Primer and probe for rapidly detecting mycobacterium paratuberculosis and application

Abstract

The invention discloses a primer and a probe for rapidly detecting mycobacterium paratuberculosis and application of the primer and the probe, and belongs to the technical field of biology. The invention discloses a TaqMan qPCR method, primer and probe for detecting MAP genome nucleic acid aiming at UNI-DUF4185, and an MAP detection method is established by taking a nucleic acid sample of a cattle and sheep vaccine production strain (virus) as a template. Sensitivity test results show that when the recombinant plasmid of UNI-DUF4185 is detected, the lowest detection limit of the detection method is 50 copies / reaction; when the nucleic acid of the MAP genome is detected, the lowest detection limit of the method is 1.12 CFU / reaction. By detecting the recombinant plasmid of UNI-DUF4185, the stability of the established method is evaluated, and the coefficient of variation between batches is within 5%, which is crucial for developing a rapid, sensitive and specific detection method for identifying MAP infected animals and formulating reasonable measures according to the detection result to control the propagation of MAP.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to primers, probes, and applications for the rapid detection of Mycobacterium paratuberculosis. Background Technology

[0002] Mycobacterium paratuberculosis ( Mycobacterium avium paratuberculosis subsp Mycobacterium avium MAP (paratuberculosis enteritis) is a Gram-positive acid-fast bacillus and the causative agent of paratuberculosis. Paratuberculosis is a global epidemic characterized by chronic proliferative enteritis and granulomatous enteritis. It has a high prevalence in ruminants, usually presenting sporadically or endemically, and can lead to significantly reduced milk production, persistent emaciation, and intractable diarrhea in infected animals. MAP is excreted in the feces of infected animals, who are the primary source of infection, with fecal-oral transmission being the main route of transmission. Young animals are most susceptible to MAP, and some animals may not develop clinical symptoms for months to years after infection; most animals are asymptomatic. The greatest challenge in controlling paratuberculosis is identifying infected animals before the appearance of clinical symptoms; therefore, detection of asymptomatic infection is crucial for disease control.

[0003] Diagnostic tests for paratuberculosis are divided into tests targeting MAP and tests targeting the host immune response induced by MAP. The specificity issue arises from the high similarity between MAP and other mycobacteria, particularly Mycobacterium avium (MAP). Figure 1 MAP and MAV share a high degree of genetic similarity, with over 95% genomic sequence similarity. This similarity leads to false-positive results in diagnostic tests based on cell-mediated immune responses, humoral immune responses, and those directly targeting MAP nucleic acids. Fecal bacterial culture and fecal MAP nucleic acid detection are direct detections of bacteria excreted by individual animals. Fecal bacterial culture is generally considered the gold standard for diagnosing MAP infection in animals, typically yielding MAP from feces 6 months or more before the onset of symptoms. Developing MAP from fecal samples is crucial for detecting latent infections, but it takes at least 6 weeks for MAP colonies to grow, a lengthy process. MAP nucleic acid in fecal samples is detected using methods such as PCR or quantitative real-time polymerase chain reaction (qPCR), with reaction times generally ranging from less than one hour to several hours. The specificity of the test results depends on the target and the sample, but the complex microbial composition of feces can affect or interfere with the specificity of the detection method. Due to insufficient sensitivity or specificity, current detection techniques for paratuberculosis diagnosis still require improvement. Summary of the Invention

[0004] The technical problem solved by the present application is to provide a primer and a probe for rapidly detecting Mycobacterium paratuberculosis and an application thereof, so as to solve the technical problems of insufficient specificity and insufficient high sensitivity of the existing primer and probe for detecting Mycobacterium paratuberculosis.

[0005] To achieve the above object, the technical scheme adopted by the present application is to provide a primer and a probe for rapidly detecting Mycobacterium paratuberculosis, comprising a forward primer 175qF, a reverse primer 175qR and a probe 175qP, and the nucleotide sequences are as follows: The forward primer 175qF is CCAGCAGTTGCGTTGAATCC (SEQ ID NO: 1); The reverse primer 175qR is ATCCAAGCGAAGTCACCCAG (SEQ ID NO: 2); The probe 175qP is FAM-TCGCTGGCAACCCTGGAACGGAACC-BHQ1 (SEQ ID NO: 3).

[0006] The present application also discloses an application of the primer and the probe in preparing a kit for identifying Mycobacterium paratuberculosis.

[0007] The present application also discloses a kit for identifying Mycobacterium paratuberculosis, which comprises the primer and the probe.

