Application of CHCHD4 in preparation of medicine for treating cancer
By promoting the expression of the CHCHD4 gene and using CRISPR/Cas9 agents to enhance the treatment of triple-negative breast cancer, the problem of lack of targeted therapy and chemotherapy resistance has been solved. This has enabled metabolic reprogramming and immune regulation of tumor cells, thereby inhibiting tumor metastasis and proliferation.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-19
- Publication Date
- 2026-03-24
AI Technical Summary
Triple-negative breast cancer lacks targeted therapeutic targets, chemotherapy has limited efficacy and is prone to drug resistance, exhibits high heterogeneity and invasiveness, and carries a high risk of metastasis and recurrence, with limited existing treatment options.
By promoting the expression of the CHCHD4 gene, regulating the metabolism and immune microenvironment of tumor cells, and using CRISPR/Cas9 agents to enhance the expression of CHCHD4, the metastasis and proliferation of triple-negative breast cancer tumors can be inhibited.
This provides a new targeted therapy strategy that inhibits the metastasis and proliferation of tumor cells, regulates the metabolism and immune response of tumor cells, and offers a new approach for the treatment of triple-negative breast cancer.
Smart Images

Figure CN121714723A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedicine, specifically relating to the application of CHCHD4 in the preparation of drugs for treating cancer. Background Technology
[0002] Triple-negative breast cancer (TNBC) is a subtype of breast cancer, accounting for approximately 15-20% of all breast cancer cases. This type of breast cancer lacks the expression of hormone receptors (such as estrogen receptor and progesterone receptor) and HER2 receptor, making it unsuitable for effective treatment with traditional hormone therapy and targeted therapy. TNBC has complex biological characteristics, is highly invasive, has a poor prognosis, and is prone to early metastasis, posing a significant challenge to patient treatment. Therefore, the treatment of triple-negative breast cancer remains one of the most challenging problems in clinical oncology.
[0003] The main difficulties in treating triple-negative breast cancer are reflected in the following aspects: (1) lack of targeted therapy targets. Triple-negative breast cancer lacks the expression of hormone receptors and HER2 receptors, which means that conventional targeted therapy methods, such as endocrine therapy (such as tamoxifen) and HER2 targeted therapy (such as trastuzumab), cannot be applied to TNBC patients. Although chemotherapy is currently the main treatment for triple-negative breast cancer, its efficacy is limited, and patients are prone to drug resistance during treatment, resulting in a high risk of recurrence and metastasis after treatment. Existing chemotherapy drugs not only have significant toxic side effects on healthy cells, but also have difficulty effectively targeting the heterogeneity of tumors, so the long-term survival rate of patients after chemotherapy is low; (2) high heterogeneity and invasiveness. Triple-negative breast cancer has significant biological heterogeneity. Different patients' TNBC exhibits different molecular characteristics, gene mutations, and clinical prognoses, which increases the complexity of clinical treatment. Pathologically, triple-negative breast cancer is often accompanied by a high proliferation index and a high degree of malignancy, and tumor cells are prone to epithelial-mesenchymal transition (EMT), making tumor cells more invasive and metastatic. This high degree of heterogeneity and invasiveness often makes it impossible for traditional treatment methods to fully cover all tumor cells, leading to treatment failure or tumor recurrence; (3) High risk of metastasis and recurrence: Triple-negative breast cancer has a high incidence of metastasis and recurrence, especially in young patients, where the tumor often metastasizes shortly after treatment. Clinical observations show that TNBC is prone to remote metastasis, especially to important organs such as the lungs, liver, bones, and brain. This high metastatic potential exacerbates the prognostic differences among patients, and currently, effective treatment options for metastatic triple-negative breast cancer remain limited. Due to the lack of a clear target, the treatment and prevention of metastasis has become a major challenge in clinical treatment.
[0004] Although traditional chemotherapy has some efficacy against triple-negative breast cancer, the discovery and screening of new therapeutic targets has become an urgent problem to be solved due to its drug resistance and high recurrence rate. Summary of the Invention
[0005] To address the aforementioned technical problems, the present invention aims to provide the application of CHCHD4 in the preparation of drugs for treating cancer. This includes the application of agents that promote CHCHD4 expression in the preparation of drugs for treating cancer. By enhancing CHCHD4 expression through gene transcriptional activation, the metabolism and immune microenvironment of tumor cells are regulated, providing a novel targeting strategy for the treatment of triple-negative breast cancer.
[0006] To achieve the above objectives, the present invention provides the use of an agent that promotes CHCHD4 expression in the preparation of a drug for treating cancer.
[0007] According to a specific embodiment of the present invention, preferably, the cancer includes breast cancer;
[0008] More preferably, the cancer is triple-negative breast cancer.
[0009] According to a specific embodiment of the present invention, preferably, the preparation that promotes CHCHD4 expression includes artificially synthesized or naturally occurring substances.
[0010] According to a specific embodiment of the present invention, preferably, the formulation that promotes CHCHD4 expression is a formulation that overexpresses CHCHD4;
[0011] More preferably, the formulation that overexpresses CHCHD4 includes a CRISPR / Cas9 formulation that promotes CHCHD4 expression;
[0012] More preferably, the CRISPR / Cas9 formulation comprises sgRNA, the sequence of which is shown in SEQ ID No. 2.
[0013] According to a specific embodiment of the present invention, preferably, the formulation that promotes CHCHD4 expression can be used alone or in the form of a pharmaceutical composition.
[0014] According to a specific embodiment of the present invention, preferably, the cancer treatment is manifested as one or both of inhibiting the metastasis of triple-negative breast cancer tumors and inhibiting the proliferation of triple-negative breast cancer tumors; preferably, the tumor is a tumor formed by MDA-MB-231 cells.
[0015] On the other hand, the present invention also provides the use of the formulation that promotes CHCHD4 expression in the preparation of a drug that inhibits the proliferation of triple-negative breast cancer tumors.
[0016] On the other hand, the present invention also provides the use of the formulation that promotes CHCHD4 expression in the preparation of a drug that inhibits the metastasis of triple-negative breast cancer tumors.
[0017] On the other hand, the present invention also provides the use of the formulation that promotes CHCHD4 expression in the preparation of a drug that inhibits the proliferation and / or metastasis of MDA-MB-231 cells.
[0018] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0019] This invention provides the application of agents that promote CHCHD4 expression in the preparation of drugs for treating cancer, specifically providing a therapeutic strategy that inhibits tumor metastasis and promotes tumor regression in triple-negative breast cancer cells by transcriptionally activating the CHCHD4 gene. The CHCHD4 gene plays a crucial role in tumor cell metabolism, immune responses, and epithelial-mesenchymal transition (EMT). By transcriptionally activating the expression of the CHCHD4 gene, its metabolism can be reprogrammed, thereby inhibiting the metastatic and proliferative capacity of tumor cells. This treatment method enhances CHCHD4 expression through gene transcriptional activation, regulating the metabolism and immune microenvironment of tumor cells, providing a novel targeted strategy for the treatment of triple-negative breast cancer, and has significant clinical application prospects. Attached Figure Description
[0020] Figure 1 This explains the working principle of gradient capture chips. Figure 1 A is a schematic diagram of the operation of the depth-resolution subtype chip; Figure 1 B is a schematic diagram of DRSC, showing the alternation of capture and elution processes to separate specific cell subtypes; Figure 1 C represents the flow rate and liquid phase of the DRSC chip during operation, maintaining the trajectory of the sample during capture and elution to achieve stable subtype sorting; Figure 1 D represents the spatial distribution of magnetic flux density modulated by the soft magnetic stripe; Figure 1 E represents the spatial distribution of magnetic force. Due to the spatial shaping of magnetic flux density, magnetic beads at different positions are also subject to gradient magnetic force.
