Sequence for enhancing antigen presentation and application thereof

Abstract

The invention provides an application of a signal peptide and / or an endoplasmic reticulum / cytoplasmic transmembrane region (ECTD) in preparation of a vaccine, and also provides an expression cassette and a polypeptide translated by the expression cassette, and the expression cassette encodes the signal peptide and / or the endoplasmic reticulum / cytoplasmic transmembrane region (ECTD) and a nucleic acid sequence of an antigen peptide. The invention also provides a vaccine containing a nucleic acid sequence for coding the expression cassette or a polypeptide obtained by translating the expression cassette and application of the vaccine in preparation of medicines for preventing or treating diseases.

Description

Technical Field

[0001] This disclosure belongs to the field of biotechnology, and in particular relates to a sequence for enhancing antigen presentation and its application. Background Technology

[0002] Currently, the optimization of mRNA vaccine molecular design mainly focuses on optimizing its general structure, including the UTR region, PolyA, and cap structure. The method for adding functional elements is singular, mainly SP / MITD. The elements in this patent are superior to SP / MITD and have demonstrated their function in human and mouse cell lines.

[0003] KDEL is a type of endoplasmic reticulum resident sequence signal. Short peptides with the KDEL sequence bind to the KDEL sequence receptor on COP-I vesicles and return to the endoplasmic reticulum. HDEL is a variant of KDEL that is naturally present in mammals, and its affinity for the KDEL receptor is more than 8 times that of KDEL. KDEL has been used in cervical cancer DNA vaccines.

[0004] SP / MITD is the signal peptide region and endoplasmic reticulum / cytoplasmic transmembrane domain of HLA-B. It has been used in BioNTech's mRNA vaccine design and has been reported to enhance antigen presentation and the intensity of the induced specific immune response. HLA-A and HLA-C are HLA-B analogues, and their signal peptide regions and endoplasmic reticulum / cytoplasmic transmembrane regions show high sequence similarity to SP / MITD, suggesting they may also enhance antigen presentation.

[0005] During antigen presentation, the mRNA molecule encoding the antigen is translated into antigen by ribosomes after being delivered into the cell. It is then further hydrolyzed into short peptides by proteasomes, exposing the antigen epitope. The short peptides then enter the endoplasmic reticulum via the TAP complex and combine with MHC-I molecules. The peptide-MHC-I complex is then transported to the cell surface, inducing the production of specific T cells.

[0006] Tapasin protein is a key protein in the formation of peptide-MHC-I complexes. It can bind to many key antigen presentation proteins, including TAP1 / 2, MHC-I, and ERp57. Its Editing-Loop domain plays a crucial role in the affinity selection for MHC-I binding. Many reports have found that the deletion or mutation of the C-terminal region of Tapasin protein greatly affects antigen presentation. Summary of the Invention

[0007] On one hand, this disclosure provides the use of a signal peptide and / or endoplasmic reticulum / cytoplasmic transmembrane region (ECTD) in the preparation of a vaccine, wherein...

[0008] The nucleic acid sequence of the ECTD is shown in SEQ ID NO: 6, SEQ ID NO: 8 or SEQ ID NO: 10, and the amino acid sequence of the ECTD is shown in SEQ ID NO: 16, SEQ ID NO: 18 and SEQ ID NO: 20.

[0009] The nucleic acid sequence of the signal peptide is shown in SEQ ID NO: 5, SEQ ID NO: 7 or SEQ ID NO: 9; the amino acid sequence of the signal peptide is shown in SEQ ID NO: 15, SEQ ID NO: 17 and SEQ ID NO: 19.

[0010] The vaccine is an mRNA vaccine, DNA vaccine, peptide vaccine, or DC vaccine, and the ECTD can enhance vaccine antigen presentation.

[0011] On the one hand, this disclosure provides an expression box containing a nucleic acid sequence encoding the following structural domains from the 5' to 3' ends:

[0012] 1) Signal peptides, optional adaptor peptides, antigenic peptides;

[0013] 2) Antigenic peptides, optional adaptor peptides, endoplasmic reticulum / cytoplasmic transmembrane region (ECTD); or

[0014] 3) Signal peptide, optional adaptor peptide, antigen peptide, optional adaptor peptide, endoplasmic reticulum / cytoplasmic transmembrane region (ECTD); wherein the endoplasmic reticulum / cytoplasmic transmembrane region (ECTD) comprises an amino acid sequence selected from the amino acid sequence shown in SEQ ID NO: 16, SEQ ID NO: 18 or SEQ ID NO: 20; and the signal peptide comprises an amino acid sequence selected from the amino acid sequence shown in SEQ ID NO: 15, SEQ ID NO: 17 or SEQ ID NO: 19.

[0015] In some specific embodiments, the amino acid sequence of the endoplasmic reticulum / cytoplasmic transmembrane region (ECTD) is shown in SEQ ID NO: 16, SEQ ID NO: 18 or SEQ ID NO: 20; and the signal peptide sequence is shown in SEQ ID NO: 15, SEQ ID NO: 17 or SEQ ID NO: 19.

[0016] In some specific embodiments, the expression frame includes, from its 5' to 3' ends, a nucleic acid sequence encoding the following domains: a signal peptide, an optional adaptor peptide, an antigen peptide, an optional adaptor peptide, and an endoplasmic reticulum / cytoplasmic transmembrane region (ECTD); wherein

[0017] (1) The signal peptide comprises the amino acid sequence shown in SEQ ID NO: 15, and the endoplasmic reticulum / cytoplasmic transmembrane region (ECTD) comprises the amino acid sequence shown in SEQ ID NO: 16; or

[0018] (2) The signal peptide comprises the amino acid sequence shown in SEQ ID NO: 17, and the endoplasmic reticulum / cytoplasmic transmembrane region (ECTD) comprises the amino acid sequence shown in SEQ ID NO: 18; or

[0019] (3) The signal peptide contains the amino acid sequence shown in SEQ ID NO: 19, and the endoplasmic reticulum / cytoplasmic transmembrane region (ECTD) contains the amino acid sequence shown in SEQ ID NO: 20.

[0020] In some specific embodiments, the expression frame includes, from its 5' to 3' ends, a nucleic acid sequence encoding the following domains: a signal peptide, an optional adaptor peptide, an antigen peptide, an optional adaptor peptide, and an endoplasmic reticulum / cytoplasmic transmembrane region (ECTD); wherein

[0021] (1) The amino acid sequence of the signal peptide is shown in SEQ ID NO: 15, and the amino acid sequence of the endoplasmic reticulum / cytoplasmic transmembrane region (ECTD) is shown in SEQ ID NO: 16; or

[0022] (2) The amino acid sequence of the signal peptide is shown in SEQ ID NO: 17, and the amino acid sequence of the endoplasmic reticulum / cytoplasmic transmembrane region (ECTD) is shown in SEQ ID NO: 18; or

[0023] (3) The amino acid sequence of the signal peptide is shown in SEQ ID NO: 19, and the amino acid sequence of the endoplasmic reticulum / cytoplasmic transmembrane region (ECTD) is shown in SEQ ID NO: 20.