[0008] On the basis of the above technical scheme, the present application can also be improved as follows: Further, the kit further comprises a positive quality control standard, a negative quality control standard and a reaction solution.

[0009] Further, the positive quality control standard is a positive quality control standard comprising a UNI-DUF418 gene fragment of Mycobacterium paratuberculosis, and the nucleotide sequence of the UNI-DUF418 gene fragment is shown as SEQ ID NO: 4.

[0010] The present application has the following beneficial effects: 1. The present application screens a MAP specific genomic fragment (UNI-DUF4185) with a length of 1070bp by comparing microbial genomes and eliminating genomic sequences with high similarity to other microorganisms, and the sequence corresponds to nucleotides 301647-302716 of the MAP K-10 strain genomic sequence (GenBank: AE016958). UNI-DUF4185 exists in 32 MAP strains with published genomes, and the matching degree is 100% and the homology is 100%; the homology with other microorganisms is less than 75%, which indicates that UNI-DUF4185 only exists in MAP and is highly conservative, and is an ideal molecular detection target.

[0011] 2、Design primers and probes for TaqMan qPCR against UNI-DUF4185, and establish a MAP detection method using bovine and ovine vaccine production strain (toxin) nucleic acid samples as templates. Use common infectious disease pathogens in bovine and ovine as specific quality control products to evaluate the effectiveness of the detection method. The sensitivity test results show that the detection limit of the detection method is 50 copies / reaction for detecting UNI-DUF4185 recombinant plasmid, and 1.12 CFU / reaction for detecting MAP genomic nucleic acid. By detecting UNI-DUF4185 recombinant plasmid, the stability of the established method is evaluated, and the batch-to-batch coefficient of variation is within 5%. The established method and nested PCR are used to detect 100 fecal clinical samples, and the consistency of the detection results of the two methods is 100%. The amplified products are sequenced and compared, and the amplified products of the established method are UNI-DUF4185 fragments.

[0012] 3、The application discloses a TaqMan qPCR method for detecting MAP genomic nucleic acid against UNI-DUF4185, primers and probes, and is important for developing a rapid, sensitive and specific detection method for identifying MAP-infected animals, and formulating reasonable measures to control the spread of MAP according to the detection results. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 2 The position of the primer probe against UNI-DUF4185 in the genome of the MAP reference strain; Figure 3 The primer and probe of TaqMan qPCR against UNI-DUF4185 and the base pairing results of Mycobacterium mantenii (GenBank No. AP022590) genome; Figure 4 MAP bacterial colony morphology; Figure 5 MAP acid-fast staining bacterial morphology; Figure 6 PCR amplification results of the target fragment for constructing the plasmid standard; Figure 7 Detection results of bovine and ovine vaccine samples by TaqMan qPCR against UNI-DUF4185; Figure 8 Standard curve of the MAP TaqMan qPCR detection method; Figure 9 Specificity test results of the MAP TaqMan qPCR detection method; Figure 10 Sensitivity test results of the MAP TaqMan qPCR detection method; Figure 11 Detection results of the first round of nested PCR (NF / NR-175qF / 175qR); wherein Figure A is the detection result of MAP diluted bacterial suspension genomic DNA; Figure B is the detection result of plasmid standard. Mycobacterium avium paratuberculosis Detection results of the second round of nested PCR (NF / NR-175qF / 175qR); wherein Figure A is the detection result of MAP diluted bacterial suspension genomic DNA; Figure B is the detection result of plasmid standard. DETAILED DESCRIPTION

[0014] The specific embodiments of the present application are described below to facilitate the understanding of the present application by those skilled in the art, and the specific conditions not specified in the examples are carried out according to the conventional conditions or the conditions recommended by the manufacturer, and the reagents or instruments not specified by the manufacturer are all conventional products that can be purchased on the market. But it should be clear that the present application is not limited to the scope of the specific embodiments, and for those skilled in the art, it is obvious that all kinds of changes within the spirit and scope of the present application defined and determined by the appended claims are within the scope of protection of the present application.

[0015] The following examples use Mycobacterium avium subsp. Mycobacterium avium subsp . Mycobacterium avium paratuberculosis , MAP) is MAP-NMS01 strain isolated and preserved by Chongqing Institute of Animal Husbandry and Veterinary Medicine, and the MAP-NMS01 strain was preserved in China General Microbiological Culture Collection Center on July 1, 2024, the address of the preservation center is No. 1, Beichen West Road, Chaoyang District, Beijing, and the preservation number is CGMCC No. 41198.