[0021] Figure 2 A genome-wide CRISPR knockout screening revealed an inverse correlation between CHCHD4 expression levels and EpCAM (epithelial cell adhesion molecule) expression levels. Figure 2 A represents the distribution of differentially expressed EpCAM groups in wild-type MDA-MB-231 cells; Figure 2 Image B represents a transwell experiment with different EpCAM expression levels in wild-type MDA-MB-231 cells; Figure 2 C represents the statistical results of transwell experiments with different EpCAM expression levels in wild-type MDA-MB-231 cells, categorized into high (H), medium (M), low (L), and none (N) groups; Figure 2D represents the images of tumor cell clonogenic assays with different EpCAM expression levels in wild-type MDA-MB-231 cells, classified into high (H), medium (M), low (L) and no (N) groups; Figure 2 E represents differential gene expression between wild-type MDA-MB-231 cells and the MDA-MB-231 KO cell pool. Screening criteria: absolute value of H vs N log2 fold change > 2, P value < 0.05, and ranked in the top 46 by absolute value of trend. Figure 2 F represents the volcano plot of differentially expressed genes between wild-type MDA-MB-231 cells and the MDA-MB-231 KO cell pool. The position of the bubbles is determined by the log2 fold change and P-value of the H vs N group samples, and the size of the bubbles is determined by the trend consistency coefficients (Trend) of the four groups H, M, L and N. Figure 2 G is a term for gene ontology (GO) enriched in the EpCAM high-expression and EpCAM non-expression groups; Figure 2 H represents the KEGG pathway enriched in the EpCAM-overexpressing and EpCAM-nonexpressing groups. Genes showing significant differential expression (defined as an absolute value of log2 fold change > 2 and a P-value < 0.05) were significantly enriched in specific biological functions and were subsequently ranked according to the fold enrichment parameter. Data are presented as mean ± standard deviation (SD). Comparisons were performed using one-way ANOVA. .
[0022] Figure 3 To identify the construction of the CHCHD4 knockout / overexpression cell line in MDA-MB-231 by Western blot.
[0023] Figure 4 CHCHD4 regulates the metastatic potential of tumor cells; Figure 4 A represents the fluorescence imaging of mtDNA in mitochondria, where the cell nucleus is blue; mtDNA is green; and the inner mitochondrial membrane is magenta. Figure 4 B represents the baseline breathing, maximum breathing, and reserve breathing capacity of the WT / KO / SAM group. Figure 4 C represents the glycolysis, glycolysis reserve, glycolysis capacity, and non-glycolytic acidification of the WT / KO / SAM group; Figure 4 D represents representative images and statistical analysis of tumor cell spheroid formation experiments in WT / KO / SAM cells; Figure 4 E represents the transwell assay and statistical analysis in WT / KO / SAM cells; data are presented as mean ± standard deviation (SD); comparisons were performed using one-way ANOVA. .
[0024] Figure 5 Real-time oxygen consumption rate (OCR) for the WT, KO, and SAM groups.
[0025] Figure 6 Non-mitochondrial oxygen consumption and proton leakage were compared in the WT / KO / SAM groups. One-way ANOVA was used for comparison. .
[0026] Figure 7 Real-time extracellular acidification rate (ECAR) for the WT, KO, and SAM groups.
[0027] Figure 8 The mechanism by which CHCHD4 expression levels regulate the migration and proliferation of MDA-MB-231 cells; Figure 8 A is a volcano plot showing gene expression in the transcriptome comparison between the KO and WT groups; Figure 8 B is a volcano plot showing gene expression in the transcriptome comparison between the SAM and WT groups; genes with an absolute value of log2 fold change > 2 and a P value < 0.05 are considered significantly upregulated and are marked in red; genes with a log2 fold change < -2 and a P value < 0.05 are considered significantly downregulated and are marked in blue. Figure 8 C represents the KEGG enrichment analysis of differentially expressed genes between the KO and WT groups; Figure 8 D represents the KEGG enrichment analysis of differentially expressed genes between the SAM and WT groups; Figure 8 E represents the mechanism by which CHCHD4 affects the function of MDA-MB-231 cells, as analyzed by Western blot. Figure 8 F represents representative transwell experimental images of CHCHD4 knockout (MCF-7-KO) and overexpression (MCF-7-SAM) MCF-7 cell lines; Figure 8 The diagram above illustrates the mechanism by which the CHCHD4 gene affects the function of MDA-MB-231.
[0028] Figure 9 To analyze the expression levels of 84 tumor-associated proteins in the WT / KO / SAM cell line using a proteome profiler array.
[0029] Figure 10 Enhanced CHCHD4 function inhibits tumor metastasis and proliferation; Figure 10 A is the preparation of in situ breast cancer tumors in female nude mice; wherein, WT / KO / SAM cells are seeded into the mammary pads of female BALB / c mice; Figure 10B is a representative image of tumor tissue; where the scale bar is 10 mm. Figure 10 C represents the tumor volume in the WT / KO / SAM group, n=6; Figure 10 D represents the body weight of the WT / KO / SAM group, n=6; Figure 10 E represents the survival rate of the WT / KO / SAM group, n=6; Figure 10 F represents HE staining and immunofluorescence images (CD31, green; Ki67, red) of tumor tissues from the WT / KO / SAM group, and representative HE staining images of the lungs; Figure 10 G represents the statistical average fluorescence intensity of CD31 and Ki67 in tumor tissue; Figure 10 H was used to prepare a lung metastasis model via tail vein injection; Figure 10 I represents a representative image of H&E staining results in lung tissue; data are presented as mean ± standard deviation (SD), and comparisons were performed using one-way ANOVA. .
[0030] Figure 11 To identify the construction of the CHCHD4 knockout / overexpression cell line in MCF-7 by Western blot. Detailed Implementation
[0031] In order to provide a clearer understanding of the technical features, objectives and beneficial effects of the present invention, the technical solution of the present invention will now be described in detail below, but it should not be construed as limiting the scope of implementation of the present invention.
[0032] It should be noted that, unless otherwise specified, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0033] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.
[0034] It should be understood that the terms “comprising,” “including,” and / or “containing” as used herein specify the presence of the stated features, integers, steps, components, or combinations thereof, but do not exclude the presence or addition of one or more other features, integers, steps, components, or combinations thereof.
[0035] The endpoints and any values of the ranges disclosed in this invention are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of the various ranges, the endpoint values of the various ranges and individual point values, and individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this invention.
[0036] Example 1
[0037] This embodiment provides the application of an agent that promotes CHCHD4 expression in inhibiting the proliferation and metastasis of triple-negative breast cancer tumors. The specific steps are as follows:
[0038] 1. Cell resuscitation and culture
[0039] The MDA-MB-231, MDA-MB-231-GFP, and HEK293FT cells used in this project were all sourced from the National Biomedical Experimental Cell Resource Bank.
[0040] After removing the cells from the liquid nitrogen freezer, quickly place them in a 37°C water bath and shake to thaw. Transfer the cell suspension to a 15 mL centrifuge tube, slowly add 5 mL of complete culture medium (containing RPMI 1640 medium, 10% fetal bovine serum FBS and 1% penicillin-streptomycin mixture), centrifuge at 200g for 5 minutes, discard the supernatant, resuspend the cells, and inoculate them into culture flasks. Replace with fresh culture medium the next day.
[0041] 2. Cell passage
[0042] When the cell confluence is approximately 90%, remove the old culture medium, gently wash once with D-PBS, add trypsin digestion solution (containing 0.25% EDTA), and digest the cells in a 37°C, 5% CO2 humidity incubator until the cells appear rounded under a microscope. Then, add an equal volume of complete culture medium to stop the digestion. Gently pipette the cells to collect the cell suspension into a 15 mL centrifuge tube, centrifuge at 200g for 3 min, discard the supernatant, resuspend the cells in fresh complete culture medium, and seed them into a new culture flask at a 1:3 ratio.
[0043] 3. Establishment of killing curves for MDA-MB-231 cells
[0044] MDA-MB-231 cells in logarithmic growth phase were divided into groups of 1×10⁻⁶. 5 / number of wells inoculated into a 6-well plate.
[0045] After the cells adhered, the drug screening concentrations were set to 0, 2, 4, 6, 8, and 10 μg / mL and added to the wells of a 6-well plate. The plates were then incubated at 37°C in a 5% CO2 cell culture incubator, and the culture medium containing the corresponding drug was replaced every 2 days.
[0046] The experiment was terminated when all the cells in the wells died, and the corresponding drug concentration was the minimum lethal concentration of the drug in MDA-MB-231 cells.
[0047] 4. Transformation of the target plasmid into chemically competent cells
[0048] (1) Take competent cells and place them in an ice bath. Thaw them for about 15 minutes to obtain thawed competent cells NEB DH5α.
[0049] (2) Add about 2 μL of 100 ng / μL target plasmid to 100 μL of thawed competent cell suspension, tap the bottom of the tube several times, and let it stand in an ice bath for 30 minutes.
