Method for increasing yield of terpenoids based on peroxisome surface display technology

Abstract

The invention discloses a method for increasing the yield of terpenoids based on a peroxisome surface display technology, which comprises the following steps of: expressing peroxisome membrane anchoring protein PEX15 in host bacteria; fusion protein of beta-carotene hydroxylase CrtZ and beta-carotene ketolase CrtW is expressed in a pichia pastoris strain PP-LC2-CoA1-IUP, and the fusion protein is anchored to the internal surface of a peroxidase body or anchored to the surface of the peroxidase body, so that the yield of astaxanthin is greatly increased. The construction method of the recombinant pichia pastoris is simple, synthesis of the astaxanthin can be better promoted by utilizing the surface of a peroxidase somatic cell, the engineering strain can efficiently synthesize the astaxanthin by utilizing glucose and methanol through shake flask fermentation, and meanwhile, the yield of the astaxanthin is improved. A peroxisome surface display technology is successfully applied to other terpenoids such as retinaldehyde and squalene, and reference is provided for production of other terpenoids.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to the construction method and application of peroxidase somatic organelle surface display technology in Pichia pastoris. Background Technology

[0002] Pichia pastoris is a methyltrophic yeast that, in addition to utilizing the traditional carbon source of glucose, can also utilize methanol as its sole carbon and energy source for growth. When methanol is used as the carbon source, Pichia pastoris cells produce a large number of peroxisomes to alleviate the metabolic stress of methanol. Therefore, using peroxisomes as a medium to anchor key enzymes in metabolic pathways to the surface of peroxisomes is an effective way to enhance the activity and expression levels of key enzymes. Currently, peroxisome surface display technology has been successfully applied to Saccharomyces cerevisiae and Kluyveromyces martensii, and has also been shown to significantly promote the production of the terpene compound santalene. Furthermore, the molecular manipulation platform of Pichia pastoris is mature and capable of high-density fermentation, showing broad development prospects.

[0003] Currently, the core methods for increasing terpene yield focus on three main directions: microbial metabolic engineering, fermentation process optimization, and innovative synthetic biology strategies. These methods utilize metabolic engineering and gene editing to enhance synthetic pathways, increase precursor supply, and reduce metabolic burden. Commonly used chassis include *Saccharomyces cerevisiae* and *Yersinia lipolytica*. However, there is currently no research on increasing terpene yield using peroxisome surface display technology in *Pichia pastoris*. Existing technologies also do not utilize the characteristic of *Pichia pastoris* to produce large amounts of peroxisomes when using methanol as a carbon source, which limits further increases in terpene yield. Therefore, further increasing the yield of terpene compounds, such as astaxanthin, remains a key research direction for promoting the industrial application of terpene compounds. Summary of the Invention

[0004] This invention provides a method for increasing the yield of terpenoids based on peroxisome surface display technology. By anchoring terpenoid synthase-related proteins to the internal surface of peroxisomes or to the surface of peroxisomes, the yield of terpenoids is increased.

[0005] The second objective of this invention is to provide a recombinant Pichia pastoris strain for synthesizing terpenoid compounds and a method for constructing the same;

[0006] The present invention also provides the application of the above-mentioned recombinant Pichia pastoris strain in the synthesis of terpenoid compounds.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] A method for increasing the yield of terpenoids based on peroxisome surface display technology includes the following steps:

[0009] (1) Construction of recombinant plasmid: The gene of terpene compound synthase was directly linked with the gene of peroxisome anchoring protein PEX15 to construct a recombinant plasmid;

[0010] (2) Construction of recombinant strains: The recombinant plasmid constructed in step (1) is transformed into the host strain, and recombinant strains that anchor the target protein to the internal surface of the peroxisome or to the surface of the peroxisome are screened to obtain the recombinant strains.

[0011] (3) Terpenoid synthesis: The recombinant strain obtained in step (2) is cultured to catalyze the synthesis of terpenoid compounds.

[0012] In step (1), the terpene compound synthase includes one or more of the following: squalene synthase SQS for synthesizing squalene, β-carotene 15,15'-monooxygenase BCMO for synthesizing retinaldehyde, β-carotene hydroxylase CrtZ and β-carotene ketolase CrtW for synthesizing astaxanthin, and phytoene synthase / lycopene cyclase CrtYB.

[0013] In step (2), the host strain is selected from Escherichia coli, yeast, and Bacillus subtilis, and the yeast is selected from Pichia pastoris and Saccharomyces cerevisiae. Pichia pastoris is preferred, and Pichia pastoris is more preferred.

[0014] The host strain was Pichia pastoris. We selected promoters and terminators that matched the expression of Pichia pastoris to promote the successful expression of the anchoring sequence PEX15 in Pichia pastoris. The promoters were pGAP and pGCW14, and the terminators were ScCYC1tt and RPL2Att. The related terpene compound synthase gene was directly linked to the peroxisome anchoring protein PEX15.

[0015] The terpenoid compound is at least one of squalene, retinaldehyde, or astaxanthin.