[0016] The Mycobacterium avium subspecies paratuberculosis K-10 strain has been disclosed in the document "The complete genome sequence of Mycobacterium avium subspecies paratuberculosis" (document information: Li L, Bannantine JP, Zhang Q, Amonsin A, May BJ, Alt D, Banerji N, Kanjilal S, Kapur V. The complete genome sequence of Mycobacterium avium subspecies paratuberculosis. Proc Natl Acad Sci U S A. 2005 Aug 30;102(35):12344-9. doi: 10.1073 / pnas.0505662102.), and its genome data is from the NCBI GenBank database (GenBank No. AE016958, Table 1).

[0017] The microorganisms and reagents used in the following experiments are shown below: Mycobacterium bovis (Danish strain of BCG), Salmonella bovism 7953 strain (CVCC 79531), Escherichia coli C83-1 strain CVCC 8301, Clostridium perfringens type D C60-2 strain, Clostridium perfringens type B C58-1 strain, Brucella abortus A19 strain (CVCC 70202), Brucella melitensis BA0711 strain, bovine viral diarrhea virus, bovine rotavirus were provided by Chongqing Aulong Biological Products Co., Ltd.

[0018] The inactivated vaccines for ovine colibacillosis (containing Escherichia coli strains C83-1 CVCC 8301, C83-2 CVCC 8302, and C83-3 CVCC 8303), ovine septicemic streptococcal disease (containing Streptococcus equine subsp. septicemicus ovine strain), and goat pox live vaccine (containing attenuated goat pox virus strain CVCC AV41) were purchased from Harbin Pharmaceutical Group Biological Vaccine Co., Ltd. Bovine Pasteurella multocida inactivated vaccine (Bovine Pasteurella multocida C47-2 strain, C45-2 strain), "Sheep Enterotoxemia Trivalent Quadrivalent Inactivated Vaccine" (containing Clostridium perfringens C55-1 or C55-2 strain, Clostridium perfringens type B C58-1 or C58-2 strain, and Clostridium perfringens type D C60-2 or C60-3 strain), and sheep mycoplasma pneumonia inactivated vaccine (MoGH3-3 strain + M87-1 strain) were purchased from Chongqing Aolong Biological Products Co., Ltd. Bovine paratyphoid inactivated vaccine (Salmonella Dublin and Salmonella bovineis) was purchased from Sichuan Hailinger Biopharmaceutical Co., Ltd. Sheep infectious pustular dermatitis live vaccine (containing HCE strain) was purchased from Shandong Huahongsheng Engineering Co., Ltd.

[0019] Tissue genomic DNA extraction kit and bacterial genomic DNA extraction kit were purchased from Tiangen Biotech (Beijing) Co., Ltd.; fecal genomic DNA extraction kit was purchased from Jiangsu Kangwei Century Biotechnology Co., Ltd.; DNA / RNA virus genomic extraction kit, 2xProbe qPCR Mix, pMD19-T Vector Cloning Kit, Premix ExTaq DNA Polymerase, DNA gel recovery kit, plasmid extraction kit, and DNA Marker were purchased from TaKaRa and Baori Biotechnology (Beijing) Co., Ltd.

[0020] The PCR instrument (Applied Biosystem) was purchased from Themal; the LightCycler® 96 real-time quantitative PCR instrument was purchased from Roche.

[0021] Example 1 1. Genome alignment Table 1 shows the information of 32 MAP strains with whole genome sequences published in GenBank. Using the genome sequence of strain K-10 (GenBank No. AE016958) (Table 1, sequence number 24), the whole MAP genome was sequenced using Microbial genome BLAST (https: / / www.ncbi.nlm.nih.gov / genome / ), and genome sequences with high similarity to other microorganisms were removed in order to find its specific sequences.

[0022] Table 1 Published whole genome MAP strain information

[0023] By genome alignment, a MAP specific genomic fragment of 1070 bp in length was screened, corresponding to nucleotides 301647-302716 of MAP K-10 strain. It was named UNI-DUF4185 because it encodes a Domain of unknown function (DUF) DUF4185. UNI-DUF4185 has 100% sequence homology and 100% match with the corresponding sequences of 32 published genomes; and less than 75% homology with other microorganisms (Table 2). This indicates that the sequence only exists in MAP and is highly conserved, making it an ideal molecular detection target.