[0024] In some specific embodiments, the signal peptide is directly linked to the antigen or linked through a adaptor peptide, and the endoplasmic reticulum / cytoplasmic transmembrane region (ECTD) is directly linked to the antigen or linked through a adaptor peptide.

[0025] In some specific embodiments, the signal peptide or the endoplasmic reticulum / cytoplasmic transmembrane region (ECTD) is respectively linked to the antigen via a linker peptide, wherein the linker peptide comprises an amino acid sequence as shown in SEQ ID NO: 21 or a sequence as shown in (G4S)n or (G2S)n, where n is any integer from 1 to 4.

[0026] In some specific embodiments, the amino sequence of the linker peptide is shown in SEQ ID NO: 21.

[0027] In some specific embodiments, the signal peptide comprises a nucleic acid sequence as shown in SEQ ID NO: 5, SEQ ID NO: 7 or SEQ ID NO: 9.

[0028] In some specific embodiments, the nucleic acid sequence of the signal peptide is shown as SEQ ID NO: 5, SEQ ID NO: 7 or SEQ ID NO: 9.

[0029] In some specific embodiments, the endoplasmic reticulum / cytoplasmic transmembrane region (ECTD) contains nucleic acid sequences as shown in SEQ ID NO: 6, SEQ ID NO: 8 or SEQ ID NO: 10.

[0030] In some specific embodiments, the nucleic acid sequence of the endoplasmic reticulum / cytoplasmic transmembrane region (ECTD) is shown in SEQ ID NO: 6, SEQ ID NO: 8 or SEQ ID NO: 10.

[0031] In some specific embodiments, the antigen is selected from one or more of the following: 1) oncogenic viral antigens, such as human papillomavirus (HPV) antigen, herpes simplex virus (EBV) antigen, hepatitis B virus (HBV) antigen, and hepatitis C virus (HCV); 2) tumor neoantigens, such as KRAS, TP53, PTEN, RBM10, STK11, ATM, SETD2, ARID1A, CDKN2A, EGFR, KEAP1, SMARCA4, PI3KCA, and BRAF and their mutants; 3) tumor-testis antigens, such as MAGE family proteins, NY-ESO-1 family proteins, SSX family proteins, CT45 family proteins, and CT47 family proteins, such as ACRBP, ACTL8, ADAM2, ADAM29, AKAP3, and A KAP4, ANKRD45, ARMC3, ARX, ATAD2, BAGE, BRDT, C15orf60, C21orf99, CABYR, CAGE1, CALR3, CASC5, CCDC110, CCDC33, CCDC36, CCDC62, CCDC83, CDCA1, CEP290, CEP55, COX6B2, CPXCR1, CRISP2, CSAG1, CSAG2, CT45A1, CT47A1, CT66 / AA884595, CT69 / BC040308, CT70 / BI818097, CTAG1B, CTAG2, CTAGE1, CTAGE5, CTCFL, CTNNA2, CXorf48, Cxorf61, cyclin A1, DCAF12, DDX43, DDX53, DKKL1, DMRT1, DNAJB8, DPPA2, DSCR8, EDAG, NDR, ELOVL4, FAM133A, FAM46D, FATE1, FBXO39, FMR1NB, FTHL17, GAGE1, GOLGAGL2 FA, GPAT2, GPATCH2, HIWI, MIWI, PIWI, HORMAD1, HORMAD2, HSPB9, IGSF11, IL13RA2, IMP-3, JARID1B, KIAA0100, LDHC, LEMD1, LIPI, LOC130576, LOC196993, LOC348120, LOC440934, LOC647107, LUZP4, LY6K, MAEL, MAGEA1, MAGEA10, MAGEA11, MAGEA12, MAGEA2, MAGEA3, MAGEA4, MAGEA5, MAGEA6, MAGEA8, MAGEA9, MAGEB1, MAGEB2, MAGEB3, MAGEB4, MAGEB5, MAGEB6,MAGEC1, MAGEC2, MAGEC3, MCAK, MORC1, MPHOSPH1, NLRP4, NOL4, NR6A1, NXF2, ODF1, ODF2, ODF3, ODF4, OIP5, OTOA, PAGE2, PAGE3, PAGE4, ​​PAGE5, PASD1, PBK, PEPP2, PIWIL2, PLAC1, POTEA, POTEB, POTEC, POTED, POTEE, POTEG, POTEH, PRAME, PRM1, PRM2, PRSS54, PRSS55, PTPN20A, RBM46, RGS22, ROPN1, RQCD1, SAGE1, SEMG1, SLCO6A1, SPA17, SPACA3, SPAG1, SPAG17, SPAG4, SPAG6, SPAG8, SPA G9, SPANXA1, SPANXB1, SPANXC, SPANXD, SPANXN2, SPANXN3, SPANXN4, SPANXN5, SPATA19, SPEF2, SPINLW1, SPO11, SSX1, SSX2, SSX 3. SSX4, SYCE1, SYCP1, TAF7L, TAG, TDRD1, TDRD4, TDRD6, TEKT5, TEX101, TEX14, TEX15, TFDP3, THEG, TMEFF1, TMEFF2, TMEM108, TMPRSS12, TPPP2, TPTE, TSGA10, TSP50, TSPY3, TSSK6, TTK, TULP2, VENTXP1, XAGE-4 / RP11-167P23.2, XAGE1, XAGE2, XAGE3, XAGE 5. ZNF165, ZNF645; 4) Cancer-fetoprotein antigens, such as alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), and 5T4 cancer-fetoprotein antigen; 5) Tumor overexpression antigens, such as HER2, HER3, EGFR, VEGF, c-MYC, IDO-1, PSA, PSMA, PAP, and RAS; 6) Tumor differentiation antigens, such as MART1, Melan-A, gp100, and tyrosinase; 7) Tumor stem cell antigens, such as TLR2, ROR1, MAGEA12, PA17, PLU-1, TEX15, TENM, SCARA5, and xCT.

[0032] In some specific embodiments, the expression box includes an amino acid sequence encoding an amino acid sequence selected from SEQ ID NO: 33-35, 44-45 or 50-53, or an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with it.

[0033] In some specific embodiments, the expression box includes a nucleic acid sequence selected from the nucleic acid sequences shown in SEQ ID NO: 26-28, 40-41 or 46-49 that has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with it.

[0034] On the other hand, this disclosure provides the use of the expression cassettes described above in the preparation of mRNA vaccines, DNA vaccines, peptide vaccines or DC vaccines.

