New pharmaceutical application of miR-126-3p

By supplementing miR-126-3p, which is downregulated in the early stages of retinal artery occlusion, the problem of retinal ischemia-reperfusion injury was resolved, retinal structure and function were protected, and visual recovery was improved.

CN121714599APending Publication Date: 2026-03-24RENMIN HOSPITAL OF WUHAN UNIVERSITY (HUBEI GENERAL HOSPITAL)
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-12
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

Existing treatments for retinal artery occlusion (RAO) are ineffective in preventing retinal ischemia-reperfusion injury, leading to retinal ganglion cell death and dysfunction. Current molecular targeted therapies lack specificity and cannot simultaneously protect retinal structure and function.

Method used

By supplementing miR-126-3p, which is significantly downregulated in the early stages of retinal artery occlusion, and using miR-126-3p or its functional equivalent as a drug component, retinal ischemia-reperfusion injury can be prevented or treated, and retinal structure and function can be protected.

Benefits of technology

It significantly reduces retinal ganglion cell death, restores retinal electrophysiological signals, improves retinal function, prevents irreversible damage, and enhances visual recovery.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention belongs to the field of biological medicines, and relates to a new pharmaceutical application of miR-126-3p. The invention discloses application of miR-126-3p or a functional equivalent thereof in preparation of a medicine for preventing or treating retinal structure damage and / or retinal function damage caused by retinal ischemia reperfusion injury caused by retinal artery occlusion. According to the medicine, by supplementing endogenous miR-126-3p consumed in the RIRI process, ganglion cell death can be reduced, and the retina structure can be protected; meanwhile, retina electrophysiological signals can be recovered, the retina function is improved, and therefore the core problem that in the prior art, vision of RAO patients is difficult to recover after blood recanalization is solved.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biological medicine, and relates to a new pharmaceutical use of miR-126-3p. BACKGROUND

[0002] Retinal artery occlusion (RAO) is a typical acute and critical condition in the field of ophthalmology. The core cause of RAO is the sudden occlusion of the central retinal artery, which directly leads to acute dysfunction of the retinal tissue and rapidly causes stasis of the axoplasm and intracellular edema. This pathological process progresses very quickly, and can cause permanent ischemia of the retina and irreversible death of retinal ganglion cells (RGCs) within a few hours. At the same time, the integrity of the blood-retinal barrier (BRB) is damaged, further aggravating the damage to the retinal tissue.

[0003] At present, the treatment of RAO in the clinic focuses on "removing the occlusive embolus in the retina". The specific means include basic symptomatic treatment such as eyeball massage, anterior chamber puncture and acetazolamide treatment, and thrombolytic treatment such as drug thrombolysis or interventional surgery thrombolysis. The core goal of treatment is to improve and restore the blood supply of the retina, so as to avoid the necrosis of retinal ganglion cells.

[0004] Although the existing treatment methods can achieve retinal blood flow recanalization in some patients, clinical data shows that only 18.7% of RAO patients can obtain limited recovery of vision after treatment. The core reason is the existence of retinal ischemia-reperfusion injury (RIRI). Even if the retinal artery restores blood perfusion, the original function of the retina cannot be restored, but more serious structural damage occurs, ultimately leading to irreversible damage.

[0005] In addition, the current molecular target research for RAO also has obvious deficiencies. Known targets such as vascular endothelial growth factor (VEGF) and PI3K / Akt pathway-related proteins focus on angiogenesis, single signal pathway regulation and other single pathological links, and lack of targeting for the multiple mechanism synergistic damage of RIRI. They lack specificity for RAO retinal tissue, especially RGCs. They cannot effectively protect the ischemic non-infarcted tissue, inhibit reperfusion injury and promote the structural and functional repair of the retina. The lack of comprehensive efficacy makes it difficult to meet the clinical needs.

[0006] At present, the pathogenesis of RAO and its secondary ischemia-reperfusion injury mechanism are not fully elucidated, how to prevent or treat the retinal ischemia-reperfusion injury caused by retinal ganglion cell death and abnormal retinal electrophysiological function after RAO treatment, so as to improve the visual recovery effect of patients, has become a key problem to be solved in the field of ophthalmology. SUMMARY

[0007] The present application proves by experiments that miR-126-3p is significantly down-regulated in the early retinal artery obstruction recanalization of mice, and supplementing endogenous miR-126-3p consumed in the RIRI process can effectively reduce the retinal ganglion cell death caused by RIRI, protect the integrity of retinal tissue structure, restore electrophysiological signals, improve retinal function, and restore vision. Based on this, the present application provides a new pharmaceutical use of miR-126-3p.