[0050] (3) Place the centrifuge tube in a 42°C water bath for 45 seconds, then quickly transfer the tube to an ice bath to cool the cells for 2 minutes. Do not shake the centrifuge tube during this process.
[0051] (4) Add 900 μL of sterile LB medium (without antibiotics) to each centrifuge tube, mix well and place in a shaker at 37°C for 1 hour (200 rpm) to express the relevant resistance marker gene on the plasmid and revive the bacteria.
[0052] 5. Electroporation amplification of whole-genome knockout libraries
[0053] (1) Take out the electrocompetent cells from the -80℃ freezer and thaw them on ice for 10 minutes to obtain thawed electrocompetent cells NEB DH5α.
[0054] (2) Take 2 μL of 50 ng / μL whole genome knockout library plasmid (GeCKO v2 plasmid library) and add it to a 25 μL centrifuge tube. Gently tap the tube wall to mix it and obtain a library plasmid mixture. Place it on ice together with an electroporation cup with a 0.1 cm gap to pre-cool.
[0055] (3) Transfer 25 μL of thawed electrocompetent cells to this electrocup and place on ice for 10 min.
[0056] (4) Turn on the electric converter, set it to Manual, and adjust the voltage to 2.1KV.
[0057] (5) Transfer the library plasmid mixture (electrotransfer competent cells and plasmids) to a pre-cooled electrode cup and gently tap the electrode cup to make the mixture evenly enter the bottom of the electrotransfer cup;
[0058] (6) Push the electroporation cup into the electroporator, press the pulse button, and after hearing the beep, quickly add 900 μL of recovery medium to the electroporation cup. After resuspending the cells, transfer them to a 1.5 mL centrifuge tube.
[0059] (7) Recover at 37℃ and 250rpm for 1.5 hours to obtain the transformation product (pLentiCRISPR v2 + sgRNAlibrary).
[0060] (8) Take 20 μL of transformation product and spread it on 160 μL of low-salt LB agar plates. Place it in a 37°C greenhouse and incubate overnight. Calculate the transformation efficiency based on the colony count the next day.
[0061] 6. Packaging of lentiviral particles
[0062] The day before virus packaging, HEK293FT cells were transferred to 15cm culture dishes, and the cell confluence was 80% the next day.
[0063] The following day, the complete culture medium of HEK293FT cells was removed, and 18 mL of Opti-MEM culture medium was gently added. The cells were then placed in a 37°C, 5% CO2 cell culture incubator for 1 hour to equilibrate.
[0064] The specific steps for preparing the DNA-Lipofectamine 2000 complex are as follows:
[0065] (1) Preparation of solution A: Take 45 μL LV PacMix, 45 μL pLentiCRISPR v2 + sgRNA library (about 25 μg) and mix them together. Add Opti-MEM medium to make up to 3.36 mL and mix by inverting.
[0066] (2) Preparation of solution B: Take 135 μL of Lipofectamine 2000 and mix with 3.24 mL of Opti-MEM medium, and mix by inverting.
[0067] (3) After incubating solution A and solution B at room temperature for 5 min, mix them, invert and mix well (avoid shaking), and then revive at room temperature for 20-30 min to form DNA-Lipofectamine2000 complex.
[0068] (4) Add the DNA-Lipofectamine 2000 complex dropwise to HEK293FT cells, and gently shake the culture dish back and forth to mix the complex. Incubate in a 37°C, 5% CO2 saturated humidity incubator to begin transfection.
[0069] (5) Change the medium 4-6 hours after transfection, replace the medium with complete medium, and incubate in a 37°C, 5% CO2 saturated humidity incubator for 48 hours. Then collect the supernatant to obtain lentivirus particles.
[0070] 7. Virus Concentration
[0071] (1) Collect the supernatant culture medium containing lentivirus particles from several 15 cm dishes into a 50 mL centrifuge tube and centrifuge at 1500 rpm for 10 min.
[0072] (2) Filter the supernatant with a 0.45μm needle filter to remove cell debris and obtain crude virus filtrate.
[0073] (3) Add 50% PEG6000 solution to 1 / 5 of the volume of crude virus filtrate, mix thoroughly by inverting the container, and place at 4°C overnight.
[0074] (4) The next day, centrifuge at 4℃ and 1500×g for 30 minutes, discard the supernatant in a clean bench, and remove the excess supernatant with a pipette.
[0075] (5) The virus collected in each 10cm dish was resuspended in 1mL of 2×HBSS (Hank's Balanced Salt Solution) to obtain a lentivirus suspension.
[0076] (6) The lentivirus suspension is aliquoted and stored at -70°C or below.
[0077] 8. Construction of a genome-wide knockout cell pool
[0078] (1) MDA-MB-231 cells in good condition were seeded into 6-well plates at a cell confluence of 30%. The next day, different volumes (0 μL, 20 μL, 50 μL, 100 μL, 150 μL and 200 μL) of lentivirus suspension were added to the 6-well plates for continuous infection for 72 hours.
[0079] (2) Cells infected with different volumes of virus were digested and seeded into 96-well plates in equal quantities, with 6 replicates per group. After cell adhesion, antibiotics were added according to the resistance genes carried by the lentiviral plasmids, and the selection was carried out until all cells in the control group (0 μL) died. Cell viability in each group was detected using CCK-8 assay, and the viral volume required for a cell viability of approximately 30% was calculated as the viral load required for a multiplicity of infection (MOI) of 0.3.
[0080] (3) Based on the coverage of the cell pool for constructing the whole genome knockout, the required number of cells for seeding is approximately 1.1 × 10⁻⁶ when the cell library coverage is 500× 10⁻⁶, which results in 65,383 sgRNAs. 8 .
[0081] (4) The cell pool for whole genome editing can be obtained by scaling up the culture system proportionally according to the method and calculation results in step (2).
[0082] 9. Determination of viral infection efficiency
[0083] (1) MDA-MB-231 cells were seeded at a suitable density in 6-well culture plates. When the density in the culture dish reached about 50%, the supernatant was aspirated, and after washing twice with an appropriate amount of PBS, the cells were digested, centrifuged, and counted.
[0084] (2) The virus was dissolved on ice, and after the cells adhered, different volumes of virus solution were added to the culture dish. 72 hours after viral infection, antibiotics were added, while cells in the non-antibiotic selection group were retained as a control.
[0085] (3) Continue culturing until almost all of the blank cells selected with resistance have failed to survive. Then, re-digest the cells and count them.
[0086] (4) Calculate infection efficiency: Infection efficiency (MOI) = number of cells in the culture plate with antibiotic selection / number of cells in the culture plate without antibiotic selection. Select a suitable volume of virus with an appropriate MOI for subsequent virus transfection experiments according to experimental needs.
[0087] 10. Construction of CHCHD4 knockout cell lines
[0088] (1) Construct Cas9 lentivirus particles and CHCHD4 knockout lentivirus particles respectively according to the above lentivirus packaging method.
[0089] (2) Cas9 lentivirus particles were added to MDA-MB-231 cells in good condition with a confluence of about 30%, and the positive cells were screened using the resistance carried by the virus to obtain the MDA-MB-231 cell line that stably expresses Cas9 protein, namely the MDA-MB-231-Cas9 cell line.
[0090] (3) Add an appropriate amount of CHCHD4 knockout lentiviral particles to the MDA-MB-231-Cas9 cell line and use the resistance carried by the virus to screen positive cells to obtain the CHCHD4 knockout MDA-MB-231 cell line, namely the MDA-MB-231-KO cell line.
[0091] (4) The sgRNA sequence of the knockout plasmid is: TGACCCCAACGATCCATACGAGG (SEQ ID No.1).
[0092] 11. Construction of CHCHD4 overexpressing cell lines
[0093] (1) The three lentiviral plasmids required for constructing the CHCHD4 overexpression cell line (pLenti_dCAS9-VP64_Blast / pLenti_MS2-P-HSF1_Hygro / pLenti-sgrna-(ms2)-puro) were packaged into lentiviral particles according to the lentiviral packaging method.
[0094] (2) With 1×10 5 -5×10 5 Cells should be seeded at a density of 6-well plates and cultured for 24 hours until 50% confluence is achieved.
[0095] (3) Add lentivirus particles to a 6-well plate and infect continuously for 72 hours. Then, use the resistance carried by the plasmid to screen positive cells.
[0096] (4) The sgRNA sequence of the transcription activation plasmid is: GTCACAGATGAATACGACAC (SEQ ID No. 2).
