Application of ACTN2 protein enhancer in preparation of medicine for preventing, relieving or treating asthma

Abstract

The invention belongs to the technical field of respiratory disease targeted therapy and protein regulation and control, and relates to application of an ACTN2 protein enhancer in preparation of a medicine for preventing, relieving or treating asthma. The key'switch 'effect of the cytoskeleton protein ACTN2 in airway smooth muscle cell (ASMC) phenotype transformation is discovered and confirmed for the first time. The prior art mainly focuses on inflammatory pathways or bronchial relaxation, while the invention reveals that the expression down-regulation of ACTN2 is a key driving factor which causes the conversion of ASC from a resting systolic phenotype to a pathological synthetic phenotype. The discovery provides a brand new therapeutic target for asthma, especially refractory asthma accompanied by severe airway remodeling and hormone resistance.

Description

Technical Field

[0001] This invention belongs to the field of targeted therapy and protein regulation technology for respiratory diseases, and specifically relates to the use of an ACTN2 protein enhancer in the preparation of drugs for the prevention, relief or treatment of asthma. Background Technology

[0002] Allergic asthma is a common chronic inflammatory airway disease, characterized by airway hyperresponsiveness (AHR) and reversible airway obstruction. The cellular basis of AHR is the abnormal proliferation and excessive contraction of airway smooth muscle cells (ASMCs). Current treatments, such as inhaled corticosteroids (ICS) and long-acting β2-agonists (LABAs), are ineffective in some patients with severe asthma, exhibiting "steroid resistance," highlighting the urgent need to develop therapeutic drugs with novel targets and mechanisms.

[0003] Phenotypic switching of ASMCs—the transition between a resting "contractile phenotype" and a proliferative / secreting "synthetic phenotype"—is a crucial step in airway remodeling. In the pathological state of asthma, ASMCs transform into a contractile phenotype, leading to airway hypersensitivity to irritants. Exploring the molecular mechanisms regulating ASMC phenotypic switching is an important direction for drug development.

[0004] α-actinin (ACTN) is a key protein that cross-links actin filaments and maintains cytoskeleton structure and tension. While the role of the ACTN2 isoform in cardiac and skeletal muscle has been reported, its expression pattern, biological function, and association with the pathological process of allergic asthma in airway smooth muscle cells are completely unknown in current technology. Although existing technologies contain drugs targeting the cytoskeleton, most are broad-spectrum inhibitors with poor target selectivity and strong off-target effects.

[0005] Therefore, there is an urgent need in the field to discover and validate new drug targets that can precisely regulate ASMC phenotypic switching and effectively alleviate airway hyperresponsiveness, and to develop safe and effective treatment strategies based on these targets. Summary of the Invention

[0006] The technical problem to be solved by this invention is that, in response to the lack of effective new targets for the treatment of asthma in the prior art, the invention reveals for the first time the key role of ACTN2 protein in regulating the phenotypic transformation of airway smooth muscle cells and the pathological process of asthma, and provides a new use based on this.

[0007] The technical solution adopted by this invention to solve its technical problem is:

[0008] Use of an ACTN2 protein enhancer in the preparation of a medicine for the prevention, relief or treatment of asthma.

[0009] The ACTN2 protein enhancer described in this invention has applications in medicines not limited to asthma, but also including lung diseases such as pneumonia, pulmonary fibrosis, emphysema, and COPD.

[0010] Preferably, the asthma is allergic asthma.

[0011] Preferably, the ACTN2 protein enhancer is a nucleic acid molecule capable of increasing the expression level of the ACTN2 protein; the nucleic acid molecule is an expression vector containing a nucleotide sequence encoding the ACTN2 protein.

[0012] Preferably, the amino acid sequence of the ACTN2 protein or the nucleotide sequence of its encoding gene has at least 90%, preferably 95%, and more preferably 99% identity with the sequence shown in SEQ ID NO: 1.

[0013] Preferably, the expression vector is a viral vector, preferably selected from lentiviral vectors, adeno-associated virus (AAV) vectors, or adenovirus vectors.

[0014] Preferably, the ACTN2 protein enhancer is selected from at least one of the following: a) small molecule compounds capable of enhancing the activity of ACTN2 protein; b) antibodies or antigen-binding fragments thereof that specifically bind to and stabilize ACTN2 protein.

[0015] Preferably, the drug is used to promote the conversion of airway smooth muscle cells (ASMCs) from a synthetic phenotype to a contractile phenotype, or to inhibit their conversion from a contractile phenotype to a synthetic phenotype.

[0016] Preferably, the drug is used to reduce airway hyperresponsiveness (AHR) and / or inhibit airway remodeling.

[0017] A pharmaceutical composition comprising an ACTN2 protein enhancer as an active ingredient and a pharmaceutically acceptable carrier, wherein the composition is used to prevent, relieve or treat asthma.

[0018] Preferably, the ACTN2 protein enhancer is an expression vector containing a nucleotide sequence encoding the ACTN2 protein, preferably a recombinant lentiviral vector or a recombinant adeno-associated virus (AAV) vector.