[0008] The technical scheme provided by the present application is as follows: The present application provides an application of miR-126-3p or a functional equivalent thereof in the preparation of a drug for preventing or treating retinal structural damage and / or retinal functional damage caused by retinal ischemia-reperfusion injury caused by retinal artery obstruction; wherein the functional equivalent is a molecule or composition having the same or similar biological function as miR-126-3p.

[0009] In some embodiments of the present application, the retinal structural damage is manifested as a decrease in the number of retinal ganglion cells.

[0010] In some embodiments of the present application, the retinal structural damage is also manifested as blood-retinal barrier damage or intraretinal edema.

[0011] In some embodiments of the present application, the retinal functional damage is manifested as a decrease in the amplitude of the b-wave of the electroretinogram or an abnormality in the latency of the b-wave of the electroretinogram.

[0012] In some embodiments of the present application, the prevention or treatment of retinal structural damage and / or retinal functional damage caused by retinal ischemia-reperfusion injury caused by retinal artery obstruction includes: Increasing the number of retinal ganglion cells; and / or, Improving the amplitude of the b-wave of the electroretinogram; and / or, Improving the latency of the b-wave of the electroretinogram.

[0013] In some embodiments of the present application, the drug is a therapeutic drug for retinal artery obstruction or a complication prevention drug after treatment of retinal artery obstruction; wherein: The therapeutic drug is an arterial thrombolytic drug, wherein miR-126-3p or a functional equivalent thereof is used as an auxiliary component for preventing retinal structure damage or function damage; The retinal artery obstruction treatment comprises one or more of the following: anterior chamber puncture, acetazolamide treatment, eyeball massage, arterial thrombolytic drug thrombolysis, and interventional surgery thrombolysis.

[0014] In some embodiments of the present application, the functional equivalent is selected from at least one of the following: a mimic, an agonist, a chemical modification, an engineered exosome, and a gene expression vector of miR-126-3p.

[0015] In some embodiments of the present application, the gene expression vector is a recombinant vector comprising a nucleotide sequence encoding miR-126-3p.

[0016] In some embodiments of the present application, the dosage form of the drug is an ocular local administration dosage form or a systemic administration dosage form; wherein: The ocular local administration dosage form is selected from one or more of the following: eye drops, eye wash, eye cream, eye gel, and intraocular injection. The systemic administration dosage form is selected from one or more of the following: oral dosage, suppository, and injection.

[0017] Compared with the prior art, the present application has at least the following beneficial effects: Experiments prove that a small amount of miR-126-3p can exhibit a significant protective effect on the retina of a mouse after blood recanalization of retinal artery obstruction, can reduce ganglion cell death (RGC) Figure 2 and Figure 4 protect the retinal structure; and can restore the electrophysiological signal (a-wave) Figure 3 and Figure 5 improve the retinal function. Therefore, by supplementing the endogenous miR-126-3p consumed in the RIRI process, the present application realizes the prevention or treatment of retinal structure and function damage caused by retinal ischemia-reperfusion injury induced by RAO, thereby solving the core problem that the vision of a patient with RAO is difficult to recover after blood recanalization in the prior art. BRIEF DESCRIPTION OF DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed in the embodiment description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0019] Figure 1Figure 6 is the expression of miR-126-3p in the retina at different reperfusion time points in the pterygopalatine artery and ophthalmic artery occlusion model; wherein: Sham represents the sham operation group, UPOAO-6h, UPOAO-1d, UPOAO-3d, UPOAO-7d represent the reperfusion 6 hours, 1 day, 3 days, 7 days groups after ischemia for 2 hours, respectively.

[0020] Figure 2 Figure 7 is the ganglion cell immunofluorescence staining result of the retinal smear of the mouse 2 days after the intervention of miR-126-3p-agomir solution (2 nmol / μL) and 7 days after the pterygopalatine artery and ophthalmic artery occlusion model.

[0021] Figure 3 Figure 8 is a waveform comparison of the a wave and b wave of the electroretinogram of the mouse 2 days after the intervention of miR-126-3p-agomir solution (2 nmol / μL) and 7 days after the pterygopalatine artery and ophthalmic artery occlusion model.

[0022] Figure 4 Figure 9 is the ganglion cell immunofluorescence staining result of the retinal smear of the mouse 3 weeks after the intervention of miR-126-3p-AVV virus suspension (5×10 9 vg / μL) and 7 days after the pterygopalatine artery and ophthalmic artery occlusion model.