[0035] On the other hand, this disclosure provides a polypeptide obtained by translating an expression frame as described above.

[0036] In another aspect, this disclosure provides a vaccine comprising a nucleic acid sequence of an expression cassette as described above, wherein the vaccine is an mRNA vaccine, a DNA vaccine, or a DC vaccine.

[0037] In another aspect, this disclosure provides a vaccine comprising the polypeptides as described above, wherein the vaccine is a polypeptide vaccine.

[0038] In some specific embodiments, the aforementioned peptides and vaccines are used in the preparation of medicines for the prevention or treatment of diseases.

[0039] Beneficial effects

[0040] This disclosure provides a universal element for enhancing vaccine antigen presentation. The element involved in this invention enhances the efficiency of antigen presentation by MHC-I molecules on antigen-presenting cells, further enhancing the induction of specific T cells, thereby enhancing vaccine function. This disclosure obtains the element SP through screening. hlac / ECTD hlac and SP tapasin / ECTD tapasin It has been shown to have antigen presentation efficiency several times higher than the SP / MITD element reported by BioNTech, and has demonstrated ECTD hlac and ECTD tapasin As the main functional area; Attached Figure Description

[0041] This disclosure can be more fully understood with reference to the following figures.

[0042] Figure 1 A schematic diagram of the sequence of the combination of the element and the OVA pattern antigen is shown.

[0043] Figure 2 The results of screening antigen-presenting elements in MC38 cells are shown.

[0044] Figure 3 The results of screening antigen-presenting elements in DC2.4 cells are shown.

[0045] Figure 4 The structure diagrams of pLVX-CD8 and pLVX-CMV-TCR plasmids are shown.

[0046] Figure 5 The expression of CD8 and CMV_TCR in the NFAT-Jurkat-CD8-CMV_TCR monoclonal cell line is shown.

[0047] Figure 6 The results of the antigen presentation element validation in the NFAT-Jurkat-CD8-CMV_TCR cell line are shown.

[0048] Figure 7 A schematic diagram of individual components and combinations of components is shown.

[0049] Figure 8 The results of screening antigen-presenting elements in MC38 cells are shown.

[0050] Figure 9 The results of screening antigen-presenting elements in DC2.4 cells are shown.

[0051] Figure 10 The plasmid structures of plasmids pIPM and pLVX are shown. Detailed Implementation

[0052] The following description of this disclosure is merely intended to illustrate various embodiments of the disclosure. Therefore, the specific modifications discussed should not be construed as limiting the scope of this disclosure. It will be apparent to those skilled in the art that various equivalents, changes, and modifications can be made without departing from the scope of this disclosure, and it should be understood that these equivalent embodiments are included herein. All references cited herein, including publications, patents, and patent applications, are incorporated herein by reference in their entirety.

[0053] To enable those skilled in the art to better understand the present disclosure, the technical solutions in the embodiments of the present disclosure will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present disclosure, and not all embodiments.

[0054] Table 1 Experimental Materials

[0055]

[0056]

[0057] Description of modified plasmids:

[0058] The pIPM plasmid was modified from the publicly available plasmid pUC57-Kan (SEQ ID NO: 48). Specifically, the transcriptional region inserted into the multiple cloning site region consists of the following sequences from 5' to 3': T7 promoter (for binding T7 transcriptase), 5'UTR (derived from the 5'UTR of natural human hemoglobin A), Kozak sequence (GCCACCAUGG, a conserved eukaryotic sequence, translation initiation factor binding site), ORF (open reading frame, protein-encoding nucleic acid sequence), 3'UTR (AES and mtRNR 3'UTR tandem sequence), PolyA and BspQI restriction sites. The plasmid structure is shown in [link to plasmid structure description]. Figure 10 A.

[0059] pLVX was modified from the publicly available plasmid pLVX-puro (SEQ ID NO: 49), replacing the ampicillin resistance coding sequence with the kanamycin resistance coding sequence and deleting the puromycin resistance sequence. The plasmid structure is shown below. Figure 10 B.

[0060] Example

[0061] Example 1: SP hlac / ECTD hlac and SP tapasin / ECTD tapasin Components improve the efficiency of ovalbumin (OVA) antigen presentation.

[0062] 1.1 Sequence Information

[0063] Ovalbumin (OVA) is a glycoprotein derived from egg white. Due to its favorable antigenic epitopes, it can induce humoral and cellular immune responses and is widely used as a classic model antigen in immunological experiments. 257-264 It is the first recognized antigenic epitope on an OVA that can be presented by MHC class I molecules (H-2Kb) and induce a strong CD8+ T response; this patent selects an OVA with a length of 25 amino acids. 249-273 As a model antigen, it contains MHC-I class molecule epitopes. hlaa SP hlac and SP tapsin These represent the signal peptide regions of human HLA-A, HLA-C, and Tapasin proteins, respectively, ECTDhlaa ECTD hlac and ECTD tapasin (ECTD stands for "Endoplasmic reticulum and cytoplasmic transmembrane domains") are the endoplasmic reticulum / cytoplasmic transmembrane regions of human HLA-A, HLA-C, and Tapasin proteins, respectively. The specific element sequences are shown in Table 2.

[0064] OVA, OVA-KDEL, OVA-HDEL, SP-OVA-MITD, SP hlaa -OVA-ECTD hlaa SP hlac -OVA-ECTD hlac and SP tapsin -OVA-ECTD tapasin Synthesized by Nanjing Genscript Biotech Co., Ltd. into the multiple cloning site of the publicly available plasmid pUC57-Kan; each element or antigen is linked by GGSGGGGGSGG, which does not easily generate new epitopes, and the specific sequences are shown in Table 3.

[0065] Table 2. Component Sequence List

[0066]

[0067]

[0068] Table 3. Optimized sequence list of OVA antigen and its components

[0069]

[0070]

[0071]

[0072] 1.2 Cell Culture

[0073] Culture of MC38 cell line: MC38 cells were cultured in T75 cell culture flasks in RPMI-1640 medium containing 10% FBS in a 37°C, 5% CO2 cell culture incubator. When the cell density reached 90% of the cell culture flask (approximately 2-3 days), the cells were passaged.

[0074] Culture of DC2.4 cell line: DC2.4 cells were cultured in T75 cell culture flasks in a 37°C, 5% CO2 cell culture incubator using DC2.4-CM medium, a dedicated complete medium for mouse bone marrow-derived dendritic cells. When the cell density reached 80% of the cell culture flask (approximately 2-3 days), the cells were passaged.