[0024] Table 2 UNI-DUF4185 sequence alignment results

[0025] MAP a : Mycobacterium subsp senriense ; Ms b : Mycobacterium mantenii Mycobacterium europaeum ; Mm c : Mycobacterium avium ; Me d : hominissuis ; MAH e : Mycobacterium paraintracellulare subsp. Mycobacterium intracellulare ; Mp f : Mycobacterium avium ; Mi g : Mycobacterium gordonae ; Ma h : Mycolicibacterium phocaicum ; Mg i : Mycolicibacter ; Mp j : heraklionensis ; Mh k : Figure 1 M. mantenii . Start site is the start site of the aligned sequence in the reference strain genome sequence; end site is the start site of the aligned sequence in the reference strain genome sequence.

[0026]

[0027] 2. Primer and probe design The TaqMan qPCR forward primer, reverse primer and probe (SEQ ID NO: 1-3) for UNI-DUF4185 were designed by eurofins genomics (https: / / eurofinsgenomics.eu / en / ecom / tools / biplex-qpcr-assay-design / #) and the matching degree of the amplified fragment with other microbial genome sequences was analyzed by BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast). The primers and probes were synthesized by Sheng Wu Bioengineering (Shanghai) Co., Ltd.

[0028] The primer and probe sequences obtained by sequence alignment screening are shown in Table 3, and the positions in the MAP genome are shown in M. mantenii . The length of the amplified fragment is 175 bp. The matching degree analysis of the TaqMan qPCR amplified fragment for UNI-DUF4185 for detecting MAP with other microbial genome sequences shows that the matching degree with the genome sequence of M. mantenii (GenBank No. AP022590) is the highest, which is 94% (Table 4); the forward primer and the probe have more continuous base pairing with the genome of Figure 2 (GenBank No. AP022590), but the reverse primer has only 7 continuous base pairings with the genome of Mycobacterium senriense (GenBank No. AP022590) Mycolicibacterium phocaicum. ; the matching sequences with other microorganisms cannot cover the forward primer, the reverse primer and the probe at the same time. This shows that the forward primer, the reverse primer and the probe for detecting MAP for UNI-DUF4185 have good specificity.

[0029] Table 3 Information of obtained primer and probe sequences

[0030] Table 4 Matching degree analysis of TaqMan qPCR amplified fragment with other microbial genome sequences

[0031] Ms b : Figure 3 ; Mm c : Mycobacterium mantenii; Mp j : Figure 4

[0032] Example 2 Preparation and identification of plasmid standard The preserved MAP-NMS01 strain was inoculated into HEYM slant medium (containing 2 mg / L Mycobactin J, 50 μg / mL nalydixic acid, 50 μg / mL vancomycin) and cultured at 37 °C for 4-8 weeks. Single colonies on the medium were picked and subjected to acid-fast staining, and the results were observed under an oil immersion lens to check the purity of the culture.

[0033] Single colonies on the HEYM medium were picked and inoculated into 7H9 liquid medium (containing 2 mg / L Mycobactin J, 10% OADC, 0.2% glycerol, 0.05% Tween-80) and cultured at 37 °C for 4-8 weeks. The culture genomic DNA was extracted using a bacterial genomic DNA extraction kit. The extracted DNA sample was amplified using Premix Ex Taq DNA Polymerase and uniF / uniR primer pair (SEQ ID NO: 5 and SEQ ID NO: 6) in a reaction system of 2x Premix Ex Taq DNA Polymerase 25 μL, upper and lower primers (10 μmol / L) 1 μL each, DNA (15 ng / μL) 1 μL, and deionized water 50 μL; the reaction program was 94 °C for 2 min; 30 cycles of 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 90 s; and 72 °C for 10 min. The DNA gel recovery kit was used to recover and purify the target fragment. The recovered target gene fragment was ligated to pMD19-T Vector Cloning Kit to construct pMD-MAP-QC, which was transformed into E. coli DH5α to construct a recombinant strain. The recombinant strain was cultured, the recombinant plasmid was extracted using a plasmid extraction kit and sequenced for verification, and the measured sequence was subjected to BLST search on NCBI for homology comparison. The recombinant plasmid with correct sequence was used as a plasmid standard and stored at -20 °C for standby use.

[0034] After 4 weeks of culture, white smooth and dot-distributed small colonies were observed on the medium Figure 5 . Single colonies were picked and subjected to acid-fast staining, and aggregated or dispersed red short rod-shaped bacteria were observed under an oil immersion lens Figure 6 .