[0019] Preferably, the dosage form of the composition is an inhalation formulation, a nebulized solution, or an injection formulation.

[0020] Preferably, the ACTN2 protein enhancer is an AAV overexpression vector of ACTN2, the nucleotide sequence of which is shown in SEQ ID NO:2.

[0021] An anti-allergic asthma pharmaceutical composition comprising 0.05–15 wt% of an ACTN2 protein enhancer and 85–99.95 wt% of a pharmaceutically acceptable carrier; dosage forms include inhaled powder, nebulized solution, oral tablets / capsules, and intravenous injection; optionally, 8-debenzoylpaeoniflorin, glycyrrhizic acid, or quercetin may be added to enhance synergy.

[0022] The beneficial effects of this invention are:

[0023] This invention is the first to discover and confirm the crucial "switch" role of the cytoskeletal protein ACTN2 in the phenotypic transformation of airway smooth muscle cells (ASMCs). While existing technologies primarily focus on inflammatory pathways or bronchodilation, this invention reveals that downregulation of ACTN2 expression is a key driver leading to the transformation of ASMCs from a resting "constrictive phenotype" to a pathological "synthetic phenotype." This discovery provides a novel therapeutic target for asthma (such as allergic asthma), particularly refractory asthma with severe airway remodeling and hormone resistance.

[0024] This invention demonstrates through in vitro and in vivo experiments (particularly gene knockout and overexpression models) that exogenous enhancement of ACTN2 expression can significantly inhibit TGF-β or PDGF-BB-induced pathological changes, potently upregulate the expression of contractile proteins (α-SMA, CNN1, SM22α), and simultaneously inhibit the synthesis of phenotypic markers (such as OPN). This means that ACTN2 protein enhancers not only alleviate symptoms but also have the potential to fundamentally reverse airway smooth muscle remodeling, a therapeutic effect that is difficult to achieve with current conventional asthma drugs (such as bronchodilators).

[0025] This invention constructs viral vectors (such as lentiviral vectors) capable of efficiently expressing ACTN2 and verifies their ability to restore normal phenotypes in in vitro cell models. This demonstrates that specifically supplementing ACTN2 using nucleic acid drugs (such as gene therapy vectors or mRNA) is a feasible therapeutic strategy, providing direct experimental evidence and material basis for the development of novel inhaled gene therapy drugs. Attached Figure Description

[0026] Figure 1 A schematic diagram showing the expression of ACTN2 protein in human lung (A) and bronchial (B) tissues in existing databases;

[0027] Figure 2The image shows the expression results of ACTN2 in the contractile phenotype of mouse airway smooth muscle cells (MASMCs) induced by serum starvation or TGF-β, including: (A) Western blot analysis of the expression and quantification of ACTN2 and contractile proteins (α-SMA, CNN1, sm22α) in MASMCs after 48 h of serum starvation; (B) Western blot analysis of the expression and quantification of ACTN2 and contractile proteins (α-SMA, CNN1, sm22α), and contractile pathway protein P-MLC in MASMCs induced by TGF-β (10 ng / mL, 48 h); (C) qRT-PCR analysis of the effect of TGF-β on the mRNA levels of ACTN2, α-SMA, CNN1, and sm22α in MASMCs induced by TGF-β (10 ng / mL, 48 h); (D) Immunofluorescence staining of α-SMA and ACTN2 in MASMCs induced by TGF-β and PDGF-BB; compared with the blank group, * P < 0.05, ** P < 0.01, *** P < 0.001; compared with the model group, # P < 0.05, ## P < 0.01, ### P < 0.001;

[0028] Figure 3 The figure shows the expression results of ACTN2 in the synthetic phenotype of mouse airway smooth muscle cells (MASMCs) induced by PDGF-BB or LPS. (A) Western blot analysis of the expression and quantification of ACTN2, contractile proteins (α-SMA, CNN1, sm22α), and synthetic protein OPN in PDGF-BB-induced (20 ng / mL, 48 h) MASMCs; (B) qRT-PCR analysis of the effect of PDGF-BB-induced (20 ng / mL, 48 h) ACTN2, α-SMA, CNN1, sm22α, and OPN mRNA levels in MASMCs; (C) Western blot analysis of the expression and quantification of ACTN2 and contractile proteins (α-SMA, CNN1, sm22α) in LPS-induced (1 μg / mL, 24 h) MASMCs. Compared with the control group, * P < 0.05, ** P < 0.01, *** P < 0.001; compared with the model group, # P < 0.05, ## P < 0.01, ### P < 0.001;

[0029] Figure 4 This image shows the validation results of successfully constructing stable ACTN2 knockout (KO) / overexpression (OE) transgenic cells in MASMCs. (AB) Western blot analysis of ACTN2 expression and quantification in MASMCs after ACTN2 knockout; (CD) Western blot analysis of ACTN2 expression and quantification in MASMCs after ACTN2 overexpression; compared with the WT group, * P < 0.05, ** P < 0.01, *** P < 0.001; compared with the model group, # P < 0.05, ## P < 0.01, ### P < 0.001;