[0097] 12. Western blot experiment
[0098] (1) Wash the cells cultured in the well plate twice with pre-cooled PBS.
[0099] (2) Add pre-chilled RIPA high-efficiency lysis buffer containing protease inhibitors and phosphatase inhibitors to the well plate and scrape off the cells using a cell scraper.
[0100] (3) Transfer the liquid obtained in (2) to a 1.5 mL centrifuge tube, lyse it on ice for 30 minutes, and mix it every 10 minutes to obtain the lysed cell suspension.
[0101] (4) Centrifuge the lysed cell suspension at 12000g for 5 minutes, collect the upper cell lysate, add loading buffer at a ratio of 1:5, boil at 100℃ for 5 minutes to obtain protein samples.
[0102] (5) Add an equal amount of protein sample to the lanes of a 10% SDS-PAGE gel. Then, electrophoresis is performed at 100V until the bromophenol blue indicator reaches the bottom of the gel.
[0103] (6) Use a semi-dry transfer system to transfer the protein in the gel onto a PVDF membrane.
[0104] (7) At room temperature, the PVDF membrane was sealed in 5% skim milk containing 0.1% Tween-20 for 1 hour to obtain the sealed PVDF membrane.
[0105] (8) After the PVDF membrane was sealed and incubated with the primary antibody at 4°C overnight, it was washed three times with TBST for 10 minutes each time to obtain the PVDF membrane after incubation with the primary antibody.
[0106] (9) At room temperature, after incubating the PVDF membrane with the primary antibody and the secondary antibody for 1 hour on a shaker, wash with TBST 3 times for 10 minutes each time.
[0107] (10) Enhanced chemiluminescence (ECL) substrates were used for detection, and the protein bands were imaged using a chemiluminescence imaging system.
[0108] 13. Oncology Proteome Profiler Array
[0109] (1) Follow the instructions in the Proteome Profiler Human XL Oncology Array Kit manual.
[0110] (2) Collect cells in good condition and count them, according to the following formula: 1 × 10⁻⁶ cells per cell. 6 Add 100 μL of lysis buffer (lysisbuffer17) to prepare the sample.
[0111] (3) With the blue spot facing up, add 1.5 mL of buffer 6 and incubate on a shaker at 4°C for 1 hour.
[0112] (4) After the blue spots disappeared, add 150 μg of total protein to each membrane and incubate overnight in a shaker at 4°C.
[0113] (5) Each membrane is washed with 20 mL of wash buffer for 10 minutes, for a total of 3 washes.
[0114] (6) After cleaning the membrane, absorb the excess liquid with absorbent paper, add 1.5 mL of detection antibody, incubate on a shaker for 1 hour, and then repeat the cleaning process in step (5).
[0115] (7) After adding streptavidin-HRP and incubating on a shaker for 30 minutes, repeat the cleaning step in step (5).
[0116] (8) Detect protein expression using ECL chemiluminescence solution.
[0117] 14. Localization of mtDNA in mitochondria
[0118] (1) Inoculate healthy cells into a glass dish. The cell confluence should be about 90% the next day.
[0119] (2) Add hochest 33342, mitochondrial inner membrane dye MitoTracker and mtDNA dye to a glass-bottomed dish and incubate at 37°C in the dark for 15 minutes.
[0120] (3) Wash with PBS three times, add complete culture medium pre-warmed at 37°C, and then use a super-resolution imaging system (HIS-SIM imaging) for imaging.
[0121] 15. Mitochondrial stress test and glycolysis stress test
[0122] Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured using a Seahorse XFe 96 extracellular energy analyzer (Agilent) to perform mitochondrial stress and glycolytic stress tests. The specific procedures are as follows:
[0123] (1) The cells were divided into groups of 2 × 10 5 Cells were seeded at a concentration of 80 μL per well in a dedicated cell culture microplate. The plates were then placed in a 37°C CO2 cell culture incubator to allow cell adhesion and incubation overnight.
[0124] (2) Take the centrifuge tube containing the XF calibration solution and the probe plate device out of the 37°C, CO2-free cell culture incubator, add 200 μL of XF calibration solution to each well of the hydration plate, and align the cap and probe plate with each well of the hydration plate so that the sensor is immersed in the XF calibration solution.
[0125] (3) Place the entire probe plate device in a 37°C, CO2-free cell culture incubator for 45-60 minutes to hydrate.
[0126] (4) Discard 60 μL of growth medium from all wells of the cell culture plate, leaving 20 μL.
[0127] (5) Add 200 μL of detection solution to all wells, and then aspirate 200 μL. Repeat twice.
[0128] (6) Add 160 μL of detection solution to all wells, place the cell culture plate in a 37°C, CO2-free cell culture incubator for 60 minutes and wait for the test.
[0129] (7) Take out the prepared drug working solution (37℃) and add the corresponding drugs at one time using the corresponding drug addition aid plate. The drugs for mitochondrial stress test are: oligomycin (2μM), carbonyl cyano-4-(trifluoromethoxy)phenylhydrazone (FCCP, 1μM) and rotenone antimycin A (0.5μM each); the drugs for glycolysis stress test are: glucose, oligomycin and 2-DG.
[0130] (8) On-machine testing. Data for each well is normalized by cell count.
[0131] 16. Tumor cell spheroidization experiment
[0132] Cells in the logarithmic growth phase were dispersed into single cells using trypsin digestion solution, resuspended in tumor cell spheroidizing medium (20 ng / mL EGF, 20 ng / mL bFGF, B27 and serum-free RPMI-1640 medium), and seeded in ultra-low adsorption 96-well plates at a density of 2000 cells per well. An effective tumor spheroid was defined as the number of cells larger than 75 μm.
[0133] 17. Tumor cell clonogenesis experiment
[0134] (1) Digest the logarithmic growth phase cells with 0.25% trypsin, add serum-containing culture medium to stop the digestion, and centrifuge at 1000 rpm for 5 min.
[0135] (2) Resuspend the cells in PBS, stain with trypan blue and count the viable cells.
[0136] (3) Inoculate the cell suspension evenly into a 6-well plate (each well contains 2 mL of culture medium) at a density of 500-1000 cells per well, and gently shake to disperse the cells evenly.
[0137] (4) Place the 6-well plate in a 37℃, 5% CO2 incubator for 10-14 days, change the culture medium every 3-4 days, and observe the formation of clones.
[0138] (5) Terminate the culture after 10-14 days. Then discard the culture medium and wash gently twice with PBS.
[0139] (6) Add 1 mL of 4% paraformaldehyde to each well and fix at room temperature for 30 minutes. Then discard the paraformaldehyde fixative and add 1 mL of crystal violet staining solution. Incubate for 30 minutes.
[0140] (7) Gently wash away excess dye with deionized water until colorless.
[0141] (8) Observe and count clones with a diameter >50μm using an inverted microscope, and calculate the clone formation rate.
[0142] 18. Transwell experiment
[0143] (1) Place Matrigel in a 4°C refrigerator overnight to thaw, and then dilute it with serum-free culture medium at a ratio of 1:8.
[0144] (2) Add 100 μL of diluted Matrigel to the upper chamber of each Transwell chamber and incubate at 37°C for 3 hours to form a film.
[0145] (3) Subsequently, the upper chamber culture medium was aspirated and 100 μL of serum-free culture medium was added and then placed in a 37°C incubator for 1 hour to allow the matrix to gel.
[0146] (4) Take tumor cells in the logarithmic growth phase, starve them for 24 hours with serum-free medium, digest them with 0.25% trypsin, resuspend the cells in serum-free medium, and adjust the cell density to 2×10⁻⁶. 5 The cells / mL were used to obtain a cell suspension.
[0147] (5) Add 500 μL of culture medium containing 10% fetal bovine serum to the lower chamber of a 24-well plate.
[0148] (6) After confirming that the transwell chamber will not leak, add 200 μL of cell suspension (approximately 4 × 10⁻⁶ cells / mL) to the upper chamber. 4 (cells).
[0149] (7) Place the Transwell chamber in a 37°C, 5% CO2 incubator and incubate for 36 hours.
[0150] (8) After the culture is completed, discard the culture medium in both the upper and lower chambers, and gently wipe away the unmigrated cells in the upper chamber with a cotton swab.
[0151] (9) Wash twice with PBS, fix with 4% paraformaldehyde for 30 minutes, and then stain with 0.1% crystal violet solution for 15 minutes.
[0152] (10) Wash away excess staining solution with deionized water, and randomly select 5 fields of view under an inverted microscope to count the number of migrating cells.