[0016] The coding genes for phytoene synthase / lycopene cyclase CrtYB are shown in SEQ ID No: 1; the coding gene for β-carotene hydroxylase CrtZ is shown in SEQ ID No: 2; the coding gene for β-carotene ketolase CrtW is shown in SEQ ID No: 3; the coding gene for peroxisome anchoring protein PEX15 is shown in SEQ ID No: 4; the coding gene for squalene synthase SQS is shown in SEQ ID No: 5; and the coding gene for β-carotene 15,15'-monooxygenase BCMO is shown in SEQ ID No: 6.

[0017] A recombinant Pichia pastoris strain for synthesizing astaxanthin based on peroxisome surface display technology, wherein the recombinant Pichia pastoris strain is obtained by expressing a fusion protein of phytoene synthase / lycopene cyclase CrtYB or β-carotene hydroxylase CrtZ and β-carotene ketolase CrtW in a host cell, and anchoring the fusion protein to one of the following: the internal surface of a peroxisome or the surface of a peroxisome.

[0018] Preferably, the recombinant Pichia pastoris strain is obtained by expressing a fusion protein of β-carotene hydroxylase CrtZ and β-carotene ketolase CrtW in a host cell and anchoring the fusion protein to the surface of a peroxisome.

[0019] The host strain is a genetically modified Pichia pastoris strain PP-LC2-CoA1-IUP.

[0020] In a preferred embodiment, green fluorescent protein EGFP is linked to PEX15, and red fluorescent protein mChery is linked to a peroxisome localization signal peptide.

[0021] In a preferred embodiment, the recombinant Pichia pastoris expresses the EGFP-PEX15 and mCherry-ePTS1 genes.

[0022] In a preferred embodiment, the recombinant Pichia pastoris strain expresses the genes CrtZ-Linker-CrtW, PEX15-CrtZ-Linker-CrtW, CrtZ-Linker-CrtW-PEX15, and CrtYB-PEX15, respectively, in the host bacteria.

[0023] The Linker is GGGGGGGG.

[0024] A recombinant Pichia pastoris strain for synthesizing astaxanthin using peroxisome surface display technology, wherein the recombinant Pichia pastoris strain is obtained by expressing green fluorescent protein, anchoring protein PEX15, and red fluorescent protein located on the peroxisome, as well as a fusion protein of β-carotene hydroxylase CrtZ and β-carotene ketolase CrtW derived from Haematococcus pluvialis in the host bacteria, and anchoring the fusion protein to the internal surface or surface of the peroxisome.

[0025] For recombinant Pichia pastoris strains synthesizing astaxanthin, this invention screened for display enzymes, including CrtYB and fusion proteins of CrtZ and CrtW. Localizing CrtZ and CrtW to the peroxisome surface better promoted astaxanthin accumulation. However, CrtYB is an enzyme that synthesizes β-carotene; its overexpression not only failed to induce astaxanthin accumulation but also had the opposite effect. Therefore, we believe that excessive accumulation of the substrate β-carotene restricts the effective synthesis of astaxanthin, and anchoring CrtZ and CrtW to the peroxisome surface is key to improving astaxanthin accumulation.

[0026] Using BB3eH-AC as the vector plasmid, a recombinant plasmid containing the EGFP-PEX15 and mCherry-ePTS1 genes was constructed and integrated into the ENO site of the Pichia pastoris GS115 genome to obtain the recombinant strain PP-EC.

[0027] Using BB3eH-14* as the vector plasmid, recombinant plasmids containing the genes CrtZ-Linker-CrtW, PEX15-CrtZ-Linker-CrtW, CrtZ-Linker-CrtW-PEX15, and CrtYB-PEX15 were constructed and integrated into the ENO site of the PP-LC2-CoA1-IUP genome to obtain recombinant bacteria PP-AS, PP-PZ, PP-WP, and PP-YBP.

[0028] The method for constructing the above-mentioned recombinant Pichia pastoris strain includes:

[0029] Using BB3eH-AC as the vector plasmid, a recombinant plasmid containing the EGFP-PEX15 and mCherry-ePTS1 genes was constructed and integrated into the ENO site of the host bacterium PP-LC2-CoA1-IUP genome to obtain the recombinant bacterium PP-EC.

[0030] Using BB3eH-14* as the vector plasmid, recombinant plasmids containing the genes CrtZ-Linker-CrtW, PEX15-CrtZ-Linker-CrtW, CrtZ-Linker-CrtW-PEX15, and CrtYB-PEX15 were constructed and integrated into the ENO site of the PP-LC2-CoA1-IUP genome to obtain recombinant bacteria PP-AS, PP-PZ, PP-WP, and PP-YBP.

[0031] The application of the above-mentioned recombinant Pichia pastoris strain in the synthesis of the natural product astaxanthin.

[0032] The applications include:

[0033] (1) The recombinant Pichia pastoris strain constructed above was cultured on a nutrient medium to obtain fermentation products;

[0034] (2) The fermentation product was extracted with dimethyl sulfoxide and ethanol to obtain astaxanthin.