[0023] Figure 5 Figure 10 is a waveform comparison of the a wave and b wave of the electroretinogram of the mouse 3 weeks after the intervention of miR-126-3p-AVV virus suspension (5×10 9 vg / μL) and 7 days after the pterygopalatine artery and ophthalmic artery occlusion model.

[0024] Figure 6 Figure 11 is the qPCR detection result of the expression changes of miR-126-3p precursor, intermediate and mature body of BE2C cells after OGD / R modeling.

[0025] Figure 7 Figure 12 is the qPCR detection result of the survival rate (crystal violet staining) of BE2C cells transfected with miR-126-3p mimics for 2 days in the OGD / R model and the expression of miR-126-3p.

[0026] Figure 8 Figure 13 is the qPCR detection result of the survival rate (crystal violet staining) of the plenti-GFP-miR-126-3p stable expression BE2C cell strain in the OGD / R model and the expression of miR-126-3p.

[0027] Figure 9 Figure 14 is the detection result of the WB apoptosis index of R28 cells transfected with miR-126-3p mimics for 2 days in the OGD / R model.

[0028] In the above figures, ns: no significant difference; : P<0.05, : P<0.01, : P<0.001, : P<0.0001. DETAILED DESCRIPTION

[0029] In order to make the objects, technical solutions and advantages of the present application clearer, the technical solutions of the present application will be described clearly and completely below in combination with the embodiments of the present application. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0030] miR-126 is a microRNA highly expressed in vascular endothelial cells (ECs) and platelets, and its gene is located on human chromosome 9, which can produce two mature bodies of miR-126-3p and miR-126-5p. The prior art uses miR-126-3p to study its role in retinal protection. Studies have shown that miR-126 is closely related to vascular endothelial homeostasis, can maintain vascular integrity, promote angiogenesis, limit atherosclerosis, and regulate platelet activity to affect thrombus formation. At present, the research on miR-126 related to blood vessels is relatively sufficient, and some studies also show that miR-126 may have a protective effect in myocardial infarction and cerebral infarction, but there is still controversy about the protective effect and mechanism of miR-126-3p or miR-126-5p in stroke.

[0031] The patent document with publication number WO2009126650A3 discloses that in a mouse model simulating retinopathy of human premature infants, injection of miR-126 inhibitors into the eyes of mice can treat retinopathy.

[0032] However, the present application proves by in vivo experiments that miR-126-3p is significantly consumed in the retinas of mice with retinal artery obstruction and recanalization ( Figure 1 ), and exogenous supplementation of a small amount of miR-126-3p can exhibit a significant protective effect on the retinas of mice after blood recanalization after retinal artery obstruction, can reduce the death of ganglion cells ( Figure 2 and Figure 4 ), protect the structure of the retina; and can restore the electro-physiological signalFigure 3 and Figure 5 ), and improves retinal function. Based on this, the application provides an application of miR-126-3p or a functional equivalent thereof in the preparation of a drug for preventing or treating retinal structural damage and / or retinal functional damage caused by retinal ischemia-reperfusion injury caused by retinal artery obstruction. "Prevention" refers to administration at the same time as retinal ischemia-reperfusion treatment; "treatment" refers to administration to patients who have already appeared clinical symptoms of retinal structural damage and / or retinal functional damage.

[0033] The application verifies that miR-126-3p has a protective effect on retinal ganglion cells after retinal artery obstruction treatment, thereby protecting the structure and function of the retina from damage. The application uses techniques such as tissue spreading and staining to observe the survival state of retinal ganglion cells in different mice in detail. The results show that the RGCs stained with Brn3a in the NC UPOAO group and the NC-AAV UPOAO group are significantly reduced compared with the Sham group, indicating that RIRI causes RGCs to die; the RGCs stained with Brn3a in the miR-126-3p-agomir UPOAO group and the miR-126-3p-AAV UPOAO group are more than those in the NC UPOAO group and the NC-AAV UPOAO group, indicating that miR-126-3p effectively inhibits the apoptosis process of RGCs during RIRI. In addition, the application detects the electroretinogram and finds that the retinal function of the miR-126-3p-agomir UPOAO group and the miR-126-3p-AAV UPOAO group is also significantly improved compared with the NC UPOAO group and the NC-AAV UPOAO group, respectively, specifically in that the amplitude and latency of the electrical signal are restored to near the level of the Sham group, further confirming the dual protective effect of miR-126-3p on the structure and function of the retina. These findings not only deepen the understanding of the pharmacological mechanism of miR-126-3p, but also provide a new perspective and potential drug treatment target for the clinical treatment of retinal artery obstruction.