[0153] 19. Animal experiments
[0154] (1) Female 4-week-old BALB / c nude mice were placed in the first-stage SPF-grade animal room of the Experimental Animal Center of Tsinghua University (temperature 22±2℃, humidity 50±10%, 12 h light / dark cycle) for 7 days for acclimatization.
[0155] (2) Use a small animal anesthesia machine to inhale isoflurane to anesthetize nude mice. Once the animals are confirmed to be in a state of deep anesthesia, place the nude mice on a sterile surgical mat and fix them in a supine position.
[0156] (3) Disinfect the fourth mammary fat pad area with 75% ethanol.
[0157] (4) Draw 100 μL of cell suspension using a 1 mL insulin injection, for a total of approximately 7 × 10⁻⁶ cells. 6 Each cell.
[0158] (5) Insert the needle slowly into the breast fat pad at a 30° angle, avoiding blood vessels, and slowly inject the cell suspension to ensure no leakage.
[0159] (6) After the liquid injection is completed, slowly withdraw the needle and gently press the injection point with a sterile cotton swab for 1 minute to prevent the liquid from overflowing.
[0160] (7) Place the nude mouse on a 37°C heat-insulating pad and transfer it back to the SPF-grade breeding cage after it has fully recovered.
[0161] (8) Observe the animal's condition after surgery and record changes in weight and tumor volume every 3 days.
[0162] (9) If the long diameter of the tumor is greater than 20 mm, the mouse is euthanized and the experiment is terminated, and it is recorded as natural death.
[0163] (10) Starting from day 7 post-inoculation, measure the long diameter (L) and short diameter (W) of the tumor every 3-4 days using calipers. Calculate the tumor volume V = 1 / 2 × L × W 2 .
[0164] Experimental results:
[0165] 1. Fabrication of depth-resolution subtype chips
[0166] Studying the genotypes of ultra-low expression cellular phenotypes is crucial for monitoring disease progression and treatment response, as the occult nature of these minimally expressed phenotypes often limits diagnostic methods to binary positive / negative classification. This limitation masks clinically significant subtype variations during disease evolution. Establishing prognostic associations between minimally expressed EpCAM phenotypes in breast cancer subtypes through immunohistochemical analysis has significant clinical implications, particularly in developing therapies targeting EpCAM. However, establishing functional associations between these rare cellular states and disease mechanisms, especially linking phenotypic gradients to cellular behavior and treatment susceptibility, remains a persistent technical challenge.
[0167] With the increasing demand for subpopulation classification of cells with ultra-low expression phenotypes, and considering the high design ceiling of the magnetic sorting force field, this invention modulates the magnetic field to a continuously enhancing peak of the gradient envelope within the screening region and combines it with a microfluidic system to construct a depth-resolved subtype chip (DRSC) (e.g. Figure 1 As shown in A, Figure 1 This explains the working principle of gradient capture chips; among which... Figure 1 (A is a schematic diagram of the operation of the depth-resolution subtype chip). The amount of immunomagnetic beads bound is directly proportional to the degree of protein expression. This core difference allows for further classification and collection of cells with ultra-low expression phenotypes within the selection area. Through the alternation of subtype capture and lateral elution, stable laminar flow enables fine-resolution subtype screening and segmented collection (e.g., ...). Figure 1 B and Figure 1 As shown in C, Figure 1 B is a schematic diagram of DRSC, showing the alternation of capture and elution processes to separate specific cell subtypes; Figure 1 C represents the flow rate and liquid phase of the DRSC chip during operation, maintaining the sample's trajectory during capture and elution to achieve stable subtype sorting.
[0168] To differentiate cells carrying rare magnetic particles via gradient and overcome the challenge of low discrimination, this invention provides a high upper limit magnetic field (200 mT) and supports the gradient using soft magnetic strips with varying magnetization. The soft magnetic strips (μ / μ0 > 80,000) enhance the local background magnetic field, and their magnetization determines the peak value of the nearby enhanced magnetic field. The background gradient magnetic field decays exponentially with location and is boosted in a multi-stage amplifier, generating a peak envelope of magnetic flux density (e.g., ...) within the thin film. Figure 1 As shown in D, Figure 1 D represents the spatial distribution of magnetic flux density modulated by the soft magnetic strips. Magnetic particles (d=1μm) per unit magnetized volume are attracted and focused onto multiple soft magnetic strips, and the magnetic force on the cell also exhibits a continuous gradient peak similar to a magnetic field (e.g., Figure 1 As shown in E, Figure 1E represents the spatial distribution of magnetic force. Due to the spatial shaping of magnetic flux density, magnetic beads at different positions are also subject to gradient magnetic force. Since the passive shaping of the magnetic field by the soft magnetic strips becomes blurred with distance, leading to attenuation of the magnetic force, this invention controls the flow range of the liquid within the microchannel between 50-150 μm. This is to ensure that magnetic particles can reach the 50 μm capture zone as quickly as possible and to perform capture evaluation under a unified magnetofluid coupling model. Heterogeneous cells have different capture thresholds under the action of magnetic beads, so they can be captured sequentially on each magnetic strip and displayed in the screening area according to their abundance.
[0169] 2. Genome-wide CRISPR-Cas9 loss-of-function screening identifies a high correlation between CHCHD4 and EpCAM expression levels.
[0170] Heterogeneous expression of EpCAM in the MDA-MB-231 breast cancer cell line has been confirmed. To investigate the functional impact of different EpCAM expression levels, this invention used depth-resolved subtype array (DRSC) to divide cells into H (high), M (medium), L (low), and N (absent) groups based on EpCAM expression levels. Statistical results showed that the proportions of each group were 14.29%, 16.97%, 5.77%, and 62.95%, respectively (e.g., ...). Figure 2 As shown in A, Figure 2 Genome-wide CRISPR knockout screening revealed an inverse correlation between CHCHD4 expression levels and EpCAM expression levels (data are presented as mean ± standard deviation (SD). One-way ANOVA was used for comparisons). ; Figure 2 A represents the distribution of EpCAM expression differential groups in wild-type MDA-MB-231 cells. This invention further determined the metastasis potential of each group. Transwell migration experiments showed that as EpCAM expression levels decreased, the number of MDA-MB-231 cells migrating to the lower chamber of the transwell increased (e.g., ...). Figure 2 B and Figure 2 As shown in C, Figure 2 Image B represents a transwell experiment with different EpCAM expression levels in wild-type MDA-MB-231 cells; Figure 2 C represents the statistical results of transwell assays in wild-type MDA-MB-231 cells with different EpCAM expression levels, categorized as high (H), medium (M), low (L), and none (N). Conversely, in the clonogenesis assay, as EpCAM expression levels decreased, the clonus size of MDA-MB-231 cells decreased (e.g., ...). Figure 2 As shown in D, Figure 2Image D represents a clonogenic assay of tumor cells with different EpCAM expression levels in wild-type MDA-MB-231 cells (categorized as high (H), medium (M), low (L), and none (N) groups). This indicates the existence of subpopulations with different biological characteristics in MDA-MB-231 cells. Cells with high EpCAM expression exhibit stronger stemness potential, while cells with low EpCAM expression are more likely to exhibit enhanced migration and invasion capabilities. Differences in surface marker expression not only reflect the dynamic plasticity of cell state but may also determine the metastatic potential of tumor cells. Therefore, subpopulations with heterogeneous EpCAM expression in MDA-MB-231 cells may play an important role in influencing their metastatic potential, which is crucial for elucidating tumor metastasis mechanisms and identifying potential therapeutic targets.
[0171] To elucidate the molecular mechanisms driving EpCAM expression heterogeneity in MDA-MB-231 cells, this invention performed genome-wide CRISPR-Cas9 loss-of-function screening in this triple-negative breast cancer (TNBC) cell line. The screening used a pooled library based on a lentiviral vector containing 65,383 unique sgRNAs targeting 19,050 annotated protein-coding genes and 1,000 untargeted control sgRNAs (sg-NTCs). Subsequently, this invention used the DRSC system to sort MDA-MB-231 cells according to EpCAM expression levels using EpCAM immunomagnetic beads, and labeled the subpopulations as H (high), M (medium), L (low), and N (absent), corresponding to decreasing EpCAM expression levels.