[0035] Agarose gel electrophoresis results showed that PCR products with expected size were amplified from the isolated bacterial genomic DNA. The PCR products were cloned into pMD19-T to construct recombinant plasmid pMD-MAP-QC, which was sequenced. Sequence analysis results showed that the measured sequence had 100% homology with MAP, indicating that the product obtained by PCR amplification was the genomic DNA sequence of MAP.

[0036] Figure 6 PCR amplification results of the purpose fragments for constructing plasmid standard, in which the letter "M" is DNA Marker DL2000; the number "1" is the MAP genome amplification product; the number "2" is the negative control.

[0037] Example 3 1. Determination of nucleic acid sample addition amount and annealing temperature In order to establish a specific MAP detection method, first, commercially available cattle and sheep vaccine production strains and strains were selected as control products for evaluating the specificity of the method, and the samples were extracted according to the requirements of the bacterial genomic DNA extraction kit and the DNA / RNA viral genome extraction kit instructions. The nucleic acid sample extracted from the MAP culture was used as a positive control, and deionized water was used as a negative control. Sheep E. coli disease inactivated vaccine (containing E. coli C83-1 strain CVCC 8301, C83-2 strain CVCC 8302 and C83-3 strain CVCC 8303), sheep septicemic streptococcosis inactivated vaccine (containing Streptococcus equi subsp. zooepidemicus of sheep origin), goat pox live vaccine, bovine pasteurellosis inactivated vaccine (bovine pasteurella C47-2 strain, C45-2 strain), "sheep fast epidemic, sudden attack, lamb dysentery, enterotoxemia triple four prevention inactivated vaccine" (containing Clostridium perfringens C55-1 strain or C55-2 strain, Clostridium perfringens type B C58-1 strain or C58-2 strain and Clostridium perfringens type D C60-2 strain or C60-3 strain), sheep mycoplasma pneumonia inactivated vaccine (MoGH3-3 strain + M87-1 strain), bovine paratyphoid inactivated vaccine (Dublin Salmonella and bovine disease Salmonella), sheep contagious pustular dermatitis live vaccine (containing HCE strain) were used as specific quality control products, and the sample nucleic acid was detected using the primer probe combination shown in Table 3. The sample nucleic acid addition amount and annealing temperature without cross reaction were screened.

[0038] The volume of TaqMan qPCR reaction was 25 μL, 1 μL or 2 μL of nucleic acid sample was added, deionized water was used instead of bacterial genomic DNA as negative control, and the reaction system was shown in Table 5 and Table 6. The cycle parameters of 59°C annealing temperature were 95°C 1 min; 95°C 5 s, 60°C 30 s, 40 cycles. The cycle parameters of 60°C annealing temperature were 95°C 1 min; 95°C 5 s, 60°C 30 s, 40 cycles. The cycle parameters of 61°C annealing temperature were 95°C 1 min; 95°C 5 s, 61°C 30 s, 40 cycles. MAP appeared typical amplification curve, Ct≤20, and the negative control had no Ct value, which was determined as a valid reaction. The determination of no cross-reaction result: under the condition of a valid reaction, the non-MAP nucleic acid sample had no Ct value, no amplification curve or no obvious logarithmic growth period in the reaction curve in 3 detection results, which was determined as no cross-reaction. The determination of cross-reaction result: under the condition of a valid reaction, the non-MAP nucleic acid sample had Ct value and obvious logarithmic growth period in the amplification curve in 3 detection results, which was determined as cross-reaction.

[0039] After inspection, when the nucleic acid sample was added in an amount of 1 μL and the annealing temperature was 60°C, MAP appeared typical amplification curve, Ct≤20, the negative control had no amplification curve and no Ct, and the non-MAP nucleic acid sample had no Ct value in 3 detection results (Table 7-Table 9, Figure 7 ). This indicated that the reaction components of TaqMan qPCR for detecting MAP established for UNI-DUF4185 could be determined as follows: total volume 25 μL, 2×Mix 12.5 μL of premixed buffer, 0.5 μL of each of upstream and downstream primers (10 μmol / L), 0.25 μL of probe (10 μmol / L), 1 μL of sample nucleic acid, and 10.25 μL of deionized water; and the reaction parameters could be determined as follows: 95°C 1 min; 94°C 5 s, 61°C 30 s, 40 cycles.

[0040] Table 5 Reaction components with 1 μL of template amount

[0041] Table 6 Reaction components with 2 μL of template amount

[0042] Table 7 Detection results of TaqMan qPCR for UNI-DUF4185 on cattle and sheep vaccines (annealing temperature: 59°C)

[0043] “-” indicates that the detection result of the sample to be detected has no Ct value, no amplification curve or no obvious logarithmic growth period in the reaction curve.