[0030] Figure 5 This is a graph showing the experimental results of the effect of ACTN2 knockout / overexpression on the contractile phenotype of MASMCs. (AB) Western blot analysis of ACTN2 and contractile protein expression and quantification in MASMCs after ACTN2 knockout; (CD) Western blot analysis of ACTN2 and contractile protein expression and quantification in MASMCs after ACTN2 overexpression; (E) Representative immunofluorescence image of F-actin (red) stained with phalloidin, with DAPI-stained cell nuclei shown in blue; compared with the WT group (wild-type), * P < 0.05, ** P < 0.01, *** P < 0.001; compared with the model group, # P < 0.05, ## P < 0.01, ### P < 0.001;

[0031] Figure 6 The study investigated the effects of ACTN2 knockout / overexpression on the contractile or synthetic phenotypes of MASMCs. Specifically: (AB) Western blot analysis of ACTN2 knockout followed by TGF-β (10 ng / mL, 48 h)-induced contractile phenotype, and quantitative analysis of ACTN2 and contractile proteins; (CD) Western blot analysis of ACTN2 knockout followed by PDGF-BB (20 ng / mL, 48 h)-induced synthetic phenotype, and quantitative analysis of ACTN2 and contractile proteins; (EF) Western blot analysis of ACTN2 overexpression followed by PDGF-BB (20 ng / mL, 48 h)-induced synthetic phenotype, and quantitative analysis of ACTN2 and contractile proteins. Compared with the WT group, * P < 0.05,** P < 0.01, *** P < 0.001; compared with their respective untreated control groups (KO or OE), # P < 0.05 ## P < 0.01, ### P < 0.001; compared with the stimulation group without knockdown / overexpression (TGF-β or PDGF-BB), $ P < 0.05 $$ P < 0.01, $$$ P < 0.001;

[0032] Figure 7 This is a schematic diagram showing the expression of ACTN2 in OVA-induced allergic asthma mice, where: (A) Western blot analysis of ACTN2 and contractile protein CNN1 expression in OVA-induced allergic asthma mice; (BC) Quantitative analysis of ACTN2 and contractile protein CNN1 expression in OVA-induced allergic asthma mice; compared with the control group, * P < 0.05, ** P < 0.01, *** P < 0.001. Detailed Implementation

[0033] The technical solution of the present invention will be further described in detail below through specific embodiments. It should be understood that the implementation of the present invention is not limited to the following embodiments, and any modifications and / or alterations made to the present invention will fall within the protection scope of the present invention.

[0034] In this invention, unless otherwise specified, all parts and percentages are by weight, and the equipment and raw materials used are commercially available or commonly used in the art. Unless otherwise specified, the methods in the following embodiments are conventional methods in the art.

[0035] Unless otherwise specified, the reagents used in the following examples can be purchased from a regular biochemical reagent store.

[0036] The expression of ACTN2 protein in human lung (A) and bronchial (B) tissues is as follows: Figure 1 As shown, we found that the ACTN2 protein can be expressed in the lungs and bronchi, specifically in smooth muscle cells. Figure 1(AB). Airway smooth muscle cells (ASMCs) play a central role in the pathogenesis of asthma, and their phenotypic transformation and accompanying functional changes are major factors leading to airway remodeling and AHR. However, current research on ACTN2 is mostly focused on cardiomyopathy, and its role in allergic asthma and its specific regulatory effects on airway smooth muscle cells remain unclear.

[0037] This invention establishes for the first time that the cytoskeletal protein ACTN2 is a key factor driving airway smooth muscle phenotypic transformation. By selectively promoting its expression / activity, it reduces AHR and airway remodeling, thereby overcoming hormone resistance and providing precise, safe, long-acting, inhalable or systemically administered ACTN2 enhancers and their pharmaceutical compositions.

[0038] This invention explores the function of ACTN2 in regulating MASMC phenotypic transformation in allergic asthma by constructing ACTN2 knockout and overexpression models in MASMC cells.

[0039] The therapeutic effect of ACTN2 described in this invention is preferably manifested as follows: it acts as a "switch" for maintaining the contractile phenotype of airway smooth muscle; its deficiency promotes asthma remodeling, while overexpression can reverse this process. ACTN2 plays an important role in regulating the phenotypic transition of MASMCs, especially in allergic asthma, where ACTN2 may inhibit airway remodeling and excessive contraction by maintaining the contractile phenotype.

[0040] Antibody information: GAPDH (Proteintech, 6000-1-Ig, 1:30000), ACTN2 (Proteintech, 14221-1-AP, 1:5000), α-SMA (Proteintech, 14395-1-AP, 1:1000), SM22α (Proteintech, 60213-1-Ig, 1:1000), OPN (Proteintech, 22952-AP, 1:1000), CNN1 (Proteintech, 24855-1-AP, 1:1000); Goat anti-Mouse IgG (H+L) (Thermo Pierce, 1460, 1:5000), Goat anti-Rabbit IgG (H+L) (Thermo Pierce, 31431, 1:5000) were purchased from Thermo Fisher Scientific; Actin-Tracker Red-555 (Beyotime Biotechnology, C2203S, 1:200), Alexa Fluor 488-labeled goat anti-rabbit IgG (H+L) (Beyotime Biotechnology, A0423, 1:200)

[0041] The specific nucleotide sequence of the overexpression plasmid targeting ACTN2 used in the following experiments of this invention is shown in SEQ ID NO: 2, and the specific nucleotide sequence of the sgRNA targeting ACTN2 is shown in SEQ ID NO: 3.