[0034] In some embodiments of the application, the retinal functional damage is manifested as a decrease in the amplitude of the b-wave of the electroretinogram or abnormal latency. The detection using ERG in Example 1 shows that under different stimulation intensities, the amplitude of the b-wave of the NC UPOAO group is significantly reduced compared with the Sham group, indicating that the manifestation of retinal functional damage is a significant decrease in the amplitude of the b-wave of the electroretinogram, and that miR-126-3p intervention can significantly restore the amplitude of the b-wave of the electroretinogram, proving that miR-126-3p can effectively improve retinal function.

[0035] In some embodiments of the present application, the retinal structure damage further comprises blood-retinal barrier damage or intraretinal edema. Blood-retinal barrier damage or intraretinal edema is a recognized, classic pathological change of RAO and is an important component of the retinal structure damage.

[0036] In some embodiments of the present application, the drug is a therapeutic drug for retinal artery obstruction or a prevention drug for complications after treatment of retinal artery obstruction. Both are used after the occurrence of RAO, can be used during the treatment of retinal artery obstruction, can be used after the treatment of retinal artery obstruction, and can protect the retina after the blood supply of the retina artery obstruction is restored to prevent the structure and function of the retina from being damaged.

[0037] In some embodiments of the present application, the therapeutic drug is an arterial thrombolysis drug, and miR-126-3p is used as an auxiliary component in the arterial thrombolysis drug to prevent retinal structure damage or function damage. The time window for RAO treatment is short, and using miR-126-3p as an auxiliary component in the arterial thrombolysis drug can start to play a preventive role during the arterial thrombolysis process, avoiding the damage to the retinal structure or function caused by late administration.

[0038] In some embodiments of the present application, the arterial thrombolysis drug comprises a fibrinolytic component and / or a vasodilator component as the main component. The arterial thrombolysis drug can use a fibrinolytic component and / or a vasodilator component as the main component, and use miR-126-3p or a functional equivalent thereof as an auxiliary component.

[0039] In some embodiments of the present application, the treatment of retinal artery obstruction comprises one or more of anterior chamber puncture, acetazolamide treatment, eyeball massage, arterial thrombolysis drug thrombolysis, and interventional surgery thrombolysis. These methods of treating retinal artery obstruction can restore the blood supply of the retina, but can cause RIRI. The administration of miR-126-3p immediately after the treatment of retinal artery obstruction can reduce the damage to the structure and / or function of the retina of the patient and avoid irreversible decline in the vision of the patient.

[0040] In some embodiments of the present application, the complication is retinal structure damage or function damage. The present application has verified that the amplitudes of a wave and b wave of the electroretinogram of the retinal artery obstruction model mice are significantly restored 7 days after the intervention of miR-126-3p-agomir, which proves that the intervention of miR-126-3p-agomir after the treatment of retinal artery obstruction can avoid retinal function damage.

[0041] In some embodiments of the present application, the functional equivalent is selected from at least one of a mimic (miR-126-3p mimics, miR-126-3p-agomir), an agonist, a chemical modification, an engineered exosome, a gene expression vector of miR-126-3p. The engineered exosome refers to an exosome carrying miR-126-3p secreted by genetically engineered cells, for example, by transfecting a gene sequence encoding a precursor of miR-126-3p into mesenchymal stem cells, collecting the culture supernatant and extracting the exosome, an engineered exosome loaded with miR-126-3p can be obtained. The agonist refers to a small molecule compound capable of enhancing the expression or activity of miR-126-3p, preferably a compound capable of up-regulating the transcription of miR-126-3p.

[0042] In some embodiments of the present application, the gene expression vector is a recombinant vector comprising a nucleotide sequence encoding miR-126-3p. Preferably, the gene expression vector is hSyn-EGFP-pre-mir126-WPRE-hGHpolyA.

[0043] In some embodiments of the present application, the dosage form of the drug is an ocular local administration dosage form or a systemic administration dosage form; wherein: the ocular local administration dosage form is selected from one or more of eye drops, eye washes, eye creams, eye gels, intraocular injections; the systemic administration dosage form is selected from one or more of oral preparations, suppositories, injections. The present application proves that intraocular injection of miR-126-3p-agomir solution can prevent or treat retinal ischemia-reperfusion injury caused by retinal arterial obstruction, resulting in damage to retinal structure or function, compared with oral preparations, suppositories, eye drops, eye washes, eye creams, eye gels and other preparations, intraocular injection of miR-126-3p-agomir solution can achieve higher local drug concentration and better efficacy.