[0075] 1.3 Construction of plasmids

[0076] Nanjing GenScript Biotechnology Co., Ltd. was commissioned to synthesize OVA, OVA-KDEL, OVA-HDEL, SP-OVA-MITD, and SP. hlaa -OVA-ECTD hlaa SP hlac -OVA-ECTD hlac and SP tapsin -OVA-ECTD tapasin Encoded sequences, as shown in Table 3 and Figure 1 As shown, the synthesized sequence was digested and ligated into the ORF region between the BamHI and SacI restriction endonuclease sites of the self-modified in vitro transcription plasmid pIPM.

[0077] 1.4 Preparation of mRNA

[0078] The plasmid was linearized by BspQI digestion, and the digestion was terminated by reacting at 50℃ for 3 h and then at 80℃ for 20 min. DNA magnetic beads were then used for further processing. The linearized plasmid was purified using DNA Clean Beads. Using the purified linearized plasmid as a template, mRNA was prepared using the EasyCap T7 Co-transcription Kit. The prepared mRNA was then used for electroporation or stored at -80°C.

[0079] 1.5 Cell transfection

[0080] mRNA transfection of MC38 cells: After digestion and counting, 2E4 MC38 cells were seeded into each well of a 96-well cell culture plate and cultured in 100 μL of RPMI-1640 medium containing 10% FBS at 37°C. mRNA transfection was performed after cell adhesion (approximately overnight). The mRNA was then transfected into 5 μL of Opti-MEM medium. TM Add 0.15 μL of Lipofectamine Messenger to the culture medium, mix thoroughly, and incubate at room temperature for 10 min. Then, dilute 500 ng of mRNA to 5 μL of Opti-MEM. TM In the culture medium, the diluted mRNA was added to the diluted Lipofectamine Messenger and allowed to stand at room temperature for 5 min. 10 μL of the mixture was then vertically dropped into adherent MC38 cells and incubated at 37°C for 24 h before flow cytometry staining.

[0081] mRNA transfection of DC2.4 cells: After digestion and counting, 2E4 MC38 cells were seeded into each well of a 96-well cell culture plate and cultured in 100 μL of DC2.4-CM medium at 37°C. mRNA was transfected overnight after cell adhesion. The mRNA was then transferred to 5 μL of Opti-MEM medium. TM Add 0.15 μL of Lipofectamine Messenger to the culture medium, mix thoroughly, and incubate at room temperature for 10 min. Then, dilute 200 ng of mRNA to 5 μL of Opti-MEM. TM In the culture medium, the diluted mRNA was added to the diluted Lipofectamine Messenger and allowed to stand at room temperature for 5 min. 10 μL of the mixture was then vertically dropped into adherent MC38 cells and incubated at 37°C for 24 h before flow cytometry staining.

[0082] 1.6 Flow cytometry staining and detection

[0083] After discarding the culture medium in the 96-well plate, wash each well with 100 μL of PBS. Then, add 50 μL of 5% EDTA trypsin to each well and digest for 2 min at 37°C. Terminate the reaction with 100 μL of PBS. Transfer the cells to a 1.5 mL centrifuge tube, centrifuge at 350 g for 5 min, discard the supernatant, and wash once with PBS. Dilute the flow cytometry antibody PE anti-mouse H-2Kb bound to SIINFEKL Antibody 100 times with PBS to prepare the staining solution. Add 100 μL of staining solution to each sample, stain at room temperature in the dark for 30 min, centrifuge at 350 g for 5 min, discard the supernatant, wash once with PBS, resuspend the cells in 200 μL of PBS, and detect them in a flow cytometer. The PE anti-mouse H-2Kb bound to SIINFEKL antibody can recognize the complex formed by H-2Kb binding to SIINFEKL. Therefore, when the OVA epitope "SIINFEKL" is presented to the cell surface by H-2Kb, it can be recognized and bound by this antibody. The PE dye on the antibody can be recognized by a flow cytometer. Based on the above principle, this antibody can be used to detect the proportion of cells (positive rate) and the intensity of OVA antigen presentation (MFI) of each cell in a group of cells using flow cytometry.

[0084] 1.7 Experimental Results

[0085] Figure 2 This demonstrates the efficiency of OVA antigen presentation by H-2Kb in MC38 after assembling the antigen-presenting element. Based on the results, SP... hlac / ECTD hlac and SPtapasin / ECTD tapasin The proportion of OVA-H-2Kb positive cells in the group was 0.96 and 1.82 times higher than that in the SP / MITD group; the MFI was 1.84 and 2.88 times higher than that in the SP / MITD group, therefore the SP group... hlac / ECTD hlac and SP tapasin / ECTD tapasin The group element has a higher antigen presentation efficiency than SP / MITD.

[0086] Figure 3 This demonstrates the efficiency of OVA antigen presentation by H-2Kb in DC2.4 after assembling the antigen-presenting element. Based on the results, SP... hlac / ECTD hlac and SP tapasin / ECTD tapasin The proportion of OVA-H-2Kb positive cells in the group was 8.27 and 8.45 times higher than that in the SP / MITD group; the MFI was 6.06 and 10.04 times higher than that in the SP / MITD group. hlac / ECTD hlac and SP tapasin / ECTD tapasin The group element has a higher antigen presentation efficiency than SP / MITD.

[0087] Example 2: SP hlac / ECTD hlac and SP tapasin / ECTD tapasin Components improve CMVpp65 antigen presentation efficiency 2.1 Sequence information

[0088] The molecules required for constructing the reporter cell line to be overexpressed are: 1) the α and β chains of CMV_TCR that recognize antigens and 2) the CD8 molecule that helps recognize antigens. The α and β chains of CMV_TCR that recognize antigens are derived from CMV1 of TABLE1 (Zong, Shan, et al. "Very rapid cloning, expression and identifying specificity of T-cell receptors for T-cell engineering." PLoS ONE 15.2 (2020): e0228112.). The CD8 sequence is the coding sequence of the α and β chains of natural human CD8. They are linked by a self-cleavable P2A peptide. The coding sequences are the CD8αβ coding sequence SEQ ID NO:36 and the CMV_TCR coding sequence SEQ ID NO:37, respectively. The sequences were synthesized by Nanjing Genscript Biotech Co., Ltd. and inserted into the publicly available plasmid pUC57-Kan.

[0089] In this embodiment, the selected pattern antigen is a 25-amino acid peptide "WQAGILARNLVPMVATVQGQNLKYQ" containing the HLA-A*02:01 restriction epitope "NLVPMVATV" derived from the structural protein pp65 of human cytomegalovirus, abbreviated as CMVpp65 below; SP hlac and SP tapsin These are the signal peptide regions of human HLA-C and Tapasin proteins, respectively, ECTD hlac and ECTD tapasin (ECTD is an abbreviation for "Endoplasmic reticulum and cytoplasmic transmembrane domains") are the endoplasmic reticulum / cytoplasmic transmembrane regions of human HLA-C and Tapasin proteins, respectively. The specific sequences are shown in Table 2.