[0044] Table 8. Detection results of TaqMan qPCR for UNI-DUF4185 on bovine and ovine vaccines (annealing temperature: 60°C)

[0045] "-" means that the sample to be tested shows no Ct value, no amplification curve or no obvious logarithmic growth period of the reaction curve.

[0046] Table 9. Detection results of TaqMan qPCR for UNI-DUF4185 on bovine and ovine vaccines (annealing temperature: 61°C)

[0047] "-" means that the sample to be tested shows no Ct value, no amplification curve or no obvious logarithmic growth period of the reaction curve. Figure 8 Table 10. Detection results of TaqMan qPCR for UNI-DUF4185 on bovine and ovine vaccine samples, in which the number "1" is the amplification curve of 3 times detection of MAP culture nucleic acid sample, and the number "2" is the amplification curve of negative control and non-MAP nucleic acid sample detection.

[0048] 2. Preparation of standard curve Dilute the plasmid standard pMD-MAP-QC to adjust the copy number concentration to 1.0 x 10 10 copies / μL, and then perform 10-fold serial dilution (1.0 x 10 10 copies / μL to 1.0 x 10 0 copies / μL). Perform qPCR amplification with 1 μL of plasmid standard pMD-MAP-QC at different concentrations (10 9 copies / μL to 10 2 copies / μL), repeat the detection of each plasmid copy number concentration for 3 times and set negative control, and draw the standard curve by the relationship between the average Ct value of amplification reaction of TaqMan qPCR detection method and the logarithmic value of corresponding plasmid copy concentration.

[0049] The standard curve of MAP TaqMan qPCR detection method for UNI-DUF4185 is Y = -3.179x + 12.663, the correlation coefficient R 2 is 0.9983, and the amplification efficiency E is 102.87% ( Figure 9 ). This shows that the standard curve of TaqMan qPCR method has good linear relationship, and can realize the quantitative analysis purpose of unknown clinical sample bacterial load.

[0050] 3. Specificity test The specificity of the method was evaluated by specific amplification curve and fluorescence signal using the above TaqMan qPCR to amplify nucleic acid of specific test samples, bovine Mycobacterium (BCG Denmark strain), bovine Salmonella 7953 strain (CVCC 79531), Escherichia coli C83-1 strain CVCC 8301, Clostridium perfringens type D C60-2 strain, Clostridium perfringens type B C58-1 strain, bovine Brucella A19 strain (CVCC 70202), sheep Brucella BA0711 strain, bovine viral diarrhea virus, and bovine rotavirus. The genome extracted from MAP culture was used as positive control, and deionized water was used as negative control. MAP appeared typical amplification curve, Ct≤20, and negative control had no Ct value, indicating that the reaction was successful. In the case of successful reaction, the detection results of non-MAP nucleic acid samples showed no Ct value, no amplification curve or no obvious logarithmic growth period of reaction curve, which was judged as no cross reaction.

[0051] The above samples were detected using the established TaqMan qPCR, and the results are shown in Figure 9 (wherein the number "1" is the nucleic acid sample of MAP culture; the number "2" is the negative control and non-MAP nucleic acid sample), only the genome extracted from MAP culture detection appeared S-shaped amplification curve and fluorescence signal, and other nucleic acid sample detection results showed no Ct value, no amplification curve or no obvious logarithmic growth of reaction curve. This shows that the established method does not cross react with nucleic acid other than MAP, showing good specificity.

[0052] 4. Sensitivity test The viable count of MAP cultured in 7H9 liquid medium was performed. 1 mL of freshly cultured bacterial suspension was taken with a pipette, slowly injected along the wall of the sterile test tube containing 9 mL of physiological saline (containing 0.05% Tween-80), and mixed uniformly on a shaker, to prepare a 1:10 bacterial suspension (diluted by 10 times). This method was continuously diluted to 1:10 10 . Three 1 mL bacterial suspensions were taken for sensitivity test at each dilution, and the viable count of bacterial suspension at each dilution was also performed.