[0172] Next, next-generation sequencing (NGS) was used to analyze the removal or enrichment of sgRNAs in different subpopulations, identifying key genes. By integrating multidimensional bioinformatics data, this invention identified the core regulatory genes driving the heterogeneity of EpCAM expression in MDA-MB-231 cells. These findings provide valuable insights into elucidating the molecular mechanisms regulating EpCAM expression dynamics in TNBC.
[0173] First, this invention selected the first 46 genes (e.g., P < 0.05, absolute value of log2FC > 1) based on linear regression analysis (P < 0.05, absolute value of log2FC > 1). Figure 2 As shown in E, Figure 2 E represents differential gene expression between wild-type MDA-MB-231 cells and the MDA-MB-231 KO cell pool. Screening criteria: absolute value of H vs N log2 fold change > 2, P value < 0.05, ranked in the top 46 by absolute value of trend. This invention observed a significant negative correlation between CHCHD4 and EpCAM expression in all subpopulations (r = -0.83, P > 0.001), suggesting a potential regulatory relationship between the two.
[0174] Further analysis was conducted on differentially expressed genes (DESeq2; absolute value of log2FC > 2, FDR > 0.05) and the linear gradient trend between groups (absolute value of Trend > 0.95) (e.g. Figure 2 As shown in F, Figure 2 F represents a volcano plot of differentially expressed genes between wild-type MDA-MB-231 cells and the MDA-MB-231 KO cell pool. Bubble positions were determined by the log2 fold change and p-value between the H and N groups, while bubble sizes were determined by the trend consistency coefficients (Trends) of the four groups (H, M, L, and N). Among the 37 candidate genes, a robust linear trend of sgRNA removal was observed with decreasing EpCAM expression. CHCHD4 showed the most significant statistical association (log2FC = -8.926, adjusted p = 7 × 10⁻⁶). -8 The absolute value of Trend (0.96) indicates that the significant downregulation of CHCHD4 expression is strongly linearly negatively correlated with EpCAM. Functional enrichment analysis of these differentially expressed genes revealed significant associations with biological processes and key signaling pathways related to energy metabolism (such as the PI3K-AKT pathway), which regulate tumor cell proliferation, growth, survival, metabolism, and migration (e.g., Figure 2 G and Figure 2 As shown in H, Figure 2 G is a term for gene ontology (GO) enriched in the EpCAM high-expression and EpCAM non-expression groups; Figure 2 H represents the KEGG pathway enriched in the EpCAM-overexpressing and EpCAM-nonexpressing groups; genes showing significant differential expression (defined as an absolute value of log2 fold change > 2 and a P-value < 0.05) were significantly enriched in specific biological functions and subsequently ranked according to the fold enrichment parameter. These findings suggest that CHCHD4 may be a key factor influencing the heterogeneity of EpCAM expression, thereby affecting the functional properties of MDA-MB-231 cells.
[0175] 3. CHCHD4 expression level regulates the migration and proliferation potential of MDA-MB-231 cells.
[0176] CHCHD4 (containing a 4-helix-helix-helix-helix domain) is a key member of the disulfide isomerase family in the inner mitochondrial membrane. It maintains mitochondrial homeostasis by regulating the introduction of mitochondrial proteins and the formation of disulfide bonds. Its absence leads to impaired assembly of the respiratory chain complex, reduced oxidative phosphorylation efficiency, and the accumulation of reactive oxygen species, thereby affecting cellular energy metabolism. CHCHD4 is involved in the regulation of tumor cell proliferation and invasion.
[0177] To investigate the effects of CHCHD4 on the function of MDA-MB-231 cells, this invention used CRISPR-Cas9 technology to construct a CHCHD4 knockout (KO) and transcriptional activation (SAM) MDA-MB-231 cell line (e.g., Figure 3 As shown, Figure 3 To identify the construction of a CHCHD4 knockout / overexpression cell line in MDA-MB-231 using Western blot. This invention first uses super-resolution microscopy to examine the effect of CHCHD4 expression on mitochondrial homeostasis (e.g., Figure 4 As shown in A, Figure 4 The study aimed to investigate the role of CHCHD4 in regulating the metastatic potential of tumor cells (where data are presented as mean ± standard deviation (SD); comparisons were performed using one-way ANOVA). ); Figure 4 Image A shows fluorescence imaging of mtDNA in mitochondria, with the cell nucleus in blue, mtDNA in green, and the inner mitochondrial membrane in magenta. Imaging results showed a significantly reduced mtDNA distribution in the KO group compared to the WT and SAM groups. Some mitochondria exhibited smaller mtDNA aggregation regions, indicating mitochondrial dysfunction or mtDNA damage. Furthermore, abnormal fragmentation and expansion of the inner mitochondrial membrane may reflect an imbalance in mitochondrial fusion and division processes. Structural damage to the mitochondrial membrane also indicates impaired mitochondrial function in the KO group.
[0178] To further evaluate mitochondrial function, this invention used Seahorse FX to perform mitochondrial stress tests. The KO and SAM groups showed higher OCR (oxygen consumption rate) than the WT group at all stages, particularly during the FCCP (carbonyl cyanide 4-(trifluoromethoxy)phenylaminohydrazine) stage, where the OCR was significantly increased (e.g., Figure 5 As shown, Figure 5 The real-time oxygen consumption rate (OCR) is shown for the WT, KO, and SAM groups. This indicates enhanced oxidative metabolism under stress. Importantly, altered CHCHD4 expression significantly remodeled the mitochondrial respiratory phenotype of MDA-MB-231 cells. The KO group exhibited a larger overall amplitude, showing higher basal respiration, maximal respiration, ATP production, and reserve respiration capacity (e.g., ). Figure 4 As shown in B, Figure 4 B represents the basal respiratory rate, maximum respiratory rate, and reserve respiratory capacity of the WT / KO / SAM group. However, coupling efficiency did not change significantly, suggesting that the enhanced respiration was not primarily due to improved coupling efficiency, but may be related to mitochondrial damage. Furthermore, elevated levels of non-mitochondrial respiration and proton leakage indicate changes in overall cellular oxygen consumption and mitochondrial inner membrane permeability (e.g., ...). Figure 6 As shown, Figure 6 Non-mitochondrial oxygen consumption and proton leakage were compared in the WT / KO / SAM groups. One-way ANOVA was used for comparison. ).
[0179] Next, this invention explores the effect of CHCHD4 expression on glycolytic function (e.g. Figure 7 As shown, Figure 7 The real-time extracellular acidification rate (ECAR) was defined for the WT, KO, and SAM groups. Both CCHHD4 knockout and overexpression significantly increased glycolytic flux and glycolytic capacity, with similar enhancements observed in the KO and SAM groups. However, glycolytic reserves remained unchanged, indicating that the increased flux primarily stemmed from changes in baseline and peak values rather than an expansion of reserves. Furthermore, both modified cell lines exhibited increased non-glycolytic acidification and 2-DG-related ECAR, suggesting a reprogramming of background acidification pathways and proton efflux. These findings are consistent with the enhanced respiration observed in mitochondrial stress assays, suggesting that changes in CCHHD4 levels synergistically promote metabolic flux at both the mitochondrial and glycolytic ends, driving metabolic reprogramming. This metabolic reprogramming may affect the metastasis and proliferation capacity of MDA-MB-231 cells (e.g., Figure 4 As shown in C, Figure 4 C represents the glycolysis, glycolytic reserve, glycolytic capacity, and non-glycolytic acidification of the WT / KO / SAM group.
[0180] Subsequently, this invention evaluated tumor stemness in three cell types (e.g., tumor spheroid formation assay) using a tumor spheroid formation assay. Figure 4 As shown in D, Figure 4 (D represents representative images and statistical analysis of tumor cell spheroid formation experiments in WT / KO / SAM cells). Results showed that the number of spheroids formed by the three cell types was KO > WT > SAM, indicating that CHCHD4 expression significantly affects the stemness of MDA-MB-231 cells. The SAM group had the fewest tumor spheroids, suggesting that increased CHCHD4 expression reduces the stemness of MDA-MB-231 cells, potentially reducing their metastatic potential.
[0181] To further verify the effect of CHCHD4 expression on the metastatic potential of MDA-MB-231 cells, this invention performed a transwell assay (e.g., Figure 4 As shown in E, Figure 4 (E represents transwell assay and statistical analysis in WT / KO / SAM cells). The number of migrating cells in the KO group was significantly higher than that in the WT and SAM groups, indicating that the loss of CHCHD4 function may promote tumor cell migration. This observation is consistent with the stronger stemness observed in the KO group.