[0090] The CMVpp65 sequence was synthesized by Nanjing Genscript Biotech Co., Ltd. and onto the publicly available plasmid Puc57-Kan. SP-CMVpp65-MITD and SP... hlac -CMVpp6-ECTD hlac and SP tapasin -CMVpp6-ECTD tapasin The sequences were obtained by replacing the OVA antigen with CMVpp65 through enzyme digestion and ligation based on the plasmid in Example 1. Finally, each element or antigen was linked with GGSGGGGGSGG, which does not easily generate new epitopes. The specific sequences are shown in Table 5.

[0091] Table 4. Sequence List

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100] Table 5. Optimized sequence list of CMVpp65 antigen and its components

[0101]

[0102]

[0103] 2.2 Experimental Methods

[0104] a) Construction of NFAT-Jurkat-CD8-CMV_TCR stable cell lines

[0105] Plasmid construction: The synthetic CD8αβ coding sequence SEQ ID NO:36 and the CMV_TCR coding sequence SEQ ID NO:37 were cloned into the multiple cloning sites XhoI and BamHI of the modified plasmid pLVX. The final plasmid map used for packaging lentivirus is shown in [link to plasmid map]. Figure 4 The primers used for cloning are shown in Table 7.

[0106] Lentiviral packaging: 293FT cells were cultured in T175 flasks until cell confluence reached 50-60%. Lipo3000 and P3000 were prepared separately (Lipo3000 formula: 500μL Opti-MEM plus 25μL Lipo3000; P3000 formula: 500μL Opti-MEM, 50μL P3000, 6.25μg pLVX-CD8 or pLVX-CMV_TCR plasmid, 12.5μg psPAX, and 6.25μg pMD2.G). After preparation, the mixture was allowed to stand at room temperature for 5 min. The two were then mixed thoroughly and allowed to stand at room temperature for 30 min. Finally, the mixture was slowly added dropwise to the cell culture flask containing the virus to be packaged and placed in a CO2 incubator for incubation. Collect the supernatant 48h and 72h after plasmid transfection (add 20mL of fresh culture medium after collecting the supernatant at 48h), centrifuge at 4500rpm and 4℃ for 5min to remove cell debris and other precipitates, then filter the supernatant through a 0.22μM vacuum filter to remove impurities. Add 1 / 5 of the total volume of PEG8000 concentrate to the filtered solution, shake to mix, and place in a 4℃ refrigerator overnight for concentration and sedimentation. Transfer to 50mL centrifuge tubes, centrifuge at 4500rpm and 4℃ for 50min, discard the supernatant, invert the centrifuge tubes on paper towels for 2-3min to drain the liquid as much as possible, resuspend in 200μL of pre-chilled D-PBS, and then aliquot into 1.5mL centrifuge tubes, 50μL / tube, and store at -80℃ or use directly to infect target cells.

[0107] Lentiviral infection: 3E5 NFAT-Jurkat cells were seeded into 12-well plates, and 1 mL of RPMI-1640 medium containing 10% FBS, 5 μL of polybrene infection promoter and 50 μL of purified lentivirus were added. The mixture was then incubated in a CO2 incubator. The medium was changed every 12-24 hours. After expansion of the culture, the mixed clones with a high proportion of CD8 and CMV_TCR positive cells were detected by flow cytometry and used for single clone screening.

[0108] Flow cytometry staining: 3E5-10E5 cells were resuspended in 100 μL of PBS containing 2 μL of T-Select HLA-A*02:01CMVpp65 Tetramer-NLVPMVATV-PE and BV510 Mouse Anti-Human CD8 antibody. After staining in the dark for 15-30 min, the cells were washed with 1 mL of PBS and analyzed using a flow cytometer. T-Select HLA-A*02:01CMVpp65 Tetramer-NLVPMVATV-PE is a flow cytometry antibody used for antigen-specific TCR staining. It is formed by the binding of the antigenic epitope "NLVPMVATV" on the HCMV virus pp65 protein to an HLA-A*02:01 type MHC-I molecule and then to the PE dye. This dye molecule can be recognized by the TCR, thus achieving the purpose of flow cytometry staining. Subsequently, the cultured monoclonal cells were stained using the above dye and CD8 molecule dye. The cell line with the highest CD8 and CMV_TCR expression abundance was selected as the cell line used in the patent.

[0109] Single-clone screening: NFAT-Jurkat cells expanded cultured were sorted into 96-well plates and expanded in a CO2 incubator. After flow cytometry staining of each clone cell line according to the above method, the cells were detected in a flow cytometer. Cell lines with better CD8 and CMV_TCR expression were selected for expanded culture and preservation.

[0110] Explanation of the principle of flow cytometry screening for monoclonal strains: T-Select HLA-A*02:01CMV pp65 Tetramer-NLVPMVATV-PE is a flow cytometry antibody used for antigen-specific TCR staining. It is formed by the antigenic epitope "NLVPMVATV" on the HCMV virus pp65 protein binding to the HLA-A*02:01 type MHC-I molecule and then to the PE dye. This dye molecule can be specifically recognized and bound by CMV_TCR, and the PE on it allows the cells to be recognized by the flow cytometer. In this example, we simultaneously stained T-Select HLA-A*02:01CMV pp65 Tetramer-NLVPMVATV-PE and BV510 Mouse Anti-Human CD8 to detect the expression of CD8 and CMV_TCR, thereby selecting monoclonal strains with better overexpression of genes after lentiviral overexpression.

[0111] b) Screening of antigen-presenting elements

[0112] NFAT-Jurkat-CD8-CMV_TCR cell line culture: cultured in 1640 medium containing 10% FBS, maintaining a cell density of 5E5-5E6 cells / mL, and cultured for 2-3 generations before being used to detect function.

[0113] HepG2 cell line culture: Cultured in DMEM medium containing 10% FBS. When the cells reach 90% confluence, digest them with 0.25% EDTA-trypsin and passage them at a ratio of 1:5. After 2-3 passages, the cells can be used for electroporation or peptide loading.

[0114] Plasmid construction: The CMVpp65 sequence was synthesized by Nanjing GenScript Biotech Co., Ltd. and cloned into the pIPM plasmid. Further plasmids were constructed from pIPM-SP-OVA-MITD and pIPM-SP from Example 1. hlac -OVA-ECTD hlac and pIPM-SP tapasin -OVA-ECTD tapasin After excising the OVA fragment on the plasmid with SacII and XmaI, the fragment was ligated with the CMVpp65 fragment digested with SacII and XmaI from the pIPM-CMVpp65 plasmid using T4 ligase overnight to obtain pIPM-SP-CMVpp65-MITD and pIPM-SP. hlac -CMVpp65-ECTD hlac and pIPM-SP tapasin -CMVpp65-ECTD tapasin Plasmid.