[0044] The technical solutions provided by the present application will be described in detail below in conjunction with the examples.

[0045] All experimental animals used were C57BL / 6 mice purchased from Liaoning Changsheng Biotechnology Co., Ltd. (Certificate No. 210726231100785184).

[0046] The 602156 silica gel thread plug (diameter 0.19±0.01mm, length 6.0±0.1mm) used was ordered from Pingdingshan Yushun Biotechnology Co., Ltd.

[0047] The drugs and reagents used were isoflurane and oxygen / nitrous oxide mixture gas purchased from Shenzhen Ruivode Technology Co., Ltd. Other conventional antibodies and reagents were all commercially available.

[0048] The instruments and apparatus used: surgical microscope is Japan Olympus SZX7, vitreous cavity injection instrument is American drummond Nanoject III microsyringe, Electro retinogram (ERG) uses Chongqing Aiexi Reti MINER 4.0, and fluorescent quantitative PCR instrument is American Bio-Rad CFX Connect. Others are common commercially available products.

[0049] Unless otherwise specified, the miR-126-3p-agomir solution and miR-126-3p-AVV virus suspension used in the examples are prepared by the following methods and administered as follows: ① Preparation of miR-126-3p-agomir solution: The miR-126-3p-agomir is synthesized by chemical synthesis, and the sense strand and antisense strand correspond to the double-stranded structure of miR-126-3p, respectively. In order to enhance its stability and cell penetration efficiency in the experiment, the antisense strand is chemically modified. Finally, the synthesized miR-126-3p-agomir is dissolved with PBS buffer to prepare a stock solution with a concentration of 2 nmol / μL.

[0050] The sequence information of miR-126-3p-agomir is as follows: Sense strand (5' to 3'): UCGUACCGUGAGUAAUAAUGCG (SEQ ID NO. 1); Antisense strand (5' to 3'): CAUUAUUACUCACGGUACGAUU (SEQ ID NO. 2); Chemical modification of antisense strand: (mC) (mA) (mU)(mU)(mA)(mU)(mU)(mA)(mC)(mU)(mC)(mA)(mC)(mG)(mG)(mU)(mA)(mC) (mG) (mA) (mU) (mU), the 3' end is modified with cholesterol, indicates a phosphorothioate bond, m indicates 2'-methoxy modification.

[0051] ② Preparation of miR-126-3p-AVV virus suspension: Firstly, a recombinant adeno-associated virus (rAAV) expression plasmid was constructed by molecular cloning technology. The plasmid takes pAAV-MCS as a backbone, and sequentially inserts a neuron-specific promoter hSyn, a reporter gene EGFP, a 73 bp mouse Mir126a gene (Gene ID: 387145, NCBI reference sequence: NR_029541.1), a woodchuck hepatitis B virus post-transcriptional regulatory element (WPRE), and a human growth hormone polyA signal (hGH polyA) between two ITR sequences to form the final recombinant plasmid, named rAAV-hSyn-EGFP-pre-mir126-WPRE-hGHpolyA.

[0052] Subsequently, using a three-plasmid co-transfection system, the constructed recombinant plasmid was co-transfected into HEK293T cells with a packaging plasmid (pAAV-RC) providing AAV replication / capsid proteins (Rep / Cap, serum type AAV2) and a helper plasmid (pHelper) providing adenovirus auxiliary functions. After 72 hours of transfection, the cell precipitate was collected, and the intracellular virus particles were released by repeated freeze-thawing method. Finally, the crude virus solution was purified by iodixanol density gradient centrifugation, and concentrated by PBS dialysis, and the final virus titer (vg / mL) was determined by qPCR.

[0053] The virus particles were dissolved in PBS and diluted to a working concentration of 5×10 9 vg / μL to obtain a miR-126-3p-AVV virus suspension.

[0054] Example 1: (1) Preoperative intravitreal injection of drugs A number of healthy male C57BL / 6 mice of the same age, aged 6-8 weeks, with body weight controlled at 20g±1g, were raised in an IVC system environment with temperature 24-17℃, relative humidity 60%, free access to food and water for one week.

[0055] Randomly grouped, intravitreal injection was performed, and according to the grouping in Table 1, each mouse was subjected to unilateral pterygopalatine ophthalmic artery embolization (UPOAO) surgery or sham operation (sham) in the left eye, and the right eye was not operated: Table 1 Grouping and treatment

[0056] (2) Surgical treatment (2.1) UPOAO surgery (2.1.1) Silicone thread preparation: Prepare the thread plug in advance, the specification is selected as follows: silicone diameter 0.19±0.01mm, silicone length 6mm±0.1mm, and No. 0.4 fishing line. Put into a 35mm sterile culture dish, soak in 75% alcohol for 1h, and naturally dry in a biological safety cabinet for standby use.