[0182] To confirm the effect of CHCHD4 on tumor cell proliferation and survival, a colony formation assay was performed. The number and size of colonies formed in the KO and SAM groups were significantly smaller than those in the WT group, further demonstrating the crucial role of CHCHD4 expression in regulating tumor cell proliferation. Both the KO and SAM groups showed inhibition of colony formation, with the reduction in colony number and size being more significant in the SAM group than in the WT group. Consistent with findings on stemness and metastasis, overexpression of CHCHD4 in the SAM group may reduce colony formation by inhibiting cell proliferation and stemness.
[0183] These results suggest that CHCHD4 plays a crucial role in regulating mitochondrial function, metabolic reprogramming, and tumor cell behavior. Changes in CHCHD4 expression not only altered mitochondrial respiration and glycolytic flux but also inhibited the stemness and proliferation of MDA-MB-231 cells.
[0184] 4. CHCHD4 regulates epithelial-mesenchymal transition and modulates the migration and proliferation potential of MDA-MB-231 cells.
[0185] To uncover the regulatory mechanism of CCHHD4 gene expression on the biological function of MDA-MB-231 cells, this invention compared the transcriptomes of the KO and WT groups using RNA sequencing to analyze differentially expressed genes. The results showed significant changes in gene expression between the KO and WT groups, involving multiple aspects such as cytoskeleton, immune response, metabolic regulation, and transcriptional activation. In particular, the significant downregulation of NOMO1 suggests that NOMO1 may regulate cell migration ability by modulating the Nodal signaling pathway. The significant upregulation of cytoskeleton-related genes such as ACTN4 and ACTG1 indicates that CCHHD4 may enhance the migration ability of MDA-MB-231 cells by weakening their adhesion to the matrix. Furthermore, the upregulation of immune-related genes such as CXCL8, IL1B, and CSF2 suggests that loss of CCHHD4 function may promote inflammatory responses and immune cell recruitment, further driving tumor growth and metastasis. In addition, the upregulation of metabolic genes such as KYNU and SLC43A3 may enhance cellular energy metabolism, supporting tumor cell proliferation and migration (e.g., ...). Figure 8 As shown in A, Figure 8 The mechanism by which CHCHD4 expression levels regulate the migration and proliferation of MDA-MB-231 cells; Figure 8 A is a volcano plot showing gene expression in the transcriptome comparison between the KO and WT groups.
[0186] This invention further compared the transcriptomes of the SAM and WT groups and analyzed the corresponding upregulated and downregulated genes. The results showed significant changes in gene expression between the SAM and WT groups. Although the SAM group upregulated ribosomal protein expression, which may promote cell growth, the downregulation of metabolic genes such as RPN2 and LDHA may limit the metabolic support required for high cell proliferation rates. This metabolic inhibition may suppress tumor proliferation, especially when energy supply is limited in the tumor microenvironment. Downregulation of LDHA inhibits the glycolysis pathway, reducing energy production in tumor cells under hypoxic conditions and further weakening their proliferative potential. Inhibition of glycolysis may lead to an imbalance in tumor cell energy metabolism, thereby inhibiting cell migration and invasion capabilities (e.g., Figure 8 As shown in B, Figure 8 B is a volcano plot showing gene expression in the transcriptome comparison between the SAM and WT groups; genes with an absolute value of log2 fold change > 2 and a P value < 0.05 are considered significantly upregulated and are marked in red; genes with a log2 fold change < -2 and a P value < 0.05 are considered significantly downregulated and are marked in blue.
[0187] Next, this invention used tumor proteomics analysis tools to detect the expression levels of 84 tumor-related proteins. CHCHD4 knockout enhanced the invasiveness and metastatic potential of MDA-MB-231 cells, and its loss induced compensatory pathways favored invasive behavior. Significant upregulation of migration / invasion-related molecules such as Cathepsin D, IL-8, and PAI-1, and downregulation of CD105, indicated that these changes collectively enhanced the cells' matrix degradation capacity and motility. Furthermore, elevated levels of IL-6 and IL-8 promoted tumor stemness, increased stem cell-like phenotypes, and drug resistance. Regarding immune responses, upregulation of multiple inflammatory mediators such as IL-6 and GM-CSF contributed to the formation of a tumor microenvironment that promotes metastasis. In addition, upregulation of HO-1 suggested mitochondrial dysfunction, inducing oxidative stress and promoting angiogenesis. Overall, CHCHD4 loss led to a more invasive phenotype in MDA-MB-231 cells, accompanied by the formation of an inflammatory activation and immunosuppressive microenvironment, driving tumor progression.
[0188] In contrast, under CHCHD4 overexpression, the expression of most epithelial-mesenchymal transition (EMT) / invasion-related factors (such as Axl, Vimentin, uPA, VEGF, and CD105) decreased, indicating weakened EMT activity and reduced metastatic potential. Furthermore, typical epithelial markers (such as FOXA2) may have been relatively elevated, enhancing epithelial characteristics. Regarding angiogenesis, downregulation of VEGF and CD105 suggests a possible reduction in angiogenic capacity. However, the significant increase in the immunomodulatory factor M-CSF indicates recruitment of tumor-associated macrophages (TAMs) and enhanced M2 polarization, promoting the formation of an immunosuppressive microenvironment. Overall, CHCHD4 overexpression promotes the transformation of MDA-MB-231 cells to a proliferative, epithelioid phenotype while inhibiting the formation of an EMT / stem phenotype, a conclusion consistent with transcriptomic findings (such as...). Figure 9 As shown, Figure 9 To analyze the expression levels of 84 tumor-associated proteins in the WT / KO / SAM cell line using a proteome profiler array.
[0189] In the KEGG enrichment analysis of differentially expressed genes between the KO group and the WT group (e.g. Figure 8 C and Figure 8 As shown in D, Figure 8 C represents the KEGG enrichment analysis of differentially expressed genes between the KO and WT groups; Figure 8 (D represents the KEGG enrichment analysis of differentially expressed genes between the SAM and WT groups). This invention found significant enrichment of the PI3K-AKT signaling pathway, suggesting that the CHCHD4 gene may regulate the biological function of MDA-MB-231 cells by modulating the activation of the PI3K-AKT pathway. Furthermore, the Nodal signaling pathway may play a role in regulating the expression of genes such as CXCL8 and NOMO1, indicating that Nodal signaling may be involved in the CHCHD4-mediated regulation of the biological function of MDA-MB-231 cells.
[0190] Further analysis revealed the interaction between the Nodal signaling pathway and the PI3K-AKT signaling pathway, whereby Nodal signaling can activate PI3K-AKT signaling, thereby promoting tumor cell proliferation and migration. Therefore, this invention hypothesizes that the expression level of CHCHD4 may affect Nodal activity through metabolic reprogramming, thereby regulating the PI3K-AKT pathway and ultimately influencing the biological function of MDA-MB-231 cells.
[0191] To verify this hypothesis, this invention conducted Western blot experiments to detect the activation status of two signaling pathways (e.g., Figure 8 As shown in E, Figure 8 (E represents the mechanism by which CHCHD4 affects MDA-MB-231 cell function, analyzed by Western blot). Results showed that in the KO group, the protein expression of NOMO1, a key regulator of the Nodal signaling pathway, was significantly downregulated, leading to increased phosphorylation levels of SMAD2 / 3. Simultaneously, the phosphorylation levels of PI3K, AKT, and mTOR were also significantly increased. These results indicate that activation of the Nodal signaling pathway via the PI3K-AKT pathway further promotes tumor cell proliferation and migration. Furthermore, changes in EMT markers such as Vimentin and E-cadherin confirmed that activation of the PI3K-AKT pathway affects the transition of MDA-MB-231 cells from an epithelial-like to a mesenchymal-like state (EpCAM).
[0192] The CHCHD4 gene regulates MDA-MB-231 cell function through complex signaling pathways, affecting EpCAM expression levels and partially restoring the epithelial-like phenotype, thereby inhibiting its metastatic and proliferative capacity. However, the effect of this regulatory mechanism on epithelial breast cancer cells, such as MCF-7, remains unclear. This invention utilizes CRISPR-Cas9 technology to construct CHCHD4 knockout (MCF-7-KO) and overexpression (MCF-7-SAM) cell lines in MCF-7 cells and evaluates their metastatic potential (e.g., Figure 11 As shown, Figure 11 To identify the construction of CCHHD4 knockout / overexpression cell lines in MCF-7 cells using Western blot. Transplantation well assays showed that altered CCHHD4 expression had no significant effect on the metastatic ability of MCF-7 cells, indicating that CCHHD4 has a unique regulatory role in the function of triple-negative breast cancer cells such as MDA-MB-231 (e.g., Figure 8 As shown in F, Figure 8 F represents representative transwell experimental images of CHCHD4 knockout (MCF-7-KO) and overexpression (MCF-7-SAM) MCF-7 cell lines.