[0035] The culture medium uses glucose or methanol as a carbon source.

[0036] More preferably, the culture medium is: 40 g / L glucose / methanol, 20 g / L tryptone, and 10 g / L yeast extract.

[0037] In a preferred embodiment, the fermentation culture uses glucose or methanol as a carbon source.

[0038] The recombinant Pichia pastoris strain for squalene synthesis based on peroxisome surface display technology was constructed using BB3eH-14* as the vector plasmid. Recombinant plasmids containing the SQS and SQS-PEX15 genes were constructed and integrated into the ENO site of the GS115 genome to obtain recombinant strains PP-S and PP-SP. The culture conditions were consistent with those used for astaxanthin production.

[0039] The recombinant Pichia pastoris strain for retinaldehyde synthesis based on peroxisome surface display technology was constructed using BB3eH-14* as the vector plasmid. Recombinant plasmids containing the BCMO and BCMO-PEX15 genes were constructed and integrated into the ENO site of the PP-B (CN118240674A) genome to obtain recombinant strains PP-B2 and PP-B2P. The culture conditions were consistent with those for astaxanthin production.

[0040] Beneficial effects:

[0041] This invention demonstrates that the peroxisome anchoring protein PEX15 can be successfully localized in Pichia pastoris. By linking the gene of terpene compound synthase with the gene of peroxisome anchoring protein PEX15, the target protein is anchored to the surface of peroxisomes to obtain recombinant Pichia pastoris, which can significantly increase the yield of terpene compounds.

[0042] This invention constructs a recombinant Pichia pastoris capable of de novo synthesis of astaxanthin using glucose or methanol, achieving efficient synthesis of the natural product astaxanthin in Pichia pastoris. By anchoring the key enzyme for astaxanthin synthesis to the surface of peroxisomes, and utilizing the enzyme co-localization strategy displayed on the peroxisome surface, the natural product astaxanthin is efficiently produced. Ultimately, the peroxisome-displayed strain PP-WP produced 292.77 mg / L of astaxanthin (9.78 mg / g) in a 250 mL shake flask using glucose as the sole carbon source, and 78.31 mg / L of astaxanthin (6.70 mg / g) using methanol as the sole carbon source. Attached Figure Description

[0043] Figure 1 The diagram shows the structure of plasmid BB3eH-AC-EGFP-PEX15-mCherry-ePTS1. This plasmid carries the hygromycin B gene as a selection marker for Pichia pastoris. The promoters are pGAP and pGCE14; the terminators are ScCYC1tt and RPL2Att. pGAP is directly linked to EGFP and PEX15, followed by ScCYC1tt; pGCW14 is directly linked to mCherry-ePTS1.

[0044] Figure 2 The diagram shows the structure of plasmid BB3eH-14*-CrtZ-Linker-CrtW. This plasmid carries the hygromycin B gene as a selection marker for Pichia pastoris. The promoter is pGAP, and the terminator is ScCYC1tt. pGAP is followed by CrtZ-GGGGGGGG-CrtW, and then ScCYC1tt.

[0045] Figure 3 The diagram shows the structure of plasmid BB3eH-14*-PEX15-CrtZ-Linker-CrtW. This plasmid carries the hygromycin B gene as a selection marker for Pichia pastoris. The promoter is pGAP, and the terminator is ScCYC1tt. pGAP is followed by PEX15-CrtZ-GGGGGGGG-CrtW, and then ScCYC1tt.

[0046] Figure 4 The diagram shows the structure of plasmid BB3eH-14*-CrtZ-Linker-CrtW-PEX15. This plasmid carries the hygromycin B gene as a selection marker for Pichia pastoris. The promoter is pGAP, and the terminator is ScCYC1tt. pGAP is followed by CrtZ-GGGGGGGG-CrtW-PEX15 and then ScCYC1tt.

[0047] Figure 5 To verify the targeting and localization of the peroxidase of the engineered strain PP-EC using fluorescence confocal microscopy.

[0048] Figure 6 The graph shows the yield of astaxanthin produced by engineered strains PP-AS, PP-PZ, PP-WP, and PP-YBP using glucose as a carbon source.

[0049] Figure 7 The graph shows the yield of astaxanthin produced by engineered strains PP-AS, PP-PZ, and PP-WP using methanol as a carbon source.

[0050] Figure 8 This study explores the application of peroxisome surface display technology in squalene synthesis.

[0051] Figure 9 This study explores the application of peroxisomal surface display technology in the synthesis of retinaldehyde. Detailed Implementation

[0052] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0053] The original strain used in the examples was *Pichia pastoris* PP-LC2-CoA1-IUP, which is a modified strain of *Pichia pastoris*. This strain was obtained by introducing the following into *Pichia pastoris* GS115: geraniol / geraniol diphosphate synthase CrtE, phytoene synthase / lycopene cyclase CrtYB, phytoene desaturase CrtI, β-carotene ketolase CrtW, β-carotene hydroxylase CrtZ, dehydrogenase Zwf1, phosphate dehydrogenase Gnd2, NADH dehydrogenase Pos5, ATP citrate lyase ACL, acetyl-CoA synthase ACS, choline kinase CK, and inositol polyphosphokinase IPK. The *Pichia pastoris* GS115 strain can be purchased commercially. The construction process of this strain is based on patent CN120682959A.

