Sufu gene knockout st cells and uses thereof

By knocking out the SUFU gene using CRISPR/Cas9 technology, SUFU gene knockout ST cells were constructed, solving the problems of low viral proliferation efficiency and purity in ST cells, and achieving efficient proliferation and high-purity porcine epidemic diarrhea virus vaccine production.

CN122303147APending Publication Date: 2026-06-30JIANGSU ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411962333.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-12-30
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

In the current production of porcine epidemic diarrhea virus vaccines, the viral proliferation efficiency and purity of ST cells need to be improved, especially since the differences between different division stages have not been fully utilized.

Method used

By knocking out the SUFU gene using CRISPR/Cas9 technology, SUFU gene knockout ST cells were constructed. Frameshift mutations were introduced to increase the number of G1 phase cells, thereby improving viral replication efficiency and purity.

Benefits of technology

It significantly improves the replication efficiency of porcine epidemic diarrhea virus and the purity of vaccine products. The high replication efficiency and high product purity make it suitable for the preparation of porcine epidemic diarrhea virus vaccines.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122303147A_ABST
    Figure CN122303147A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of cell biology, particularly the interdisciplinary field of cell biology and vaccine production. More specifically, it relates to ST cell lines with the SUFU gene knocked out, their construction methods, and applications. The ST cell lines with the SUFU gene knocked out constructed by this invention can increase the number of cells in the G1 phase, thereby providing a more suitable cell state for the proliferation and replication of porcine epidemic diarrhea virus. The single cell proliferation efficiency is high, and the product purity is high, which is of great significance for the preparation of porcine epidemic diarrhea vaccines.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of cell biology, particularly the interdisciplinary field of cell biology and vaccine production, and more specifically, it relates to SUFU gene knockout ST cells and their applications. Background Technology

[0002] Porcine epidemic diarrhea (PED) is an acute, highly contagious intestinal infectious disease caused by porcine epidemic diarrhea virus (PEDV). Its clinical features include watery diarrhea, vomiting, and dehydration. PED has been reported to cause significant outbreaks in Asian countries in recent years, with major epidemics occurring in Japan, South Korea, and Thailand, resulting in high mortality rates and severe damage, causing substantial economic losses to the pig farming industry.

[0003] It has been proven that vaccination can effectively prevent and control swine epidemic diarrhea.

[0004] ST cells (porcine testicular cells) are an ideal host for the proliferation of porcine epidemic diarrhea virus (PEDV). Therefore, ST cells are widely used in domestic vaccine production to proliferate PEDV for the production of porcine epidemic diarrhea vaccines. To achieve better proliferation effects and obtain virus products with higher titers and higher purity, the modification of ST cells is one of the key research areas and hot topics in the field. Currently, the modification of ST cells mainly focuses on the construction of adherent and suspension growth cells. Summary of the Invention

[0005] The inventors of this invention discovered that the ability of host cells to infect and proliferate with viruses varies at different stages of cell division. ST cells in the G1 transition phase exhibit superior proliferative capacity against porcine epidemic diarrhea virus.

[0006] Further research revealed that the SUFU gene can regulate the division phase of ST cells, significantly increasing the number of ST cells in the G1 transition phase, thus potentially leading to ST cell lines with higher proliferation efficiency for porcine epidemic diarrhea virus.

[0007] Based on this, the present invention discloses SUFU gene knockout ST cells, named SUFU gene knockout ST cells-003, with accession number CGMCC NO: 46254, which was deposited on December 11, 2024 at the China General Microbiological Culture Collection Center (CGMCC), with the deposit address in Beijing, China.

[0008] Furthermore, this invention discloses an sgRNA targeting the SUFU gene, the nucleotide sequence of which is shown in SEQ ID NO: 1. This sequence (TTCCGCCAATCAACCCTCAG) successfully introduced a frameshift mutation at position 328aa in ST cells. Western blotting confirmed that the pSufu protein was completely eliminated.

[0009] In this invention, SUFU gene knockout ST cells were successfully constructed using CRISPR / Cas9 technology.

[0010] Furthermore, the present invention also discloses the application of the SUFU gene knockout ST cells in the production of porcine epidemic diarrhea virus vaccine.

[0011] The SUFU gene knockout ST cells constructed in this invention can increase the number of cells in the G1 phase, thereby providing a more suitable cell state for the proliferation and replication of porcine epidemic diarrhea virus. The single cell proliferation efficiency is high and the product purity is high, which is of great significance for the preparation of porcine epidemic diarrhea vaccine. Attached Figure Description

[0012] Figure 1 This is a schematic diagram of the frameshift mutation sequence of the SUFU gene.

[0013] Figure 2 wild-type ST cells and SUFU - / - Schematic diagram of ST cell SUFU gene detection results.

[0014] Figure 3 wild-type ST cells and SUFU - / - Schematic diagram of ST cell virus proliferation.

[0015] Figure 4 wild-type ST cells and SUFU - / - Comparison chart of PEDV titer data in ST cell culture.