[0053] The viable bacterial count method is as follows: 1 mL of each dilution of bacterial suspension is taken into two sterile culture dishes; at the same time, 1 mL of normal saline is taken into two sterile culture dishes as a blank control. 15 mL to 20 mL of plate count agar medium (7H9 medium containing 2 mg / L Mycobactin J, 10% OADC, 0.2% glycerol, 0.05% Tween-80, 1.6% agar powder) cooled to 46°C to 50°C is poured into the culture dishes, and the culture dishes are rotated to mix the medium with the bacterial suspension or normal saline evenly. The plates are placed horizontally until the agar solidifies, then the plates are turned over and incubated at 36°C ± 1°C for 8 weeks. The colony-forming units (CFU) on the plates are counted, and the number of bacteria contained in 1 mL of the original culture solution is calculated. The genomic DNA of 1 mL of the diluted bacterial suspension at each dilution is extracted using a bacterial genomic DNA extraction kit.

[0054] The plasmid standard pMD-MAP-QC is amplified using the above established TaqMan qPCR method. The plasmid has a concentration of 10 9 copies / μL to 10 0 copies / μL, and the reaction components are as follows: 1 μL of plasmid, 12.5 μL of 2xProbe qPCR Mix, 0.5 μL of each of the upstream and downstream primers (10 μmol / L), 0.25 μL of probe (10 μmol / L), and 10.25 μL of deionized water. The reaction program is as follows: 1 min at 95°C; 5 s at 95°C, 30 s at 60°C, 40 cycles. In addition, the established TaqMan qPCR method is used to detect 100, 50, 25, 12.5, and 6.25 copies / μL of the plasmid standard pMD-MAP-QC, and the genomic DNA samples extracted from 1 mL of bacterial suspension at each dilution are detected. Each sample is detected 16 times, and the lowest plasmid concentration or the lowest MAP concentration that can be stably detected and has a detection rate of ≥95% is defined as the lowest detection limit of the method. The positive and negative judgment criteria are as follows: when the amplification curve Ct value is ≤40, the sample detection result is judged to be positive; when the amplification curve has no Ct value, the sample detection result is judged to be negative.

[0055] Simultaneously, nested PCR (NF / NR-175qF / 175qR) consisting of primer pairs NF / NR (SEQ ID NO: 7 and SEQ ID NO: 8) + 175qF / 175qR (SEQ ID NO: 1 and SEQ ID NO: 2) was used to detect plasmid standards with different copy numbers and genomic DNA extracted from 1 mL diluted bacterial suspensions at various dilutions. Deionized water was used as a negative control. Nested PCR used the sequencing primers listed in Table 3. The first round of PCR used primer pair NF / NR, and the second round used primer pair 175qF / 175qR. The reaction systems for the first and second rounds of PCR are shown in Table 10. The second round of PCR used the PCR product from the first round as a template. PCR reaction parameters were: 94℃ for 2 min; 94℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, 30 cycles; 72℃ for 3 min; stored at room temperature.

[0056] Table 10 PCR Reaction System

[0057] Based on the test results ( Figure 10 As can be seen, the established MAP TaqMan qPCR method can stably detect 10 9 copies / μL ~ 10 3 The plasmid standard pMD-MAP-QC was tested at concentrations of 100, 50, 25, 12.5, and 6.25 copies / μL. Repeated detection results for pMD-MAP-QC at concentrations of 100 and 50 copies / μL showed that the established method can stably detect plasmids with a detection rate ≥95% at concentrations of 100 and 50 copies / μL. The limit of detection for the established method is 50 copies / reaction (Table 11).

[0058] Figure 11 The numbers "9" through "2" represent 10 respectively. 9 10 8 10 7 10 6 10 5 10 4 10 3 10 2 Copy / μL plasmid standard.

[0059] Based on the viable count results, the cultured bacteria were diluted 10... 6 After dilution, the CFU colony count on the plate was between 30 and 300, which meets the counting requirements. This dilution of bacterial suspension contained 112 CFU / mL, while the original culture medium contained 1.12 × 10⁻⁶ CFU / mL. 8CFU / mL. The results of repeated detection of MAP dilution bacterial suspension showed that the established method could stably detect, and the number of live bacteria with a detection rate of ≥95% was greater than or equal to 1.12 CFU / mL, and the Ct value of the number of live bacteria greater than or equal to 112 CFU / mL was less than or equal to 35.5.

[0060] Table 11 Sensitivity results of MAP TaqMan qPCR method

[0061] It can be seen from the detection results of nested PCR (NF / NR-175qF / 175qR) that the detection sensitivity of the first round of PCR is significantly lower than that of the second round of PCR; the second round of PCR can detect MAP = 1.12 CFU / mL, and the plasmid standard 100 copies / μL. It shows that the detection sensitivity of nested PCR for sample nucleic acid is equivalent to the detection sensitivity of the established TaqMan qPCR method, and the second round of PCR amplification product of nested PCR is used for sequencing to verify the detection accuracy of TaqMan qPCR. Figure 10 Figure 11

[0062] ​ and ​ Figure A of the present application is the first round result of nested PCR (NF / NR-175qF / 175qR), and the letter "M" is DL2000 Marker; the numbers "1"-"8" are respectively 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 ; the number "9" is a negative control; Figure B is the second round result of nested PCR (NF / NR-175qF / 175qR), and the letter "M" is DL2000 Marker; the numbers "1"-"7" are respectively 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 , 10 0 ; the number "8" is a negative control.