[0054] In this embodiment, the extraction and quantitative analysis steps of astaxanthin are as follows:

[0055] 1. Extraction of astaxanthin

[0056] (1) Take 1 mL of the mixed fermentation broth and centrifuge at 12000 rpm for 5 min (wash twice with pure water).

[0057] (2) After draining the water, resuspend the contents in 2 mL of dimethyl sulfoxide (DMSO) (preheated at 60℃) and shake evenly on a vortex mixer. Then place the container in a 55℃ water bath for 15 min.

[0058] (3) Add 6 mL of anhydrous ethanol.

[0059] (4) Centrifuge the sample at 12,000 rpm for 5 min. Transfer the supernatant to a new centrifuge tube and store it away from light.

[0060] 2. Quantitative analysis of astaxanthin: High performance liquid chromatography was used to detect the concentration of astaxanthin.

[0061] The liquid chromatograph used in this study was an Agilent Technologies 1200 Infinity series; the column was an Acclaim™ 120 C30 column; the UV absorption wavelength was 450 nm; the mobile phase was methanol and methyl tert-butyl ether; the flow rate was controlled at 1.0 mL / min; and the column temperature was 25℃.

[0062] Example 1: Amplification of Gene Elements and Preparation of Target Plasmids

[0063] (I) Preparation of target gene

[0064] The red fluorescent protein mCherry was purchased from Shanghai Beyotime Biotechnology Co., Ltd., catalog number: D2628; the green fluorescent protein was purchased from Weihai Newp Biotechnology Co., Ltd., catalog number: V009750.

[0065] Based on the coding gene sequences of β-carotene ketolase CrtW and β-carotene hydroxylase CrtZ from Haematococcus pluvialis provided on NCBI, the gene sequences were synthesized by Nanjing Genscript Biotech Co., Ltd. and codon optimization was performed on Pichia pastoris. The gene sequences are shown in SEQ ID No:2-3.

[0066] Based on the coding gene sequence of the peroxisome anchoring protein PEX15 from Saccharomyces cerevisiae provided on NCBI, PCR amplification was performed using the Saccharomyces cerevisiae genome as a template. The gene sequence is shown in SEQ ID No: 4.

[0067] The amino acid sequence of the linker is: GGGGGGGG, constructed according to the method described in patent CN 118146970 A.

[0068] (II) Construction of recombinant plasmids

[0069] 1. Using BB1-23 (Plasmid #98496) as the vector plasmid, construct recombinant plasmids containing EGFP-PEX15, mCherry-ePTS1, CrtZ-Linker-CrtW, PEX15-CrtZ-Linker-CrtW, CrtZ-Linker-CrtW-PEX15, and CrtYB-PEX15.

[0070] Each gene fragment was inserted into plasmid BB1-23 using the GoldenGate method, resulting in recombinant plasmids BB1-23-EGFP-PEX15, BB1-23-mCherry-ePTS1, BB1-23-CrtZ-Linker-CrtW, BB1-23-PEX15-CrtZ-Linker-CrtW, BB1-23-CrtZ-Linker-CrtW-PEX15, and BB1-23-CrtYB-PEX15, as detailed below:

[0071] Using EGFP-F and EGFP-R as primers, the EGFP fragment was amplified, and the PEX15 fragment was amplified using PEX15-F1 and PEX15-R1. The EGFP-PEX15 fragment was obtained through overlap extension. The primer sequences are shown in Table 4.

[0072] Using mCherry-ePTS1-F and mCherry-ePTS1-R as primers, the mCherry-ePTS1 fragment was amplified to obtain the mCherry-ePTS1 fragment. The primer sequences are shown in Table 4.

[0073] The CrtZ-Linker-CrtW fragment was amplified using CrtZ-Linker-CrtW-F1 and CrtZ-Linker-CrtW-R2 primers. The primer sequences are shown in Table 4.

[0074] Using CrtZ-Linker-CrtW-F2 and CrtZ-Linker-CrtW-R1 as primers, the CrtZ-Linker-CrtW fragment was amplified. Using PEX15-F2 and PEX15-R2 as primers, the PEX15 fragment was amplified. The PEX15-CrtZ-Linker-CrtW fragment was obtained through overlap extension. The primer sequences are shown in Table 4.

[0075] Using CrtZ-Linker-CrtW-F1 and CrtZ-Linker-CrtW-R3 as primers, the CrtZ-Linker-CrtW fragment was amplified, and using PEX15-F3 and PEX15-R3 as primers, the PEX15 fragment was amplified. The CrtZ-Linker-CrtW-PEX15 fragment was obtained through overlap extension. The primer sequences are shown in Table 4.