[0042] All experimental data described in this invention were analyzed using Graphpad Prism 8.0.2 (GraphPad Instat, San Diego, California, USA). One-way ANOVA was used for inter-group comparisons. All experimental data are expressed as mean standard deviation (SD), Mean ± SD. P < 0.05 was considered statistically significant.

[0043] Example 1: Construction and packaging of ACTN2 knockout and overexpression lentiviral vectors.

[0044] 1. Construction of ACTN2 knockout and overexpression lentiviral vectors:

[0045] Primer design and gene sequence acquisition: The coding region sequence of the mouse ACTN2 gene (CDS sequence, NM_033268.4) publicly available in the NCBI database is shown in SEQ ID NO: 1. The specific nucleotide sequence of the ACTN2 overexpression plasmid is shown in SEQ ID NO: 2. The sgRNA sequence targeting ACTN2 was designed using the CRISPR design tool (http: / / chopchop.cbu.uib.no / ): CACCGGATGGTCCAGATCATACCCA (SEQ ID NO: 3).

[0046] Preparation of the target gene fragment: cDNA from mouse aortic smooth muscle cells (MASMCs) was used as a template for PCR amplification using the primer pairs described above. The PCR reaction mixture consisted of: 1 μL template cDNA, 1.5 μL each of forward and reverse primers (10 μM), 25 μL 2xkod Fxbuffer, 10 μL 2 mM dNTPs, and ddH2O to a final volume of 50 μL. The PCR reaction conditions were: denaturation at 98℃ for 10 s, annealing at 55℃ for 15 s, and extension at 72℃ for 5 s, for a total of 30 cycles.

[0047] Enzyme digestion and ligation: The overexpression PCR product and the overexpression vector (pLV-ZsGreen(2A)PURO-CMV, purchased from Beijing Qingke Biotechnology Co., Ltd.) were digested with XhoI and EcoRI restriction endonucleases (purchased from NEB) at 37℃ for 2 h. The digestion products were recovered by 1% agarose gel electrophoresis. The target gene fragment was mixed with the linearized vector at a ratio of 1:2 and ligated using T4 DNA ligase (purchased from NEB) at 50℃ for 30 min to obtain the recombinant overexpression plasmid pLV-ACTN2-ZsGreen(2A)PURO-CMV. Similarly, the knockout PCR product was digested and ligated with the lentiviral vector (LentiCRISPR v2-Puro, purchased from Beijing Qingke Biotechnology Co., Ltd.) in the same manner to obtain the recombinant knockout plasmid LentiCRISPR v2-ACTN2-Puro.

[0048] Transformation: The ligation product was mixed with *E. coli* DH5α competent cells at a ratio of 1:20, incubated on ice for 30 min, then heat-shocked at 42°C for 45 s. The mixture was then added to 100 μL of antibiotic-free LB liquid medium, incubated at 37°C with shaking at 200 rpm for 30 min, and finally plated onto LB solid medium containing ampicillin (100 μg / mL). The culture was incubated upside down at 37°C overnight. Single colonies were selected for colony PCR verification, and positive clones were sent to Keenon Biotech for Sanger sequencing.

[0049] 2. Lentiviral Packaging and Harvesting

[0050] Logarithmic growth phase 293T cells (purchased from Wuhan Pronosai Biotechnology Co., Ltd.) were seeded in 10 cm culture dishes, and co-transfection was performed when the cell density reached 70%-80%.

[0051] The recombinant overexpression plasmid pLV-ACTN2-ZsGreen(2A)PURO-CMV, packaging plasmid psPAX2, and envelope plasmid pMD2.G were mixed in a 4:2:1 ratio (total plasmid amount: 8.2 μg) and then mixed with 18 μL of PEI 4000 transfection reagent (MCE). Following the manufacturer's instructions, 293T cells were transfected. Eight hours after transfection, the medium was replaced with 5 mL of DMEM containing 10% fetal bovine serum. After 48 hours of culture, 3 mL of DMEM containing 10% fetal bovine serum was added. Seventy-two hours after transfection, the cell culture supernatant was collected. The collected 8 mL of supernatant was added to 2 mL of 5×PEG 8000 and concentrated overnight at 4°C. The next day, the virus solution was collected by centrifugation at 4800 rpm for 15 min at 4°C. The virus solution was then resuspended in 400 μL of PBS, aliquoted, and stored at -80°C for later use. Similarly, the recombinant knockout plasmid LentiCRISPR v2-ACTN2-Puro was mixed with the packaging plasmid psPAX2 and the envelope plasmid pMD2.G in a ratio of 4:2:1 and transfected into 293T cells to obtain the corresponding knockout virus solution.