[0115] mRNA preparation: The plasmid was linearized by BspQI digestion. After reacting at 50℃ for 3 h, the digestion was terminated by reacting at 80℃ for 20 min. The linearized plasmid was purified using DNA magnetic beads. Using the purified linearized plasmid as a template, mRNA was prepared using the EasyCap T7 Co-transcription Kit. The prepared mRNA was used for electroporation or stored at -80℃.

[0116] mRNA transfection: After digesting and counting HepG2 cells, seed 2E4 HepG2 cells per well in a 96-well cell culture plate and incubate in 100 μL of 1640 medium containing 10% FBS at 37°C. Once cells adhere, mRNA can be transfected (approximately overnight). [The text then abruptly shifts to a different topic:] ...in 5 μL Opti-MEM... TM Add 0.15 μL of Lipofectamine Messenger to the culture medium, mix thoroughly, and incubate at room temperature for 10 min. Then, dilute 20 ng, 2 ng, 0.2 ng, and 0.02 ng of mRNA to 5 μL of Opti-MEM. TM In the culture medium, the diluted mRNA was added to the diluted Lipofectamine Messenger and allowed to stand at room temperature for 5 min. 10 μL of the mixture was then vertically dropped into adherent MC38 cells and incubated at 37°C for 24 h before flow cytometry staining.

[0117] Cell co-culture and luciferase assay: 1E5 NFAT-Jurkat-CD8-CMV_TCR cells were seeded in each well, and 100 μL of 1640 medium containing 10% FBS was added to each well. After culturing in a 37℃ incubator for 6 h, 100 μL of luciferase assay reagent was added to each well, and the fluorescence value was detected in an ELISA reader.

[0118] Detection principle explanation: The NFAT-Jurkat reporter cell line overexpresses the NFAT-luciferase reporter gene. NFAT is a T cell activation transcription factor. After TCR signaling activation, it enters the cell nucleus and binds to DNA to initiate the expression of downstream luciferase. In this embodiment, HepG2 cells are transfected with mRNA overexpressing CMVpp65 antigen. Its epitope NLVPMVATV binds to MHC-I and is expressed on the cell surface (antigen presentation). It can bind to CD8 and TCR overexpressed on NFAT-Jurkat-CD8-CMV_TCR cells (immune recognition), activating the downstream signaling pathway of TCR, so that the reporter cell line NFAT-Jurkat cells overexpress luciferase. The added reagent Bio-Lite Luciferase Assay System is a luciferase substrate that can generate a fluorescent signal. Therefore, the stronger the signal detected by the microplate reader, the stronger the TCR activation, the more antigen presented by the mRNA molecule, and the higher the antigen presentation amplification of the assembled elements.

[0119] 2.3 Experimental Results

[0120] Figure 4 The structure diagrams of the pLVX-CD8 and pLVX-CMV-TCR plasmids used for lentivirus construction are shown.

[0121] Figure 5 The results showed that monoclonal cell line 18 had the best overexpression effect, and flow cytometry results showed that the proportion of cells that were double positive for CD8 and CMV_TCR could reach more than 90%.

[0122] Figure 6 The study demonstrated the expression of different concentrations of CMVpp65, SP-CMVpp65-MITD, and SPhlac-CMVpp65-ECTD. hlac and SP tapasin -CMVpp65-ECTD tapasin The activation of HepG2 cells with mRNA after co-culturing with the NFAT-Jurkat-CD8-CMV_TCR cell line for 6 h was investigated. The electroporation results at different concentration gradients were used to generate log(agonist) vs. response-variable slope (four parameters) curves in GraphPad. (CMVpp65, SP-CMVpp65-MITD, SP...) hlac -CMVpp65-ECTD hlac and SP tapasin -CMVpp65-ECTD tapasinThe EC50 values ​​are: 55.82, 12.51, 8.288, and 2.596, respectively. hlac -CMVpp65-ECTD hlac and SP tapasin -CMVpp65-ECTD tapasin The EC50 of the SP-CMVpp65-MITD group was approximately 1.5-fold and 4.82-fold lower than that of the SP-CMVpp65-MITD group, respectively. At a transfection mRNA concentration of 2 ng / mL, SP... hlac / ECTD hlac and SP tapasin / ECTD tapasin These figures are 2 times and 3.4 times higher than SP / MITD, respectively. The above results indicate that SP... hlac / ECTD hlac and SP tapasin / ECTD tapasin The combination of components promotes antigen presentation efficiency higher than the SP / MITD combination.

[0123] Example 3: The endoplasmic reticulum / cytoplasmic transmembrane region (ECTD) mainly functions to promote antigen presentation.

[0124] 3.1 Cell Culture

[0125] Culture of MC38 cell line: MC38 cells were cultured in T75 cell culture flasks in 1640 medium containing 10% FBS. When the cell density reached 90% of the cell culture flask (about 2-3 days), the cells were passaged.

[0126] Culture of DC2.4 cell line: DC2.4 cells were cultured in T75 cell culture flasks using DC2.4-CM medium, a complete medium for mouse bone marrow-derived dendritic cells, and the cells were seeded to a density of 80% in the cell culture flasks (approximately 2-3 days). Cells were then passaged.

[0127] 3.2 Plasmid Construction

[0128] pIPM-OVA, pIPM-SP-OVA-MITD, pIPM-SP tapasin -OVA-ECTD tapasin and pIPM-SP hlac -OVA-ECTD hlac The plasmid pIPM-SP constructed in Example 1 is used. tapasin -OVA, pIPM-OVA-ECTD tapasin pIPM-SP hlac -OVA and pIPM-OVA-ECTD hlac SP was generated by PCR tapasin -OVA and OVA-ECTD tapasinFrom pIPM-SP tapasin -OVA-ECTD tapasin Cloning, SP hlac -OVA and OVA-ECTD hlac From pIPM-SP hlac -OVA-ECTD hlac In the middle cloning, the PCR product SP tapasin -OVA, OVA-ECTD tapasin SP hlac -OVA and OVA-ECTD hlac The PCR products were digested with BamHI and SacI, purified by gel back purification, and then ligated into the digested vector pIPM using T4 ligase. The ligation products were transformed into StarK1 competent cells, plated on culture plates containing 50 μg / mL kanamycin, and then single clones were selected for sequencing. After the correctly sequenced single clones were expanded, plasmids were extracted using an endotoxin-free plasmid extraction kit for mRNA preparation. The sequences are shown in Table 6.

[0129] The primers used to construct the plasmids were purchased from Sangon Biotech (Shanghai) Co., Ltd., and their sequences are shown in Table 7. Each element or antigen was linked by a GGSGGGGGSGG linker that does not readily generate new epitopes.