[0193] In summary, the CHCHD4 gene plays a crucial role in regulating the biological functions of MDA-MB-231 cells, particularly during tumor metastasis and proliferation. Aberrant CHCHD4 expression leads to metabolic reprogramming in MDA-MB-231 cells; however, this reprogramming produces drastically different outcomes. In the KO group, loss of CHCHD4 function results in impaired mitochondrial integrity, leading to mitochondrial dysfunction. This dysfunction triggers activation of the Nodal signaling pathway, which in turn activates the PI3K-AKT-mTOR pathway. This change promotes the expression of the transcription factor POU2F2, further increasing the expression of pro-inflammatory cytokines, leading to the formation of an immunosuppressive microenvironment that drives tumor metastasis. Furthermore, compensatory enhanced glycolysis provides energy support for the rapid proliferation of tumor cells and interacts with the epithelial-mesenchymal transition (EMT) process, jointly promoting cell migration. Ultimately, these changes result in significant alterations to the cytoskeleton of MDA-MB-231 cells, accompanied by decreased EpCAM expression, making them more susceptible to metastasis.
[0194] Activation of CHCHD4 promotes protein synthesis activity and further enhances mitochondrial function, significantly increasing oxidative phosphorylation levels. In this process, downregulation of LDHA effectively alleviates tumor microenvironment acidification caused by overactive glycolysis, thereby preventing the acidified microenvironment from promoting EMT. Furthermore, the reduction of LDHA may also attenuate the activation of the PI3K-AKT-mTOR pathway, inhibiting angiogenesis and tumor progression. However, excessive activation of CHCHD4 places cellular metabolism in a high-energy, low-efficiency state. Although oxidative phosphorylation capacity is enhanced, it is insufficient to meet the energy requirements for rapid proliferation, ultimately limiting tumor cell proliferation (e.g., ...). Figure 8 As shown in G, Figure 8 (G is a schematic diagram illustrating the mechanism by which the CHCHD4 gene affects the function of MDA-MB-231).
[0195] 5. CHCHD4 activation inhibits tumor metastasis and induces tumor regression.
[0196] Loss of function or overexpression of CHCHD4 alters the energy metabolism phenotype of MDA-MB-231 cells. These changes may subsequently affect the proliferation and metastatic potential of tumor cells. To assess the impact of CHCHD4 function on tumorigenesis, this invention established an orthotopic mammary tumor model in female mice using WT, KO, and SAM group cells. Cells containing 7 × 10⁻⁶ cells were used. 6 Cells / 100μL suspension was injected into the breast fat pad, and tumor growth was monitored over time (e.g., Figure 10 As shown in A, Figure 10Enhanced CHCHD4 function inhibits tumor metastasis and proliferation (where data are presented as mean ± standard deviation (SD), and comparisons were performed using one-way ANOVA). ); Figure 10 In group A, in situ breast cancer tumors were prepared in female nude mice (WT / KO / SAM cells were seeded into the mammary pads of female BALB / c mice). Significantly different proliferative capacities were observed in the three groups.
[0197] Notably, tumors in both the WT and KO groups showed a gradual decrease in tumor weight during tumor progression. While the WT and KO groups demonstrated full tumorigenesis (100% incidence), the tumor formation rate in the SAM group was only 50% (e.g., Figure 10 As shown in B, Figure 10 Image B represents a representative image of the tumor tissue; where the scale bar is 10 mm, and the tumor volume is significantly smaller than that of the control group (e.g., ...). Figure 10 As shown in C, Figure 10 C represents the tumor volume in the WT / KO / SAM group (n=6). Survival analysis showed that the WT group died completely on day 74, while the KO and SAM groups maintained survival rates of 33.3% and 100%, respectively. Extending the observation to day 87, no additional deaths occurred in either group (e.g., ...). Figure 10 D and Figure 10 As shown in E, Figure 10 D represents the body weight of the WT / KO / SAM group, n=6; Figure 10 E represents the survival rate of the WT / KO / SAM group (n=6), suggesting that hyperactivation of CHCHD4 may inhibit tumor proliferation and promote tumor regression.
[0198] Immunofluorescence analysis of tumor tissues revealed abundant angiogenesis (CD31+, green) in the WT and KO groups, while the SAM group showed significantly reduced angiogenesis. This suggests that CHCHD4 activation may regulate the metastatic potential of MDA-MB-231 cells by inhibiting angiogenesis. Subsequently, HE staining assessed lung metastasis, revealing widespread metastatic lesions in the WT and KO groups, while the SAM group showed only a few micrometastases (e.g., [missing information]). Figure 10 As shown in F, Figure 10 F represents HE staining and immunofluorescence images of tumor tissues from the WT / KO / SAM group (CD31, green; Ki67, red) and representative HE staining images of the lungs. These findings collectively indicate that CHCHD4 activation inhibits primary tumor growth and distant metastasis formation through angiogenesis regulation.
[0199] However, in the in situ breast fat pad injection model, the tumor volume in the SAM group was significantly smaller than that in the control group (WT / KO). To rule out the possibility that the reduced metastatic potential was caused by primary tumor growth restriction and reduced release of circulating tumor cells (CTCs), this invention injected 3 × 102 cells into each of the three groups. 5 Cells / 100μL were injected into the tail vein to directly assess its extravasation efficiency (e.g., Figure 10 As shown in G, Figure 10 G represents the average fluorescence intensity of CD31 and Ki67 in tumor tissue (statistical analysis), colonization survival rate, and the ability to form a metastatic microenvironment, thereby excluding interference from the primary tumor.
[0200] Consistent with observations in the in situ model, assessment of lung tissue using H&E staining revealed extensive metastatic lesions in the WT and KO groups, while the SAM group showed only a small number of micrometastatic infiltrations (e.g., Figure 10 H and Figure 10 As shown in I, Figure 10 H was used to prepare a lung metastasis model via tail vein injection. Figure 10 (I represents a representative image of H&E staining results in lung tissue). This consistency between spontaneous mammary fat pad metastasis and experimental hematogenous spread induced by tail vein injection strongly demonstrates that CHCHD4 hyperactivation fundamentally attenuates the metastatic capacity of MDA-MB-231 cells. Notably, this inhibition of malignant progression is independent of primary tumor burden or size, further supporting the cellular autologous role of CHCHD4 signaling in regulating metastatic dynamics.
[0201] The above embodiments have provided a detailed description of the present invention. For those skilled in the art, the present invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although embodiments have been given, it should be understood that further modifications can be made to the present invention. In summary, according to the principles of the present invention, this application is intended to include any changes, uses, or improvements to the present invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. Use of a preparation for promoting CHCHD4 expression in the preparation of a medicament for treating cancer.
2. The use according to claim 1, wherein, The cancer includes breast cancer.
3. The use according to claim 2, wherein, The cancer is triple negative breast cancer.
4. The use according to claim 1, wherein, The preparation for promoting CHCHD4 expression is a preparation for overexpressing CHCHD4.
5. Use according to claim 4, wherein, The preparation for overexpressing CHCHD4 includes a CRISPR / Cas9 preparation for promoting CHCHD4 expression.
6. Use according to claim 5, wherein, The CRISPR / Cas9 preparation includes sgRNA, the sequence of which is shown in SEQ ID No.
2.
7. The use according to claim 1, wherein, The treatment of cancer is manifested as one or both of inhibiting triple negative breast cancer tumor metastasis and inhibiting triple negative breast cancer tumor proliferation; preferably, the tumor is a tumor formed by MDA-MB-231 cells.
8. Use of a preparation for promoting CHCHD4 expression in the preparation of a medicament for inhibiting triple negative breast cancer tumor proliferation.
9. Use of a preparation for promoting CHCHD4 expression in the preparation of a medicament for inhibiting triple negative breast cancer tumor metastasis.
10. Use of a preparation for promoting CHCHD4 expression in the preparation of a medicament for inhibiting MDA-MB-231 cell proliferation and / or metastasis.