[0052] 3. Infect target cells:

[0053] MASMC cells were loaded at 5 × 10 4 Cells were seeded at 1000 / well in 24-well plates and incubated overnight. The next morning, infection enhancer (Polybrene, BL628A) was added to the culture medium at a ratio of 1:1000. 400 μL of antibiotic-free medium and 100 μL of the corresponding virus (overexpressing virus or knockout virus) were added to each well. After 8 h of transfection, the medium was replaced with growth medium. 24 h later, cells were screened for 48 h using 2 µg / mL puromycin to identify positive cells, thus successfully constructing MASMC cells overexpressing ACTN2 and MASMC cells knocked out ACTN2.

[0054] Example 2: Study on the expression patterns of ACTN2 in different phenotypic models of MASMC

[0055] 1. Experimental Methods:

[0056] Cell culture: Mouse airway smooth muscle cells (MASMCs) were purchased from Wuhan Pronosei Biotechnology Co., Ltd., and cultured in DMEM medium containing 10% fetal bovine serum (FBS), 100 U / mL penicillin, and 100 μg / mL streptomycin, and incubated at 37℃ in a 5% CO2 incubator. When the cells reached 80-90% confluence, they were digested with 0.25% trypsin-EDTA trypsin for 1 min, the trypsin was discarded, and complete culture medium was added and mixed by pipetting. One-quarter of the cells were then passaged or plated.

[0057] Model induction: MASMCs were digested using the same procedure as in passages, and the cell number was adjusted by adding complete culture medium. Cells were then seeded in 6-well plates with 1.2 × 10⁶ cells per well. 6 Cells were cultured in an incubator until each well reached approximately 70% confluence, still using DMEM incomplete medium containing FBS and 1% P / S. Except for the normal group, cells exhibiting the shrinking and synthetic phenotypes were treated with 10 ng / mL TGF-β and 20 ng / mL PDGF-BB, respectively, for 48 hours before cell collection.

[0058] Western Blot: Cells were washed with PBS, and 100 μL of pre-chilled RIPA lysis buffer (containing 1 mM PMSF) was added to each well. Lysis was performed at low temperature for 30 min. The cells were then centrifuged at 4°C and 15,000 rpm. The supernatant was collected, and protein concentration was determined using a BCA protein assay kit (Beyotime, Shanghai, China) according to the manufacturer's instructions. The protein concentration was then adjusted to a uniform level with PBS. Protein samples were mixed with 5× loading buffer at a 4:1 volume ratio and heated at 100°C for 7 min to ensure complete denaturation. After thorough mixing, the samples were loaded onto a 10% gradient gel. Electrophoresis was performed using an electrophoresis apparatus (Shanghai Tianneng Co., Ltd., Shanghai, China) at 80V for 30 min, followed by increasing the voltage to 120V until the tracer dye reached the bottom of the gel. Wet transfer was performed: the transfer tank was placed in an ice-filled foam box, and pre-diluted 1× transfer buffer was added. The PVDF membrane was activated with methanol for 30 seconds. The transfer layers were assembled in the order of cathode side (black side) (sponge pad-filter paper-gel-PVDF membrane-filter paper-sponge pad). Transfer was performed at a constant voltage of 70 V for 90 min, with the entire process in an ice bath. After transfer, the PVDF membrane was immersed in 5% skim milk powder-TBST blocking solution and blocked on a shaker for 1 h. The membrane was then washed three times with PBST, 5 min each time. The sample was incubated overnight at 4°C with primary antibody diluted to a specific dilution. The next day, the membrane was washed three times with PBST and incubated with HRP-labeled secondary antibody at room temperature for 1 hour. The membrane was then washed three more times with PBST (10 min each time), and subsequently immersed in a 1:1 mixture of ECL A / B solution for 1 minute. The chemiluminescence signal was captured using a signal acquisition system.

[0059] qRT-PCR: Total RNA was extracted from cells using the Steady Pure Rapid RNA Extraction Kit (Accurate Biology, Wuhan, China) according to the manufacturer's instructions. cDNA synthesis was then performed using the Evo M-MLV RTreagent Kit (Accurate Biology, Wuhan, China). Real-time quantitative PCR was performed using the SYBR® Green ProTaq HS qPCR Kit (Accurate Biology, Wuhan, China) to assess the expression levels of identified genes. Relative gene expression levels were expressed as 2^- △△ The Ct method was used for calculation, with GAPDH as the internal reference gene. Each sample was analyzed three times to ensure reproducibility. Primer sequences are shown in Table 1.