[0076] The CrtYB fragment was amplified using primers CrtYB-F and CrtYB-R, and the PEX15 fragment was amplified using primers PEX15-F4 and PEX15-R4. The CrtYB-PEX15 fragment was obtained by overlap extension PCR. The primer sequences are shown in Table 4.

[0077] The amplified EGFP-PEX15, mCherry-ePTS1, CrtZ-Linker-CrtW, PEX15-CrtZ-Linker-CrtW, CrtZ-Linker-CrtW-PEX15 and CrtYB-PEX15 fragments were recovered and purified by agarose gel electrophoresis.

[0078] GoldenGate was assembled using Bsa1 enzyme and T4 ligase from Shanghai Beyotime Biotechnology Co., Ltd. The reaction system is as follows:

[0079] Table 1

[0080] system 10 µL BB1-23 1 µL EGFP-PEX15 / mCherry-ePTS1 / CrtZ-Linker-CrtW / PEX15-CrtZ-Linker-CrtW / CrtZ-Linker-CrtW-PEX15 1 µL Bsa1 0.5 µL BSA 1 µL T4 ligase 0.5 µL T4buffer 1 µL distilled water 5 µL

[0081] The circular recombinant vector was transformed into E. coli DH5α competent cells. Positive recombinant plasmids BB1-23-GEFP-PEX15, BB1-23-mCherry-ePTS1, BB1-23-CrtZ-Linker-CrtW, BB1-23-PEX15-CrtZ-Linker-CrtW, BB1-23-CrtZ-Linker-CrtW-PEX15, and BB1-23-CrtYB-PEX15 were obtained by screening for kanamycin sulfate resistance on plates and verifying by colony PCR and sequencing.

[0082] 2. Construct expression boxes for GEFP-PEX15 and mCherry-ePTS1

[0083] Plasmids BB1-23-EGFP-PEX15, BB1-12-pGAP, and BB1-34-ScCYC1tt were inserted into plasmid BB2-AB using the GoldenGate method with Bpi1 enzyme and T4 ligase to obtain plasmid BB2-AB-pGAP-EGFP-PEX15-ScCYC1tt.

[0084] Plasmids BB1-23-mCherry-ePTS1, BB1-12-pGCW14, and BB1-34-RPL2Att were inserted into plasmid BB2-BC using the GoldenGate method with Bpi1 enzyme and T4 ligase to obtain plasmid BB2-BC-pGCW14-mCherry-ePTS1-RPL2Att.

[0085] The construction process of recombinant plasmid BB2-AB-pGAP-EGFP-PEX15-ScCYC1tt is as follows:

[0086] GoldenGate was assembled using Bpi1 enzyme and T4 ligase from Nanjing Formis Biotechnology Co., Ltd. The reaction system is as follows:

[0087] Table 2

[0088] system 10 µL BB2-AB 1 µL BB1-12-pGAP 1 µL BB1-23-EGFP-PEX15 1 µL BB1-34-ScCYC1tt 1 µL Bpi1 0.5 µL BSA 1 µL T4 ligase 0.5 µL T4buffer 1 µL distilled water 3 µL

[0089] The circular recombinant vector was transformed into Escherichia coli DH5α competent cells. The positive recombinant plasmids BB2-AB-pGAP-EGFP-PEX15-ScCYC1tt were obtained by screening for ampicillin resistance plates and verifying by colony PCR and sequencing.

[0090] The construction process of the recombinant plasmid BB2-BC-pGCW14-mCherry-ePTS1-RPL2Att is as follows:

[0091] The system is basically the same as in Table 2, except that the plasmids are changed to BB2-BC, BB1-12-pGCW14 and BB1-34-RPL2Att.

[0092] The circular recombinant vector was transformed into Escherichia coli DH5α competent cells. The positive recombinant plasmid BB2-BC-pGCW14-mCherry-ePTS1-RPL2Att was obtained by screening for ampicillin resistance on plates and verifying by colony PCR and sequencing.

[0093] 3. Using BB3eH-14*(Plasmid#98543) as a carrier, construct expression cassettes of CrtZ-Linker-CrtW / PEX15-CrtZ-Linker-CrtW / CrtZ-Linker-CrtW-PEX15 / CrtYB-PEX15.

[0094] Plasmids BB1-23-CrtZ-Linker-CrtW, BB1-12-pGAP, and BB1-34-ScCYC1tt were inserted into plasmid BB3eH-14* using the GoldenGate method with Bpi1 enzyme and T4 ligase to obtain plasmid BB3eH-14*-CrtZ-Linker-CrtW.

[0095] Plasmids BB1-23-PEX15-CrtZ-Linker-CrtW, BB1-12-pGAP, and BB1-34-ScCYC1tt were inserted into plasmid BB3eH-14* using the GoldenGate method with Bpi1 enzyme and T4 ligase to obtain plasmid BB3eH-14*-PEX15-CrtZ-Linker-CrtW.