[0063] 5. Repetitive test The plasmid standard pMD-MAP-QC was used for repetitive test, and the different copy number concentrations were 1.0×10 8 copies / μL, 1.0×10​​6 copies / μL, 1.0 x 10 4 copies / μL 3 replicates as reaction templates, and deionized water as template for negative control, using the above established TaqMan qPCR amplification, the established MAP detection method was repeatedly verified, and the copy number of each plasmid was set for intra-batch repeated test (at the same time), inter-batch repeated test (different time and different batch qPCR enzyme premix system) each 3 times. Calculate the coefficient of variation (CV) of Ct value of intra-batch repeated test and inter-batch repeated test, evaluate the repeatability and stability of the method, and the results are shown in Table 12.

[0064] copies / μL 3 replicates as reaction templates, and deionized water as template for negative control, using the above established TaqMan qPCR amplification, the established MAP detection method was repeatedly verified, and the copy number of each plasmid was set for intra-batch repeated test (at the same time), inter-batch repeated test (different time and different batch qPCR enzyme premix system) each 3 times. Calculate the coefficient of variation (CV) of Ct value of intra-batch repeated test and inter-batch repeated test, evaluate the repeatability and stability of the method, and the results are shown in Table 12.

[0065] Table 12 repeatability evaluation results

[0066] 6、Clinical sample detection Clinical samples were used as sheep and cattle fecal samples, including 10 sheep fecal samples with MAP positive bacterial culture, 40 sheep fecal samples collected from sheep farms without paratuberculosis history, and 50 cattle fecal samples collected from cattle farms without paratuberculosis history. The established TaqMan qPCR method and nested PCR (NF / NR-175qF / 175qR) method were used to detect the genomic DNA extracted from the above samples. For TaqMan qPCR detection, samples with amplification curve and 35 < Ct value < 40 were repeatedly detected. If the repeated detection Ct value < 40 and the amplification curve had a clear logarithmic growth period, it was judged as Mycobacterium paratuberculosis nucleic acid positive, otherwise it was judged as Mycobacterium paratuberculosis nucleic acid negative. The consistency of TaqMan qPCR method and nested PCR (NF / NR-175qF / 175qR) method was evaluated. The TaqMan qPCR amplification product and the nested PCR (NF / NR-175qF / 175qR) second round PCR product were sequenced, and their homology with MAP was analyzed by BLAST.

[0067] The results of TaqMan qPCR and nested PCR (NF / NR-175qF / 175qR) were consistent in 10 fecal samples from sheep with MAP culture positive. The results of 40 fecal samples from sheep without history of paratuberculosis were consistent, and the positive rate was 5%. The results of 50 fecal samples from cattle without history of paratuberculosis were different. The positive rate of TaqMan qPCR was 8% (4 / 50), and one sample was negative by nested PCR (NF / NR-175qF / 175qR). BLAST results showed that the amplified products were consistent with the target sequence.

Claims

1. A primer and probe for rapid detection of Mycobacterium paratuberculosis, characterized in that, The nucleotide sequences of the primer 175qF (forward), primer 175qR (reverse), and probe 175qP are shown below: Forward primer 175qF: CCAGCAGTTGCGTTGAATCC; Reverse primer 175qR: ATCCAAGCGAAGTCACCCAG; Probe 175qP: FAM-TCGCTGGCAACCCTGGAACGGAACC-BHQ1.

2. The use of the primers and probes according to claim 1 in the preparation of a kit for identifying Mycobacterium paratuberculosis.

3. A kit for identifying Mycobacterium paratuberculosis, characterized in that, It includes the primers and probes as described in claim 1.

4. The reagent kit according to claim 3, characterized in that, The kit also includes positive control standards, negative control standards, and reaction solution.

5. The reagent kit according to claim 4, characterized in that, The positive control standard is a positive control standard comprising the Mycobacterium paratuberculosis UNI-DUF418 gene fragment, the nucleotide sequence of which is shown in SEQ ID NO: 4.

Images