[0060] Gene Sequence (5'-3') SEQ ID NO m-ACTN2-F TGGCACCCAGATCGAGAAC 4 m-ACTN2-R GTGGAACCGCATTTTTCCCC 5 m_α-SMA-F CCCAGACATCAGGGAGTAATGG 6 m_α-SMA -R TCTATCGGATACTTCAGCGTCA 7 m-CNN1-F TCTGCACATTTTAACCGAGGTC 8 m-CNN1-R GCCAGCTTGTTCTTTACTTCAGC 9 m-SM22α-F CAACAAGGGTCCATCCTACGG 10 m-SM22α-R ATCTGGGCGGCCTACATCA 11 m-β-actin-F GACCCAGATCATGTTTGAGAC 12 m-β-actin-R GTAGCCACGCTCGGTCAG 13 m-GAPDH-F CAGTGGCAAAGTGGAGATTGTTG 14 m-GAPDH-R TCGCTCCTGGAAGATGGTGAT 15

[0061] Immunofluorescence staining: After placing cell spreaders into 24-well plates, MASMC cells were seeded, with approximately 1 × 10⁶ cells per well. 5 After 48 h of cell modeling according to the above method, the cells were removed, the culture medium was removed, and the cells were gently washed three times with PBS. Then, 500 μL of 4% paraformaldehyde was added to each well for cell fixation at room temperature for 40 min. After fixation at room temperature, the 4% paraformaldehyde was removed, and the cells were washed three times with PBS on a shaker for 5 min each time. After washing, 500 μL of 0.1% Triton X-100 was added to each well for cell permeabilization. After standing for 10 min, the cells were washed three times with PBS on a shaker for 5 min each time. After removing the PBS, 500 μL of 5% goat serum was added to each well for cell blocking. After blocking at room temperature for 1 h, the blocking solution was removed, and the prepared primary antibody was added directly and incubated at 4°C for 12 h. After incubation, the primary antibody was recovered, and the cells were washed three times with PBS on a shaker for 5 min each time. Then, the prepared fluorescent secondary antibody was added and incubated at room temperature in the dark for 1 h. After removing the fluorescent secondary antibody, the cells were washed three times with PBS on a shaker for 5 min each time. After washing, add an appropriate amount of DAPI-containing anti-fluorescence quenching solution to a glass slide, remove the slide and invert it onto the glass slide, seal the slide, and then observe it under a fluorescence microscope.

[0062] 2. Experimental Results:

[0063] In cell models, we found that by using serum starvation ( Figure 2 A) and the TGF-β-induced contractile phenotype of MASMC ( Figure 2B) The expression of MASMC-related contractile proteins (α-SMA, CNN1, sm22α) was significantly increased, and the marker protein MLC in the contraction pathway was phosphorylated (MLC was activated under the contraction phenotype), indicating that the contraction model was successfully constructed. Simultaneously, ACTN2 expression was also significantly increased. This indicates that ACTN2 increases during MASMC contraction. Furthermore, the results of qRT-PCR were consistent with those of Western Blot analysis. Figure 2 C). The above results indicate that ACTN2 expression is positively correlated with the contractile phenotype of MASMC.

[0064] In the PDGF-BB-induced synthetic phenotype of MASMCs, the expression of MASMC-related contractile proteins α-SMA, CNN1, and SM22α was significantly decreased, while the expression of the synthetic protein OPN was significantly increased. Figure 3 A), indicating that the synthetic phenotype model was successfully constructed. Simultaneously, the protein expression level of ACTN2 was significantly reduced in the synthetic phenotype. Furthermore, the results of qRT-PCR were consistent with those of Western Blot analysis. Figure 3 B). Similarly, in an LPS-induced MASMC inflammation model, we found that the expression of ACTN2 and MASMC-related contractile proteins α-SMA, CNN1, and SM22α was significantly reduced. Figure 3 C).

[0065] Simultaneously, we used immunofluorescence to stain MASMC contraction markers α-SMA and ACTN2. Compared with the control group, the fluorescence intensity of α-SMA and ACTN2 was significantly enhanced in the TGF-β-induced contraction phenotype of MASMCs. Conversely, in the PDGF-BB-induced synthesis phenotype of MASMCs, the fluorescence intensity of α-SMA and ACTN2 was significantly decreased. Figure 2 D). The above results indicate that ACTN2 plays a crucial role in the phenotypic transformation of MASMC.

[0066] Example 3: Effects of ACTN2 knockout / overexpression on MASMC phenotypic transformation

[0067] Example 2 demonstrates that ACTN2 plays a crucial role in the TGF-β-induced shrinkage phenotype of MASMCs and the PDGF-BB-induced synthetic phenotype of MASMCs. To further elucidate the effect of ACTN2 on MASMC phenotypic transformation, this example further constructs a cell line with ACTN2 knockout / overexpression to further clarify the effect of ACTN2 on MASMC phenotypic transformation.

[0068] 1. Experimental Methods:

[0069] Construction of stable cell lines: MASMC cells were infected with the lentivirus prepared in Example 1, and after selection with 2 μg / mL puromycin for 48 h, stable ACTN2 knockout (ACTN2-KO) and overexpression (ACTN2-OE) cell lines were obtained. ACTN2-WT was constructed as a control.

[0070] Cell grouping: ACTN2-WT, ACTN2-KO, and ACTN2-OE cells were digested using the same steps as in "Example 2" above. Complete culture medium was added to adjust the cell number, and the cells were seeded in 6-well plates with 1.2 × 10⁶ cells per well. 6 After culturing in an incubator for 24 hours, the supernatant was discarded, and the cells were collected for subsequent experiments.