[0130] Table 6. List of SP-OVA and OVA-ECTD sequences

[0131]

[0132]

[0133] Table 7. Primer Table

[0134] Primer name Primer sequence SEQ ID NO COMMEN-F AGAGAGAACCCGCCACCGGATCC 66 <![CDATA[OVA-ECTD tapasin -F]]> ACCGGATCCATGGAGGTGTCTGGCCTGGAACAG 67 <![CDATA[SP tapasin -OVA-R]]> CAGGAGCTCTCACACGTTGCTGCTGGTCCACTCG 68 COMMEN-R TTGCGTGCATGCAGTACCAGGAGCTC 69 <![CDATA[OVA-ECTD hlac -F]]> ACCGGATCCATGGAGGTGTCCGGCCTGGAACAG 70 <![CDATA[SP hlac -OVA-R]]> CAGGAGCTCTCACACGTTGCTGCTGGTCCATTCG 71 CD8AB-F CCGCTCGAGGCCACCATGGCGCTGCCCGTC 72 CD8AB-R CGGGATCCTTACTTGTAAAACTGCTTCATGAAGCG 73 CMV_TCR-F CCGCTCGAGGCCACCATGGCGTCCGCTCCCA 74 CMV_TCR-R CGGGATCCTCAGCTGTTCTTCTTCTTCACCATGGCCAT 75

[0135] 3.3 mRNA preparation

[0136] The plasmid was linearized by BspQI digestion. After reacting at 50°C for 3 h, the digestion was terminated by reacting at 80°C for 20 min. The linearized plasmid was purified using DNA magnetic beads. Using the purified linearized plasmid as a template, mRNA was prepared using the EasyCap T7 Co-transcription Kit. The prepared mRNA was used for electroporation or stored at -80°C.

[0137] 3.4 Cell transfection

[0138] mRNA transfection of MC38 cells: After digestion and counting, 2E4 MC38 cells were seeded into each well of a 96-well cell culture plate and cultured in 100 μL of 1640 medium containing 10% FBS at 37°C. mRNA transfection was performed after cell adhesion (approximately overnight). In 5 μL of Opti-MEM... TM Add 0.15 μL of Lipofectamine Messenger to the culture medium, mix thoroughly, and incubate at room temperature for 10 min. Then, dilute 500 ng of mRNA to 5 μL of Opti-MEM. TM In the culture medium, the diluted mRNA was added to the diluted Lipofectamine Messenger and allowed to stand at room temperature for 5 min. 10 μL of the mixture was then vertically dropped into adherent MC38 cells and incubated at 37°C for 24 h before flow cytometry staining.

[0139] mRNA transfection of DC2.4 cells: After digestion and counting, 2E4 MC38 cells were seeded into each well of a 96-well cell culture plate and cultured in 100 μL of DC2.4-CM medium at 37°C. mRNA transfection was performed after cell adhesion (approximately overnight). The mRNA was then transfected into 5 μL of Opti-MEM medium. TM Add 0.15 μL of Lipofectamine Messenger to the culture medium, mix thoroughly, and incubate at room temperature for 10 min. Then, dilute 200 ng of mRNA to 5 μL of Opti-MEM. TM In the culture medium, the diluted mRNA was added to the diluted Lipofectamine Messenger and allowed to stand at room temperature for 5 min. 10 μL of the mixture was then vertically dropped into adherent MC38 cells and incubated at 37°C for 24 h before flow cytometry staining.

[0140] 3.5 Flow cytometry staining and detection

[0141] After discarding the culture medium in the 96-well plate, wash each well with 100 μL of PBS. Then, add 50 μL of 5% EDTA trypsin to each well and digest for 2 min at 37°C. Terminate the reaction with 100 μL of PBS. Transfer the cells to a 1.5 mL centrifuge tube, centrifuge at 350 g for 5 min, discard the supernatant, and wash once with PBS. Dilute the flow cytometry antibody that recognizes the H-2Kb-SIINFEKL complex 100-fold, add 100 μL of the diluted staining solution to each sample, stain at room temperature in the dark for 30 min, centrifuge at 350 g for 5 min, discard the supernatant, wash once with PBS, resuspend the cells in 200 μL of PBS, and detect them in a flow cytometer.

[0142] 3.6 Experimental Results

[0143] Figure 7 The diagram shows the sequence of the ORF region of the plasmid used to show the effects of individual element signal peptide regions, endoplasmic reticulum cytoplasmic transmembrane regions, and combinations on antigen presentation efficiency. Figure A shows the Tapsin protein, and Figure B shows the HLA-C protein.

[0144] Figure 8 Show the SP region of Tapsin protein and HLA-C protein signal peptide. tapasin and SP hlac Endoplasmic reticulum cytoplasmic transmembrane region ECDD tapasin and ECTD hlac and combined structure SP tapasin / ECTD tapasin and SP hlac / ECTD hlac After assembly into OVA and in vitro delivery of it as mRNA to MC38 cells, the presentation of OVA antigen 24 hours later indicated that the endoplasmic reticulum / cytoplasmic transmembrane domain (ECTD) was isolated. tapasin and ECTD hlac The percentage of antigen-presenting positive cells and MFI were isolated signal peptide groups (SPs). tapasin and SP hlac 1.38-fold and 6.76-fold (Tapasin), 1.46-fold and 6.20-fold (HLA-C); complete signal peptide region and endoplasmic reticulum / cytoplasmic transmembrane region assemblage (SP tapasin / ECTD tapasin and SP hlac / ECTD hlac The percentage of antigen-presenting positive cells and MFI were isolated endoplasmic reticulum / cytoplasmic transmembrane region groups (ECTD). tapasin and ECTD hlac The levels of HLA-C were 1.02 and 0.64 times higher than those of Tapasin, and 0.82 and 0.83 times higher than those of HLA-C, indicating that the endoplasmic reticulum / cytoplasmic transmembrane region is the main region responsible for antigen presentation.

[0145] Figure 9 Displaying the SP region of Tapsin protein and HLA-C protein signal peptide tapasin and SP hlac Endoplasmic reticulum cytoplasmic transmembrane region ECDD tapasin and ECTD hlac and combined structure SP tapasin / ECTD tapasin and SP hlac / ECTD hlacAfter assembly into OVA and in vitro delivery of it as mRNA to DC2.4 cells, the presentation of OVA antigen 24 hours later indicated that the endoplasmic reticulum / cytoplasmic transmembrane domain group (ECTD) alone was effective. tapasin and ECTD hlac The percentage of antigen-presenting positive cells and MFI were isolated signal peptide groups (SPs). tapasin and SP hlac 3.03-fold and 4.34-fold (Tapasin), 3.23-fold and 3.29-fold (HLA-C); complete signal peptide region and endoplasmic reticulum / cytoplasmic transmembrane region assemblage (SP tapasin / ECTD tapasin and SP hlac / ECTD hlac The percentage of antigen-presenting positive cells and MFI were isolated endoplasmic reticulum / cytoplasmic transmembrane region groups (ECTD). tapasin and ECTD hlac The levels of HLA-C were 0.87 and 1.45 times higher than those of Tapasin, and 1.03 and 1.28 times higher than those of HLA-C, indicating that the endoplasmic reticulum / cytoplasmic transmembrane region is the main region responsible for antigen presentation.