[0057] (2.1.2) Establishment of UPOAO mouse model: Anesthetize, fix, and control the body temperature of C57BL / 6 mice: Anesthetize the mice by inhaling 2.0% isoflurane and oxygen / nitrous oxide mixed gas. Place the mice in a supine position and fix them, wet the neck fur with 75% medical alcohol, and remove and clean it with a blade. Insert the anal temperature probe to keep the body temperature at 37±0.5℃.

[0058] (2.1.3) Isolation of the pterygopalatine artery: Isolate the left common carotid artery, internal carotid artery, and external carotid artery from the neck. Ligate the distal end of the external carotid artery with an 8-0 silk thread, pass another 8-0 silk thread at the proximal end of the external carotid artery, and tie a slipknot near the common carotid artery bifurcation. Clamp the internal carotid artery and common carotid artery with artery clamps. Cut a small opening 1mm below the ligation line of the external carotid artery.

[0059] (2.1.4) Insert the silicone thread plug No. 602156 into the pterygopalatine artery to construct the UPOAO model: Insert a sterile silicone thread plug No. 602156 from 1mm below the ligation line of the external carotid artery, gently push the thread plug with forceps until the silicone of the thread plug enters the common carotid artery. Release the internal carotid artery clamp, cut the external carotid artery at the small opening, pull back the thread plug, turn it over to make it enter the internal carotid artery, and insert it into the pterygopalatine artery. The insertion depth of the thread plug is about 6±1mm from the common carotid artery bifurcation, and the silicone tail of the thread plug is roughly located at the common carotid artery bifurcation. Tighten the slipknot slightly.

[0060] (2.1.5) Remove the retinal obstruction thread plug: After 120min of ischemia, remove the thread plug, ligate the proximal end of the external carotid artery, and release the artery clamp. Observe the reperfusion of the common carotid artery and internal carotid artery blood flow, and suture the wound.

[0061] (2.2) Sham operation The only difference between the sham operation and the UPOAO operation is that steps (2.1.4) and (2.1.5) are not performed.

[0062] (3) Evaluation of the effectiveness of RAO treatment 7 days after surgery, 6 mice from each group were taken, 2% sodium pentobarbital was injected intraperitoneally at a dose of 0.3 mL per 100 g of body weight for general anesthesia, and after the mice were anesthetized stably, compound tropicamide eye drops were dropped for mydriasis, and mydriasis was maintained for 5 min. The mydriatic mice were placed on the ERG operating table, the head was in the normal position, the eyes were consistent in height, and the tail electrode was clamped at the back end of the mouse tail. The subcutaneous electrode was inserted into the back of the neck. The left and right corneas were contacted with the model eye and the normal eye, and the amplitude changes of a wave and b wave of retinal electrogram were recorded by ERG different light intensity stimulation.

[0063] As shown in Figure 3 and Figure 5 , the b wave amplitude of the NC UPOAO group was significantly lower than that of the Sham group under all stimulation intensities, indicating that the UPOAO operation successfully caused damage to the inner retinal nerve function; the b wave amplitude of the miR-126-3p-agomir UPOAO group was significantly higher than that of the NC UPOAO group under all stimulation intensities, and tended to approach the level of the Sham group, indicating that miR-126-3p had a protective effect on the vision of mice, effectively reversing the decline in visual function caused by ischemic injury.

[0064] To further verify the protective effect of miR-126-3p on retinal ganglion cells (RGCs), the mouse retinal samples were fixed with 4% paraformaldehyde for 60 minutes, and retinal dissection was performed. The retinal sections were rinsed with PBS, and the retinas were immersed in 5% BSAT solution (i.e. a mixture of 0.3% triton X-100 in immunofluorescence blocking solution (BSA)), and placed in a 4°C refrigerator for overnight blocking. Brn3a rabbit serum primary antibody was incubated at 4°C for 48 hours, and after rinsing in PBS buffer, Alexa Fluor 594 goat anti-rabbit fluorescent secondary antibody was incubated at 4°C overnight, and after rinsing in PBS buffer, the retinas were moved to the glass slide with a Pasteur pipette, and after cutting and gently spreading with a brush into a clover shape, the glass slide was sealed with an anti-fluorescence quenching mounting medium, and the RGCs were counted by photographing with an upright microscope. As shown in Figure 2 and Figure 4 , compared with the Sham group, the Brn3a-stained RGCs on the retinal sections of the NC UPOAO group were significantly reduced, indicating that ischemic injury caused RGCs to die; and the Brn3a-stained RGCs on the retinal sections of the miR-126-3p-AVV UPOAO group were significantly more than those of the NC UPOAO group, confirming that miR-126-3p had a protective effect on the RGCs of mice.