[0071] Protein level detection: Western blotting was used to detect the expression of contraction-related proteins. For detailed steps, please refer to "Example 2".

[0072] Cell morphology observation: The experimental procedure is described in “Example 2” for cell immunofluorescence staining. The primary antibody is phalloidin (a red fluorescent probe F-actin). No secondary antibody step is required. After the primary antibody is completed, the slide can be mounted and photographed.

[0073] 2. Experimental Results:

[0074] We constructed a knockout and overexpression of ACTN2 in MASMCs using lentiviral packaging. Western blot results showed that, compared with the WT group, ACTN2-KO cells exhibited significantly reduced ACTN2 protein expression. Figure 4 In contrast, in ACTN2-OE cells, ACTN2 protein expression was significantly increased (AB); Figure 4 CD indicates that the stable cell line was successfully constructed.

[0075] The changes in related contractile marker proteins and cell morphology after ACTN2 knockout / overexpression are as follows: Figure 5 As shown. By detecting the expression of MASMC-related contractile proteins in ACTN2-KO or ACTN2-OE, we found that: Figure 5 As shown in A and 5B, compared with wild-type (WT) cells, the expression levels of contraction-related proteins α-SMA, CNN1, and SM22α were significantly reduced in ACTN2-KO cells. Figure 5 Conversely, with overexpression of ACTN2, the expression of related contractile proteins α-SMA, CNN1, and SM22α in the MASMC of ACTN2-OE was significantly increased (AB). Figure 5CD). This demonstrates that ACTN2 expression significantly influences the phenotypic transformation of airway smooth muscle cells. Secondly, phalloidin staining revealed that compared to elongated-contractile MASMCs under normal physiological conditions, ACTN2-KO MASMCs transformed from an elongated-contractile phenotype to a polygonal synthetic phenotype, while cells after ACTN2-OE exhibited a more elongated-contractile phenotype (CD). Figure 5 E).

[0076] These results indicate that ACTN2 knockout / overexpression significantly affects the phenotypic transition of MASMCs. Inhibiting ACTN2 expression can promote the transformation of MASMCs from a contractile phenotype to a synthetic phenotype, meaning that ACTN2 can mediate the phenotypic transition of airway smooth muscle.

[0077] Example 4: Effects of ACTN2 knockout / overexpression on shrinkage or synthesis phenotypes

[0078] Example 3 demonstrates the effect of ACTN2 knockout / overexpression on MASMC phenotypic transformation. To further investigate the function of ACTN2 in MASMC phenotypic transformation, in this example, we used TGF-β and PDGF-BB to induce shrinkage and synthesis phenotypes in ACTN2 knockout / overexpression cells.

[0079] 1. Cell grouping and drug administration: ACTN2-WT, ACTN2-KO, and ACTN2-OE cells were digested using the same steps as in "Example 2" above. Complete culture medium was added to adjust the cell number, and the cells were seeded in 6-well plates with 1.2 × 10⁶ cells per well. 6 Cells were cultured in an incubator for 24 h, then the culture medium was discarded. Some groups were stimulated with TGF-β (10 ng / mL) or PDGF-BB (20 ng / mL) and cultured in an incubator for 48 h. The six-well plates were removed, the supernatant was discarded, and the cells were collected for subsequent Western blot analysis.

[0080] 2. Experimental Results:

[0081] In WT cells, TGF-β stimulation significantly upregulated the expression of ACTN2 and contractile proteins α-SMA and SM22α. However, in ACTN2-KO cells, even after TGF-β treatment (KO+TGF-β group), the expression levels of each contractile protein remained at a low level. Figure 6 Similarly, based on ACTN2-KO, we used PDGF-BB to induce the synthetic phenotype of airway smooth muscle. We found that the absence of ACTN2 exacerbated the reduction in ACTN2 and contractile proteins α-SMA and CNN1 expression induced by PDGF-BB. Figure 6Conversely, we induced an airway smooth muscle synthesis phenotype using PDGF-BB on the basis of ACTN2-OE overexpression and found that the decrease in ACTN2 and contractile proteins α-SMA and CNN1 induced by PDGF-BB was reversed by ACTN2 overexpression. Figure 6 This indicates that ACTN2 is a key target mediating phenotypic transformation of airway smooth muscle.

[0082] Example 5: Decreased expression of ACTN2 in mice with allergic asthma

[0083] "Examples 3" and "Examples 4" confirmed the key role of ACTN2 in MASMC phenotypic transformation based on in vitro cell experiments. To further investigate the role of ACTN2 in MASMC phenotypic transformation in vivo, we measured ACTN2 and contraction phenotypic indices in OVA-induced allergic asthmatic mice in this example.