[0096] Plasmid BB1-23-CrtZ-Linker-CrtW-PEX15, along with plasmids BB1-12-pGAP and BB1-34-ScCYC1tt, was inserted into plasmid BB3eH-14* using the GoldenGate method with Bpi1 enzyme and T4 ligase to obtain plasmid BB3eH-14*-CrtZ-Linker-CrtW-PEX15.

[0097] Plasmids BB1-23-CrtYB-PEX15, BB1-12-pGAP, and BB1-34-ScCYC1tt were inserted into plasmid BB3eH-14* using the GoldenGate method with Bpi1 enzyme and T4 ligase to obtain plasmid BB3eH-14*-CrtYB-PEX15.

[0098] The structure of the recombinant plasmid BB3eH-14*-CrtZ-Linker-CrtW is shown in the figure. Figure 2 Its construction process is as follows:

[0099] The reaction system is basically the same as in Table 2, except that the plasmids are changed to BB3eH-14*, BB1-12-pGAP, BB1-23-CrtZ-Linker-CrtW, and BB1-34-ScCYC1tt.

[0100] The circular recombinant vector was transformed into Escherichia coli DH5α competent cells, and the positive recombinant plasmid BB3eH-14*-CrtZ-Linker-CrtW was obtained by screening for hygromycin B resistance plates and verifying by colony PCR and sequencing.

[0101] The structure of the recombinant plasmid BB3eH-14*-PEX15-CrtZ-Linker-CrtW is shown in the figure. Figure 3 Its construction process is the same as described above.

[0102] The structure of the recombinant plasmid BB3eH-14*-CrtZ-Linker-CrtW-PEX15 is shown in the figure. Figure 4 Its construction process is the same as described above.

[0103] The recombinant plasmid BB3eH-14*-CrtYB-PEX15 was constructed in the same manner as described above.

[0104] 4. Using BB3eH-AC (Plasmid#98544) as a vector, construct a co-expression recombinant plasmid for GEFP-PEX15 and mCherry-ePTS1:

[0105] The plasmids BB2-AB-pGAP-EGFP-PEX15-ScCYC1tt and BB2-BC-pGCW14-mCherry-ePTS1-RPL2Att were inserted into the plasmid BB3eH-AC using the GoldenGate method with Bsa1 enzyme and T4 ligase to obtain the recombinant plasmid BB3eH-AC-EGFP-PEX15-mCherry-ePTS1.

[0106] The structure of the recombinant plasmid BB3eH-AC-EGFP-PEX15-mCherry-ePTS1 is shown below. Figure 1 Its construction process is as follows:

[0107] GoldenGate was assembled using Bsa1 enzyme and T4 ligase, and the reaction system is as follows:

[0108] Table 3

[0109] system 10 µL BB3rN-AC 1 µL BB2-AB-pGAP-EGFP-PEX15-ScCYC1tt 1 µL BB2-BC-pGCW14-mCherry-ePTS1-RPL2Att 1 µL Bsa1 0.5 µL BSA 1 µL T4 ligase 0.5 µL T4buffer 1 µL <![CDATA[ddH2O]]> 4 µL

[0110] The circular recombinant vector was transformed into Escherichia coli DH5α competent cells. The positive recombinant plasmid BB3eH-AC-EGFP-PEX15-mCherry-ePTS1 was obtained by screening for hygromycin B resistance plates and verifying by colony PCR and sequencing.

[0111] Table 4 Primer sequences

[0112] Primer name Sequence (5'-3') EGFP-F TCAATTGAACAACTATCAAAACACCATGATGGTGAGCAAGGGCGAG EGFP-R TCATTATCTCACTTGCAGCCATCTTGTACAGCTCGTCCATGC PEX15-F1 GCATGGACGAGCTGTACAAGATGGCTGCAAGTGAGATAATGA PEX15-R1 GTAAGCGTGACATAACTAATTACATGATCATATACTCGCTAGAAGTTTTAGCAAC mCherry-ePTS1-F ACTCGCTTCACTCAACAACAAAACATGGTGAGCAAGGGCGAG mCherry-ePTS1-R ACTTAGATCTTCTACCTCTTCCCAACAACTTAGATCTTCTACCTCTTCCCA CrtZ-Linker-CrtW-F1 ATGCTCAGCAAACTGCAGA CrtZ-Linker-CrtW-R1 TCAAGCCAGAGCAGGTACTAA PEX15-F2 CGCGAATTCGAAGACGCCATGGCTGCAAGTGAGATAATGA PEX15-R2 TCTGCAGTTTGCTGAGCATTATACTCGCTAGAAGTTTTAGCAACC CrtZ-Linker-CrtW-F2 GGTTGCTAAAACTTCTAGCGAGTATAATGCTCAGCAAACTGCAGA CrtZ-Linker-CrtW-R3 TCATTATCTCACTTGCAGCCATAGCCAGAGCAGGTACTAAC PEX15-F3 GTTAGTACCTGCTCTGGCTATGGCTGCAAGTGAGATAATGA PEX15 - R3 TCGAATTCGAAGACGCAAGCTCATATACTCGCTAGAAGTTTTAGCAAC CrtYB - F GGTCTCCCATGACTGCTTTGGCCTA CrtYB - R TCATTATCTCACTTGCAGCCATCTGACCCTCCCAACCAGACATG PEX15 - F4 CATGTCTGGTTGGGAGGGTCAGATGGCTGCAAGTGAGATAATGA PEX15 - R4 GGTCTCGAAGCTCATATACTCGCTAGAA

[0113] Example 2 Construction of recombinant bacteria

[0114] 1. Construction of recombinant bacteria PP-EC

[0115] The gene expression cassette plasmid BB3eH-AC-EGFP-PEX15-mCherry-ePTS1 was introduced into Pichia pastoris GS115 to obtain recombinant strain PP-EC.