[0065] (4) The neuroprotective effect of miR-126-3p intervention on RAO is achieved by supplementing the consumed miR-126-3p in the ischemia-reperfusion process The above in vivo experiment proves that miR-126-3p in the mouse retina is significantly down-regulated in the early stage of retinal artery obstruction reperfusion, indicating that the pathological process consumes a large amount of miR-126-3p.

[0066] In order to clarify that the supplement of miR-126-3p can directly produce a neuroprotective effect, the present application carries out an in vitro experiment, uses an oxygen-glucose deprivation / reoxygenation (OGD / R) model to simulate retinal ischemia-reperfusion injury, and the grouping of the in vitro experiment is shown in Table 2: Table 2

[0067] Transfection of miR-126-3p mimics or miR-126-5p mimics: in a culture box containing 95% O2 and 5% CO2 gas environment and certain humidity, BE2C cells and R28 cells are cultured for 24 hours using high-sugar DMEM (glucose concentration 4.5 g / L) complete medium containing 10% fetal bovine serum; miR-126-3p mimics or miR-126-5p mimics are diluted to 20 μM with nuclease-free water, and the miR-126-3p mimics or miR-126-5p mimics are transfected into BE2C and R28 cells.

[0068] No intervention treatment: in a culture box containing 95% O2 and 5% CO2 gas environment and certain humidity, BE2C cells and R28 cells are cultured for 24 hours using high-sugar DMEM (glucose concentration 4.5 g / L) complete medium containing 10% fetal bovine serum; nuclease-free water is added to the cell culture medium in an equal volume to the miR-126-3p mimics solution.

[0069] OGD / R modeling is performed after 2 days of intervention treatment, and the specific modeling process is as follows: the complete culture medium is discarded, the cells are rinsed with PBS for 2 times, sugar-free DMEM medium is added, and the BE2C cells are made to be anoxic for 3 hours and the R28 cells are made to be anoxic for 6 hours under a gas environment of 1% O2, 94% N2 and 5% CO2, and then the high-sugar DMEM complete medium is used for culture for 24 hours after anoxia.

[0070] As shown in Table 3, the expression of miR-126-3p in the intervention group is significantly higher than that in the no intervention group, and the expression of miR-126-3p in the miR-126-3p mimics group is significantly higher than that in the no intervention group, which proves that the supplement of miR-126-3p can directly produce a neuroprotective effect. Figure 6 Figure 7 、 Figure 8 ​The results showed that after transfection with miR-126-3p, the expression level of miR-126-3p in cells was significantly increased. However, miR-126-3p was significantly consumed after OGD / R modeling, and the protective effect was obvious. This indicates that BE2C cells resist the damage of OGD / R by directly consuming miR-126-3p.

[0071] In in vitro experiments, miR-126-3p intervention in BE2C cells was used to further verify that miR-126-3p protects nerve cells by replenishing miR-126-3p consumed during ischemia-reperfusion.

[0072] (4.2) miR-126-3p Functional Verification Crystal violet staining and Western blotting were used to determine cell viability and apoptosis rate, and the protective effects of miR-126-3p mimics and miR-126-5p mimics on BE2C and R28 cells were evaluated.

[0073] like Figure 7 , Figure 9 As shown, after transfection with miR-126-3p mimics, cell viability was significantly higher than that of cells transfected with miR-126-5p mimics and untreated cells, and the level of apoptosis was significantly reduced. This confirms the protective effect of miR-126-3p on the OGD / R model of neural cells.

[0074] (4.3) Construction of miR-126-3p specific expression system This invention constructed specific long-acting expression systems for miR-126-3p and miR-126-5p using the same construction method. Taking the target gene miR-126-3p as an example, the specific construction method is as follows: A lentiviral expression vector, plenti-GFP-miR30a-miR-126-3p, was constructed using the miR-30a-shRNA system. This lentiviral expression vector was transfected into HEK293T cells for lentiviral packaging. Subsequently, BE2C cells were infected with the packaged lentivirus, and cell lines that stably expressed miR-126-3p were selected by puromycin.