[0084] 1. Experimental Methods

[0085] Twenty SPF-grade female BALB / c mice (6-8 weeks old, 18-22 g) were purchased from Zhejiang Vital River Laboratory Animal Technology Co., Ltd. After one week of acclimatization, they were randomly divided into a control group and a model group. The model group was sensitized on days 1 and 14 by intraperitoneal injection of a suspension containing 0.2% OVA (9006-59-1, Shanghai Yuanye Biotechnology Co., Ltd.) and 4% Al(OH)3 (21645-51-2, Shanghai Maclean Biochemical Technology Co., Ltd.) at a dose of 10 mL / kg. From days 28 to 34, the model group underwent nebulization challenge with 5% OVA solution for 30 min, while the control group underwent nebulization with physiological saline for 30 min, for 7 consecutive days. The mice were sacrificed 24 hours after the last OVA nebulization challenge, on day 35. Lung tissue from each group was collected and stored at -80℃. Western blot analysis was then performed to detect the expression of ACTN2 protein and the contraction marker CNN1 protein in each group.

[0086] 2. Experimental Results

[0087] like Figure 7 As shown, compared with the control group, the protein expression levels of ACTN2 and the contractile protein CNN1 were significantly reduced in the allergic asthma model (OVA) mice. This result once again demonstrates that ACTN2 is an important target for the treatment of allergic asthma.

[0088] in conclusion:

[0089] This invention provides a novel drug target for the prevention or treatment of allergic asthma—ACTN2 protein. By constructing an ACTN2 knockout and overexpression model of airway smooth muscle cells (MASMCs) and combining it with an ovalbumin (OVA)-induced allergic asthma mouse model, the crucial role of ACTN2 in allergic asthma was systematically elucidated at both in vitro and in vivo levels. The study shows that ACTN2 plays a decisive role in maintaining the contractile phenotype of MASMCs and preventing their conversion to a synthetic / proliferative phenotype, and is a key node in regulating airway remodeling in asthma. Therefore, it has clear potential and development value as a novel drug target for the treatment of allergic asthma.

[0090] Experiments using ACTN2 knockdown and overexpression in MASMC cells revealed that ACTN2 plays a crucial role in maintaining the contractile phenotype of MASMCs. When ACTN2 was knocked out, the expression of contractile markers in both the TGF-β-induced contractile phenotype and the PDGF-BB-induced synthetic phenotype was significantly reduced, and the cell morphology tended towards a polygonal synthetic phenotype. Conversely, overexpression of ACTN2 suppressed the low expression of contractile markers in the PDGF-BB-induced synthetic phenotype, resulting in a cell morphology tending towards an elongated contractile phenotype, similar to the performance of the WT group. These results suggest that ACTN2 plays an important role in regulating phenotypic transitions in MASMCs, particularly in allergic asthma, where ACTN2 may inhibit airway remodeling and excessive contraction by maintaining the contractile phenotype.

[0091] In summary, the above examples demonstrate that ACTN2 plays a crucial role in maintaining the contractile phenotype of ASMCs, and enhancing ACTN2 expression or activity is an effective way to promote the transformation of MASMCs from a synthetic phenotype to a contractile phenotype, thereby treating allergic asthma. The uses disclosed in this invention provide novel targets and strategies for developing new anti-asthma drugs.

Claims

1. Use of an ACTN2 protein enhancer in the preparation of a medicament for preventing, alleviating or treating asthma.

2. Use according to claim 1, characterized in that, The ACTN2 protein enhancer is a nucleic acid molecule capable of increasing the expression level of ACTN2 protein; the nucleic acid molecule is an expression vector comprising a nucleotide sequence encoding ACTN2 protein.

3. Use according to claim 2, characterized in that, The amino acid sequence of the ACTN2 protein or the nucleotide sequence of its encoding gene has at least 90% identity with the sequence shown in SEQ ID NO:

1.

4. Use according to claim 2 or 3, characterized in that, The expression vector is a viral vector, preferably selected from a lentivirus vector, an adeno-associated virus vector or an adenovirus vector.

5. Use according to claim 1, characterized in that, The ACTN2 protein enhancer is selected from at least one of the following: a) a small molecule compound capable of increasing the activity of ACTN2 protein; b) an antibody or antigen-binding fragment thereof that specifically binds and stabilizes ACTN2 protein.

6. Use according to claim 1, characterized in that, The medicament is used to promote the transformation of airway smooth muscle cells from a synthetic phenotype to a contractile phenotype, or to inhibit the transformation of airway smooth muscle cells from a contractile phenotype to a synthetic phenotype.

7. Use according to claim 1, characterized in that, The medicament is used to reduce airway hyperresponsiveness and / or inhibit airway remodeling.

8. A pharmaceutical composition comprising, as an effective ingredient, an ACTN2 protein enhancer and a pharmaceutically acceptable carrier, wherein, The composition is used to prevent, alleviate or treat asthma.

9. The pharmaceutical composition of claim 8, wherein, The ACTN2 protein enhancer is an expression vector comprising a nucleotide sequence encoding ACTN2 protein.

10. The pharmaceutical composition according to claim 8 or 9, characterized in that, The dosage form of the composition is an inhalation preparation, an atomized solution or an injection preparation.

Images