[0116] 2. Construction of recombinant bacteria PP-AS, PP-PZ, PP-WP, and PP-YBP

[0117] The plasmid BB3eH-14*-CrtZ-Linker-CrtW / BB3eH-14*-PEX15-CrtZ-Linker-CrtW / BB3eH-14*-CrtZ-Linker-CrtW-PEX15 / BB3eH-14*-CrtYB-PEX15 of the gene expression cassette was introduced into Pichia pastoris PP-LC2-CoA1-IUP to obtain recombinant strains PP-AS, PP-PZ, PP-WP, and PP-YBP.

[0118] The specific method is as follows:

[0119] ① Competent cells were prepared by overnight culture of Pichia pastoris in YPD liquid medium (containing 2% peptone, 1% yeast extract and 2% glucose).

[0120] ② Using an electroporator, BB3eH-AC-EGFP-PEX15-mCherry-ePTS1 / BB3eH-14*-CrtZ-Linker-CrtW / BB3eH-14*-PEX15-CrtZ-Linker-CrtW / BB3eH-14*-CrtZ-Linker-CrtW-PEX15 / BB3eH-14*-CrtYB-PEX15 was introduced into the corresponding Pichia pastoris competent cells for homologous recombination.

[0121] ③ Use YPD selection plates with added hygromycin B for screening. Single colonies will grow in 2-3 days. The positive clones that are correctly identified by PCR are named recombinant bacteria PP-EC / PP-AS / PP-PZ / PP-WP / PP-YBP.

[0122] Example 3: Verification of recombinant bacteria by PP-EC fluorescence confocal microscopy

[0123] Fluorescence confocal microscopy verification of the engineered strain PP-EC revealed that the red fluorescent protein with peroxisome localization almost completely overlapped with the green fluorescent protein with PEX15. Figure 5 This indicates that PEX15 can successfully localize the linked protein to the surface of the peroxisome.

[0124] Example 4: Application of peroxisome display technology in astaxanthin production

[0125] The engineered strains were cultured using the original strain PP-LC2-CoA1-IUP and the recombinant strains PP-AS, PP-PZ, PP-WP, and PP-YBP from Example 2 to produce astaxanthin.

[0126] The specific method is as follows: Take the strain from the preservation tube, inoculate it into the YPD test tube with a 1% inoculation amount, and culture it at 30℃ for 24 h to obtain the seed liquid;

[0127] The seed culture was inoculated at a rate of 1% into 50 mL of fermentation medium (40 g / L glucose / methanol, 10 g / L yeast extract, and 20 g / L peptone), and cultured at 25℃ with shaking at 220 rpm for 5 days. 40 g / L glucose / methanol was added at 24 h. Using glucose as the sole carbon source, the astaxanthin yields of the recombinant strains PP-LC2-CoA1-IUP, PP-AS, PP-PZ, PP-WP, and PP-YBP were 171.98 mg / L, 168.73 mg / L, 248.69 mg / L, 292.77 mg / L, and 140.23 mg / L, respectively, with astaxanthin contents of 6.06 mg / g, 6.15 mg / g, 9.21 mg / g, 9.78 mg / g, and 4.96 mg / g, respectively. Figure 6 Using methanol as the sole carbon source, the astaxanthin yields of recombinant strains PP-LC2-CoA1-IUP, PP-AS, PP-PZ, PP-WP, and PP-YBP were 18.05 mg / L, 29.87 mg / L, 61.72 mg / L, 78.31 mg / L, and 12.81 mg / L, respectively, with contents of 3.37 mg / g, 2.76 mg / g, 6.41 mg / g, 6.70 mg / g, and 2.83 mg / g, respectively. Figure 7 Based on the above results, CrtW and CrtZ are key enzymes in astaxanthin synthesis. Anchoring CrtYB to peroxisomes leads to the accumulation of intermediate metabolites, affecting the effective accumulation of astaxanthin. However, simply increasing the levels of the key enzymes CrtW and CrtZ does not significantly improve astaxanthin production. Therefore, considering the characteristics of Pichia pastoris, CrtW and CrtZ were anchored to the surface and interior of peroxisomes, respectively. Compared with the control, when glucose was used as the carbon source, astaxanthin production increased by 44.60% when anchored to the interior surface of peroxisomes, and by 70.23% when anchored to the surface. When methanol was used as the carbon source, astaxanthin production increased by 241.94% when anchored to the interior surface of peroxisomes, and by 333.85% when anchored to the surface. This indicates that anchoring enzymes to the surface of peroxisomes is an efficient enzyme immobilization strategy, and utilizing different organelle strategies in yeast can provide a reference for the production of different chemicals by other yeasts.

