGTGATGCCGACACTGAGCACTACGCCGCGTCAGCGCGCGCGTTTGGTGCGGCGTTCCCCAAGGCCAGCATGATCGTGATGAGCCATTCCGCCCCCGATAGCCGCGCCGCAATCACTCATACGGCCCGCATGGCCGACAAGCTGCGCTGAGCCATGGCTGACCACGTCACCCCCAATCTGCCATCGCGCGATTTCGATGTGACAGAGA SEQ ID NO: 8 CGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTATGCCGCACTCACCCCCATGGAGTTTTGATGTTCAAACTTTTGAGTAAGTTATTGGTCTATTTGACCGCGTCTATCATGGCTATTGCGAGTCCGCTCGCTTTTTCCGTAGATTCTAGCGGTGAGTATCCGACAGTCAGCGAAATTCCGGTCGGGGAGGTCCGGCTTTACCAGATTGCCGATGGTGTTTGGTCGCATATCGCAACGCAGTCGTTTGATGGCGCAGTCTACCCGTCCAATGGTCTCATTGTCCGTGATGGTGATGAGTTGCTTTTGATTGATACAGCGTGGGGTGCGAAAAACACAGCGGCACTTCTCGCGGAGATTGAGAAGCAAATTGGACTTCCTGTAACGCGTGCAGTCTCCACGCACTTTCATGACGACCGCGTCGGCGGCGTTGATGTCCTTCGGGCGGCTGGGGTGGCAACGTACGCATCACCGTCGACACGCCGGCTAGCCGAGGTAGAGGGGAACGAGATTCCCACGCACTCTCTAGAAGGACTCTCATCGAGCGGGGACGCAGTGCGCTTCGGTCCAGTAGAACTCTTCTATCCTGGTGCTGCGCATTCGACCGACAACTTAGTTGTGTACGTCCCGTCTGCGAGTGTGCTCTATGGTGGTTGTGCGATTTATGAGTTGTCACGCACGTCTGCGGGGAACGTGGCCGATGCCGATCTGGCTGAATGGCCCACCTCCATTGAGCGGATTCAACAACACTACCCGGAAGCACAGTTCGTCATTCCGGGGCACGGCCTGCCGGGCGGTCTAGACTTGCTCAAGCACACAACGAATGTTGTAAAAGCGCACACAAATCGCTCAGTCGTTGAGTAGCAGGCAGATGCGGCATAACATGAAGTTGCAGCCGACCATCACTCCGCTGCGCTCCGTTCTGGCGGCTGAACTTCGGCGTTAGATGCACT Conclusion: The primers, probes, kits, and methods provided in this invention can achieve efficient, specific, sensitive, and reproducible detection of the KPC gene, and have important application value in environmental and drug-resistant bacteria monitoring and control.
[0043] The above description, in conjunction with specific preferred embodiments, provides a further detailed explanation of the present invention, enabling those skilled in the art to understand and apply it. However, it should not be construed that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art, several simple deductions or substitutions can be made without departing from the inventive concept, without requiring creative effort. Therefore, any simple improvements made to the present invention by those skilled in the art based on the disclosure of this invention should be within the scope of protection of this invention.
Claims
1. A primer-probe composition for detecting KPC-type carbapenem resistance genes, characterized in that, The primer-probe composition includes: Primer pairs, including a forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer is shown in SEQ ID NO:1 and the nucleotide sequence of the reverse primer is shown in SEQ ID NO:2; The probe has the nucleotide sequence shown in SEQ ID NO:
3.
2. The primer and probe composition for detecting KPC-type carbapenem resistance genes according to claim 1, characterized in that, The probe 5′ end is labeled with a fluorescent group, which is selected from FAM, VIC, HEX, CY5, and TET. The probe 3′ end is labeled with a quenching group, which is selected from BHQ1, BHQ2, TAMRA, and MGB.
3. The primer and probe composition for detecting KPC-type carbapenem resistance genes according to claim 1 or 2, characterized in that, The final concentration of both the forward and reverse primers in the real-time fluorescence PCR reaction system was 0.3 μmol / L.
4. The primer and probe composition for detecting KPC-type carbapenem resistance genes according to claim 1 or 2, characterized in that, The final concentration of the probe in the real-time fluorescence PCR reaction system was 0.10 μmol / L.
5. A real-time fluorescent PCR kit for detecting KPC-type carbapenem resistance genes, characterized in that, The kit includes the primer and probe composition for detecting KPC-type carbapenem resistance genes as described in any one of claims 1-4.
6. The real-time fluorescent PCR kit for detecting KPC-type carbapenem resistance genes according to claim 5, characterized in that, The real-time fluorescence PCR kit also includes: The fluorescent PCR premix contains Taq DNA polymerase and dNTPs; Positive control sample, which contains bacterial genomic nucleic acid containing the blaKPC gene; Negative control sample, which is bacterial genomic nucleic acid that does not contain blaKPC; Nuclease-free water; Instruction manual.
7. A non-diagnostic or therapeutic method for detecting KPC-type carbapenem resistance genes, characterized in that, Includes the following steps: Nucleic acid is extracted from the sample to be tested to obtain a sample DNA template; Configure a reaction system, wherein the reaction system comprises: the primer and probe composition for detecting KPC type carbapenem resistance genes as described in any one of claims 1-4, fluorescent PCR premix, DNA template, quality control nucleic acid template, and nuclease-free water; The prepared reaction system was placed in a real-time fluorescence quantitative PCR instrument for amplification, and the fluorescence signal was monitored in real time. The presence of the KPC gene in the sample to be tested can be determined based on the amplification curve or the cycle threshold.
8. The method for detecting KPC-type carbapenem resistance genes according to claim 7, characterized in that, The amplification procedure includes: Pre-denaturation: 95 ℃, 2 minutes; The loop repeats 40 times, each time including: Denaturation at 95°C for 8 seconds; Annealing / extending at 62 °C for 5 seconds, and acquiring fluorescence signals at this temperature.
9. The method for detecting KPC-type carbapenem resistance genes according to claim 7, characterized in that, The detection limit of the method is 0.04 copies / μL.
10. The application of the real-time fluorescence PCR kit for detecting KPC carbapenem resistance genes according to any one of claims 5-6 in the detection of KPC carbapenem resistance genes in non-diagnostic or non-therapeutic applications.