[0075] like Figure 8 As shown, qPCR validation revealed a significant upregulation of miR-126-3p expression in this cell line. Further OGD / R modeling and crystal violet staining experiments showed that specifically expressed miR-126-3p exhibited a clear cytoprotective effect in the OGD / R cell model, while the protective effect of miR-126-5p was not significant.

[0076] Figure 3 andFigure 5 It is shown that exogenous supplementation of miR-126-3p, either by transient delivery (agomir) or long-term expression (AAV), can significantly improve the retinal function impairment induced by retinal artery obstruction after recanalization.

[0077] In the description of the present specification, the description of the terms "one embodiment / way", "some embodiments / ways", "example", "specific example", or "some examples" and the like means that the specific features, structures, materials or characteristics described in connection with the embodiment / way or example are included in at least one embodiment / way or example of the present application. In the present specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment / way or example. Also, the specific features, structures, materials or characteristics described can be combined in any appropriate manner in any one or more embodiments / ways or examples. In addition, the person skilled in the art can combine and combine the different embodiments / ways or examples described in the present specification and the features of the different embodiments / ways or examples, without contradiction.

[0078] It should be noted that in the present application, the relationship terms such as "first" and "second" are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between the entities or operations. Also, the term "include", "contain" or any other variant thereof is intended to cover non-exclusive inclusion, so that the process, method, article or device including a series of elements not only includes those elements, but also includes other elements not explicitly listed or inherent to such process, method, article or device. Without more limitation, the element defined by the statement "including a" does not exclude the presence of another identical element in the process, method, article or device including the element. In the present application, the meaning of "a plurality of" is at least two, for example, two, three, etc., unless otherwise specifically specified.

[0079] The above is only a specific embodiment of the present application, enabling those skilled in the art to understand or implement the present application. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present application. Therefore, the present application will not be limited to these embodiments shown herein, but will conform to the widest scope consistent with the principles and novel features applied herein.

Claims

1. The use of miR-126-3p or its functional equivalent in the preparation of medicaments for the prevention or treatment of retinal structural and / or functional impairment caused by retinal ischemia-reperfusion injury due to retinal artery occlusion; wherein, The functional equivalent is a molecule or composition having the same or similar biological function as miR-126-3p.

2. The application according to claim 1, characterized in that: The damage to the retinal structure is manifested by a reduction in the number of retinal ganglion cells.

3. The application according to claim 2, characterized in that: The damage to the retinal structure can also manifest as disruption of the blood-retinal barrier or edema within retinal cells.

4. The application according to claim 1, characterized in that: The aforementioned retinal dysfunction manifests as a decrease in the amplitude of the beta wave on electroretinogram (ERG) or an abnormality in the beta wave latency on ERG.

5. The application according to claim 1, characterized in that: The prevention or treatment of retinal structural damage and / or retinal functional impairment caused by retinal ischemia-reperfusion injury due to retinal artery occlusion includes: Increase the number of retinal ganglion cells; and / or, Improve the amplitude of the b-wave on electroretinogram; and / or, Improves the latency of the b-wave on electroretinogram.

6. The application according to claim 1, characterized in that: The drug is a treatment for retinal artery occlusion or a preventive drug for complications after treatment of retinal artery occlusion.

7. The application according to claim 6, characterized in that: The therapeutic drug is an arterial thrombolytic drug, wherein miR-126-3p or its functional equivalent is used as an adjuvant to prevent retinal structural or functional damage. The treatment for retinal artery occlusion includes one or more of the following: anterior chamber paracentesis, acetazolamide therapy, ocular massage, thrombolysis with arterial thrombolytic drugs, and interventional thrombolysis.

8. The application according to claim 1, characterized in that: The functional equivalent is selected from at least one of miR-126-3p mimics, agonists, chemical modifiers, engineered exosomes, and gene expression vectors.

9. The application according to claim 8, characterized in that: The gene expression vector is a recombinant vector containing a nucleotide sequence encoding miR-126-3p.

10. The application according to claim 1, characterized in that: The drug is in the form of a topical ocular administration or a systemic administration; wherein: The ocular topical drug delivery dosage form is selected from one or more of eye drops, eye washes, ocular creams, ocular gels, and intraocular injections; The systemic drug delivery dosage form is selected from one or more of oral, suppository, and injection formulations.

Citation Information

Patent Citations

  • Inhibition of angiognesis

    WO2009126650A3

  • Gene therapy for treating an ocular disease

    US20250249127A1

  • Pharmaceutical composition for treatment of eye diseases comprising retinal organoid-derived exosomes

    WO2024014792A1