[0128] Example 5: Application of peroxisome surface display technology in the production of retinaldehyde and squalene

[0129] To verify the universality of peroxisome display technology for other terpenoids, we linked squalene synthase (SQS) and β-carotene 15,15'-monooxygenase (BCMO) to PEX15 to demonstrate its application in other terpenoids. The results showed that localizing squalene synthase on the peroxisome surface increased squalene yield from 513.61 mg / L to 759.90 mg / L, a yield increase of 47.95%; and localizing β-carotene 15,15'-monooxygenase on the peroxisome surface increased retinaldehyde yield from 25.89 mg / L to 54.17 mg / L, a yield increase of 109.23%. Based on these results, peroxisome display can be successfully applied to the production of squalene and retinaldehyde.

[0130] This invention utilizes the peroxisome-anchored protein PEX15 to successfully demonstrate the ability to localize proteins on the surface of Pichia pastoris peroxisomes. Subsequently, by localizing the fusion protein of the key astaxanthin synthesis enzymes CrtZ and CrtW on the peroxisome surface, and using glucose or methanol as carbon sources, astaxanthin yields increased by 70.32% and 333.85%, respectively. This marks the first application of peroxisome surface display technology in Pichia pastoris and the first practical application of peroxisome surface display technology to astaxanthin synthesis. Simultaneously, we have also successfully applied this technology to the production of squalene and retinaldehyde, providing reference and guidance for the production of other terpenoid chemicals and offering valuable insights for the production of other chemicals by other yeasts.

Claims

1. A method for increasing the production of terpenoids based on the peroxisome surface display technology, characterized in that, The method comprises the following steps: (1) construction of a recombinant plasmid: connecting a terpenoid compound synthesis enzyme gene with a peroxisome anchor protein PEX15 gene to construct a recombinant plasmid; (2) construction of a recombinant strain: transforming the recombinant plasmid constructed in step (1) into a host strain to obtain a recombinant strain in which a target protein is anchored to the inner surface of a peroxisome or anchored to the surface of a peroxisome; (3) synthesis of a terpenoid compound: culturing the recombinant strain obtained in step (2) to catalyze the synthesis of a terpenoid compound.

2. The method of claim 1, wherein, In step (1), the terpenoid compound synthesis enzyme comprises at least one of squalene synthase SQS, beta-carotene 15,15'-monooxygenase BCMO, beta-carotene hydroxylase CrtZ, beta-carotene ketolase CrtW, and octahydrolycopene synthase / lycopene cyclase CrtYB.

3. The method of claim 1, wherein, In step (2), the host strain is selected from Escherichia coli, yeast, and Bacillus subtilis, and the yeast is selected from Pichia pastoris and Saccharomyces cerevisiae.

4. The method of claim 1, wherein, The terpenoid compound is at least one of squalene, retinal, or astaxanthin.

5. The method of claim 2, wherein, The coding gene of octahydrolycopene synthase / lycopene cyclase CrtYB is shown in SEQ ID No: 1, the coding gene of beta-carotene hydroxylase CrtZ is shown in SEQ ID No: 2, the coding gene of beta-carotene ketolase CrtW is shown in SEQ ID No: 3, the coding gene of peroxisome anchor protein PEX15 is shown in SEQ ID No: 4, the coding gene of squalene synthase SQS is shown in SEQ ID No: 5, and the coding gene of beta-carotene 15,15'-monooxygenase BCMO is shown in SEQ ID No:

6.

6. The method of claim 3, wherein, In step (2), the host strain is Pichia pastoris.

7. A recombinant Pichia pastoris strain for synthesizing astaxanthin, characterized in that, The recombinant Pichia pastoris strain is obtained by expressing a fusion protein of beta-carotene hydroxylase CrtZ and beta-carotene ketolase CrtW in a host strain and anchoring the fusion protein to the inner surface of a peroxisome or to the surface of a peroxisome.

8. A recombinant Pichia pastoris strain for synthesizing squalene, characterized in that, The recombinant Pichia pastoris strain is obtained by anchoring squalene synthase SQS to the surface of a peroxisome in host strain GS115.

9. A recombinant Pichia pastoris strain for synthesizing retinal, characterized in that, The recombinant Pichia pastoris strain is obtained by anchoring beta-carotene 15,15'-monooxygenase BCMO to the surface of a peroxisome in host strain PP-B.

10. The recombinant Pichia pastoris strain synthesizing astaxanthin according to claim 7, characterized in that, The recombinant Pichia pastoris strain is obtained by introducing the plasmid BB3eH-14*-CrtZ-Linker-CrtW-PEX15 of a gene expression cassette into Pichia pastoris PP-LC2-CoA1-IUP to obtain recombinant strain PP-WP.

Images