[0146] By incorporating via reference

[0147] The full contents of every patent and scientific document mentioned in this article are incorporated herein by reference for all purposes.

[0148] Equivalence

[0149] This disclosure may be embodied in other specific ways without departing from its spirit or essential characteristics. Therefore, the above embodiments should be considered illustrative in all cases and not as limiting of the invention described herein. Consequently, the scope of this disclosure is defined by the appended claims rather than by the foregoing description and is intended to be encompassed therein by all variations within the equivalent meaning and scope of the claims.

Claims

1. The use of signal peptides and / or endoplasmic reticulum / cytoplasmic transmembrane regions (ECTDs) in vaccine preparation, among which... The nucleic acid sequence of the ECTD is shown in SEQ ID NO: 6, SEQ ID NO: 8 or SEQ ID NO: 10, and the amino acid sequence of the ECTD is shown in SEQ ID NO: 16, SEQ ID NO: 18 and SEQ ID NO:

20. The nucleic acid sequence of the signal peptide is shown in SEQ ID NO: 5, SEQ ID NO: 7 or SEQ ID NO: 9; the amino acid sequence of the signal peptide is shown in SEQ ID NO: 15, SEQ ID NO: 17 and SEQ ID NO:

19. The vaccine is an mRNA vaccine, DNA vaccine, peptide vaccine, or DC vaccine, and the ECTD can enhance vaccine antigen presentation.

2. An expression frame comprising, from its 5' to 3' ends, a nucleic acid sequence encoding the following domains: 1) Signal peptides, optional adaptor peptides, antigenic peptides; 2) Antigenic peptides, optional adaptor peptides, endoplasmic reticulum / cytoplasmic transmembrane region (ECTD); or 3) Signal peptide, optional adaptor peptide, antigen peptide, optional adaptor peptide, endoplasmic reticulum / cytoplasmic transmembrane region (ECTD); in, The amino acid sequences of the endoplasmic reticulum / cytoplasmic transmembrane region (ECTD) are shown in SEQ ID NO: 16, SEQ ID NO: 18 and SEQ ID NO: 20; the sequence of the signal peptide is shown in SEQ ID NO: 15, SEQ ID NO: 17 and SEQ ID NO:

19.

3. The expression cassette of claim 2, wherein the 5' to 3' ends comprise a nucleic acid sequence encoding the following domains: a signal peptide, an optional adaptor peptide, an antigen peptide, an optional adaptor peptide, and an endoplasmic reticulum / cytoplasmic transmembrane region (ECTD); wherein (1) The amino acid sequence of the signal peptide is shown in SEQ ID NO: 15, and the amino acid sequence of the endoplasmic reticulum / cytoplasmic transmembrane region (ECTD) is shown in SEQ ID NO: 16; or (2) The amino acid sequence of the signal peptide is shown in SEQ ID NO: 17, and the amino acid sequence of the endoplasmic reticulum / cytoplasmic transmembrane region (ECTD) is shown in SEQ ID NO: 18; or (3) The amino acid sequence of the signal peptide is shown in SEQ ID NO: 19, and the amino acid sequence of the endoplasmic reticulum / cytoplasmic transmembrane region (ECTD) is shown in SEQ ID NO:

20.

4. The expression cassette of claim 2 or 3, wherein the signal peptide is directly linked to the antigen or linked via a adaptor peptide, and the endoplasmic reticulum / cytoplasmic transmembrane region (ECTD) is directly linked to the antigen or linked via a adaptor peptide.

5. The expression cassette of claim 3 or 4, wherein the signal peptide or the endoplasmic reticulum / cytoplasmic transmembrane region (ECTD) is respectively linked to the antigen via a linker peptide, wherein the amino acid sequence of the linker peptide is as shown in SEQ ID NO: 21 or as shown in (G4S)n or (G2S)n, where n is any integer from 1 to 4.

6. The expression box according to any one of claims 2 to 5, wherein the nucleic acid sequence of the signal peptide is as shown in SEQ ID NO: 5, SEQ ID NO: 7 or SEQ ID NO:

9.

7. The expression box according to any one of claims 2 to 6, wherein the nucleic acid sequence of the endoplasmic reticulum / cytoplasmic transmembrane region (ECTD) is as shown in SEQ ID NO: 6, SEQ ID NO: 8 or SEQ ID NO:

10.

8. The expression cassette according to claims 2 to 7, wherein the antigen is selected from one or more of the following: 1) oncogenic viral antigens, such as human papillomavirus (HPV) antigen, herpes simplex virus (EBV) antigen, hepatitis B virus (HBV) antigen, and hepatitis C virus (HCV); 2) tumor neoantigens, such as KRAS, TP53, PTEN, RBM10, STK11, ATM, SETD2, ARID1A, CDKN2A, EGFR, KEAP1, SMARCA4, PI3KCA, and BRAF and their mutants; 3) tumor-testis antigens, such as MAGE family proteins, NY-ESO-1 family proteins, and SSX. 4) Cancer-fetoprotein antigens, such as alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), and 5T4 cancer-fetoprotein; 5) Tumor overexpression antigens, such as HER2, HER3, EGFR, VEGF, c-MYC, IDO-1, PSA, PSMA, PAP, and RAS; 6) Tumor differentiation antigens, such as MART1, Melan-A, gp100, and tyrosinase; 7) Tumor stem cell antigens, such as TLR2, ROR1, MAGEA12, PA17, PLU-1, TEX15, TENM, SCARA5, and xCT.

9. Use of the expression cassette as described in any one of claims 2 to 8 in the preparation of an mRNA vaccine, DNA vaccine, peptide vaccine, or DC vaccine.

10. A polypeptide obtained by translating the expression frame according to any one of claims 2 to 8.

11. A vaccine comprising a nucleic acid sequence of an expression cassette as described in any one of claims 2 to 8, wherein the vaccine is an mRNA vaccine, a DNA vaccine, or a DC vaccine.

12. A vaccine comprising the polypeptide of claim 10, wherein the vaccine is a polypeptide vaccine.

13. Use of the polypeptide of claim 10, or the vaccine of claim 11 or 12, in the preparation of a medicament for the prevention or treatment of a disease.

Images