[0016] Figure 5 wild-type ST cells and SUFU - / - A schematic diagram showing the cell count of ST cells at different stages of division.

[0017] Figure 6 This is a graph showing the proportion of wild-type ST cells and SUFU- / -ST cells at different stages of division. Detailed Implementation

[0018] To better understand this invention, we will further illustrate it below with reference to specific embodiments. Embodiment 1: Design and Screening of SUFU-Targeting sgRNAs

[0019] (1) sgRNA design and synthesis

[0020] Three sgRNA sequences were chemically synthesized in vitro based on the SUFU genome sequence of porcine testicular cells. The sequence information is as follows:

[0021]

[0022]

[0023] Then we will proceed as follows:

[0024] (2) Transfection

[0025] (i) Cell preparation: One day in advance, plate the cells in T25 cell culture flasks, controlling the cell density to be between 60% and 80% before transfection; set up 3 experimental groups, with each sample containing approximately 1-5 × 10⁶ cells. 6 indivual;

[0026] (ii) Cell electroporation: Add the corresponding sgRNA and protein to each electroporation well, mix well, and then transfer the cells to the electroporator using an electroporator. After electroporation, gently transfer the cells from the electroporator to a six-well plate containing complete culture medium for culture.

[0027] (iii) Change the solution after the solution has adhered to the wall for 6 hours;

[0028] (iv) After the cells grew for 48 hours by electroporation, the genome was extracted, amplified by PCR, and sent for sequencing analysis to determine the editing efficiency.

[0029] (3) Single clone selection and identification (i) The knockout hybrid cell line with editing effect was infinitely diluted and passaged into two 96-well plates, so that each well contains only one cell.

[0030] (ii) The isolated single cells are cultured. After a period of time, the single cells will gradually form cell clusters. When the cell coverage reaches more than 80%, the cells are passaged into 24-well plates.

[0031] (iii) When the coverage of monoclonal cells in the 24-well plate reaches more than 80%, the cells are further cultured and a portion of the cells are taken for genome sequencing and identification.

[0032] (iv) The genomes of monoclonal cells with editable sequencing effects were coupled into T-cells and further sequenced to identify the genotype.

[0033] The results are as follows Figure 1 As shown, the sequence SUFU-sgRNA3 successfully inserted a cysteine ​​residue at amino acid position 328 of the SUFU gene, forming a frameshift mutation; Figure 2 As shown in the WB verification results, compared with wild-type ST cells, SUFU gene knockout ST cells cannot express SUfu protein, confirming that the knockout was successful.

[0034] Example 2: Proliferation of porcine epidemic diarrhea virus in ST cell lines with SUFU gene knockout

[0035] Wild-type (WT) and SUFU gene knockout ST cells were introduced into T25 cells. After the cells reached 99% confluence, PEDV was introduced with the help of 10 μg / mL trypsin at a multiplicity of infection (MOI) of 1. After 24 hours, the cells were freeze-thawed once with the culture medium to obtain the virus solution to be tested.

[0036] ST cells were seeded into 96-well plates and inoculated with PEDV when the cell confluence reached 99%. The virus was serially diluted 10-fold in sterile 1.5 mL EP tubes with DMEM medium containing 10 μg / mL trypsin. 100 μL of each dilution was seeded into each well of a 96-well plate, with eight replicates per dilution. Normal ST and IPEC-J2 cells were used as control groups. The 96-well plates were incubated at 37°C in a 5% CO2 incubator for 48 h. Cytopathic effect (CPE) was observed and counted. The TCID of the virus was determined using the Reed-Muench method. 50 .

[0037] The results are as follows Figure 3 and Figure 4 As shown, compared with WT, knocking out the SUFU gene significantly increased the ability of ST cells to proliferate PEDV, with an average increase in viral titer of more than 2.

[0038] Example 3: Cell cycle analysis of SUFU gene knockout ST cell lines

[0039] WT and SUFU gene knockout ST cells were fixed overnight in 70% ethanol at -20°C, washed with phosphate-buffered saline (PBS) and resuspended. Cells were stained with PI at room temperature for 30 min. Cell cycle distribution data were collected using an Accuri™ C6 flow cytometer and analyzed and plotted using FlowJo software.

[0040] The results are as follows Figure 5 and Figure 6 As shown, the proportion of G1 phase cells in SUFU gene knockout ST cells was significantly higher than that in wild-type ST cells, suggesting that the increased proliferation capacity of SUFU gene knockout ST cells compared to wild-type PEDV is due to cell cycle arrest.

[0041] The above describes specific embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications are also considered to be within the scope of protection of the present invention.

Claims

1. SUFU gene knockout ST cells, with accession number CGMCC NO: 46254.

2. The sgRNA targeting the SUFU gene, the nucleotide sequence of which is shown in SEQ ID NO:

1.

3. The use of the SUFU gene knockout ST cells as described in claim 1 in the production of porcine epidemic diarrhea virus vaccine.