Application of lactoferrin in prevention of porcine epidemic diarrhea

By using lactoferrin to bind to HSPG to inhibit PEDV replication and promote DC maturation and T lymphocyte proliferation, the problem of poor immune protection in newborn piglets is solved, and an effective control measure for PED is provided.

CN118743749BActive Publication Date: 2026-07-24JIANGSU AGRI ANIMAL HUSBANDRY VOCATIONAL COLLEGE +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410955411.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-17
Publication Date
2026-07-24
Estimated Expiration
2044-07-17

Smart Images

  • Figure CN118743749B_ABST
    Figure CN118743749B_ABST
Patent Text Reader

Abstract

The present application relates to the field of molecular biology, in particular to the application of lactoferrin in preventing porcine epidemic diarrhea. The present application provides the application of lactoferrin in preventing porcine epidemic diarrhea, wherein the lactoferrin inhibits the replication of PEDV by combining with HSPG, and the PEDV promotes its own replication by adhering to the cell surface HSPG. The present application discloses the antiviral effect of lactoferrin in colostrum of sows and its molecular mechanism, which provides a theoretical basis and a new direction for the comprehensive prevention and control of PED of newborn piglets.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to the application of lactoferrin in the prevention of porcine epidemic diarrhea. Background Technology

[0002] Porcine epidemic diarrhea (PED) is a gastrointestinal infectious disease caused by porcine epidemic diarrhea virus (PEDV), characterized primarily by watery diarrhea. PED is characterized by high morbidity, rapid spread, and high mortality; the mortality rate in newborn piglets infected with PEDV can reach as high as 90%. Currently, most vaccines for PED on the market are administered via intramuscular injection. However, because the immune systems of newborn piglets are not fully developed, vaccination cannot provide timely immune protection, making them highly susceptible to PEDV infection.

[0003] Sow milk is classified into colostrum and mature milk based on the timing of its secretion. Compared to mature milk, colostrum is rich in immune factors, including antibodies, immune cells, cytokines, and antiviral proteins. Lactoferrin (LF) is an iron-binding glycoprotein mainly distributed in mammalian colostrum. LF not only blocks viral invasion but also regulates the body's immune response. Studies have shown that bovine LF can inhibit PEDV replication. Although LF affects PEDV replication, its mechanism of action against PEDV infection remains unclear. Summary of the Invention

[0004] The purpose of this invention is to address the above-mentioned shortcomings of the prior art by providing an application of lactoferrin in the prevention of porcine epidemic diarrhea, wherein the lactoferrin inhibits PEDV replication by binding to HSPG.

[0005] Furthermore, the PEDV promotes its own replication by adhering to HSPGs on the cell surface.

[0006] Furthermore, the sequences of lactoferrin and its mutants are shown in SEQ ID NO: 1-3, respectively.

[0007] Furthermore, the lactoferrin can induce the maturation of dendritic cells (DCs).

[0008] Furthermore, the lactoferrin can positively regulate the ability of dendritic cells (DCs) to induce T lymphocyte proliferation.

[0009] Compared with the prior art, the present invention has the following beneficial effects: This invention demonstrates that lactoferrin, by binding to HSPG to inhibit PEDV replication, can induce the maturation of dendritic cells (DCs) and positively regulate the ability of DCs to induce T lymphocyte proliferation. It reveals the antiviral effect and molecular mechanism of lactoferrin in sow colostrum, providing a theoretical basis and new direction for the comprehensive prevention and control of PED in newborn piglets. Attached Figure Description

[0010] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, and the advantages of the present invention in the above and / or other aspects will become clearer.

[0011] Figure 1 The results of verifying the effect of lactoferrin on PEDV replication are shown in Figure A. A schematic diagram of the antiviral effect of lactoferrin after pre-incubation with cells. BD shows the viral RNA level in cells and viral titer in supernatant of different groups detected by RT-qPCR and plaque formation assay, respectively. E shows the viral RNA load in feces of piglets in each group detected by RT-qPCR. FH shows the viral RNA load and protein expression level in jejunal and ileal tissues of piglets in each group detected by RT-qPCR and Western blot. Figure 2 A is a schematic diagram showing how lactoferrin can effectively inhibit PEDV replication; A is a schematic diagram showing the detection of the antiviral effect of lactoferrin during viral adsorption, invasion and replication; B and C are the results of detecting the viral RNA level and viral titer in the supernatant of different groups of cells by RT-qPCR and plaque formation assay, respectively. Figure 3 The results of verifying the effect of lactoferrin on cell viability are shown in Figure A; Figure A shows the effect of different concentrations of lactoferrin on cytotoxicity detected by the CCK-8 assay kit, and Figure B shows the effect of different concentrations of lactoferrin inhibitors on cytotoxicity detected by the CCK-8 assay kit. Figure 4 This diagram illustrates how PEDV promotes its own replication by adhering to HSPG on the cell surface; A shows the distribution of HSPG in Vero E6 cells as detected by immunofluorescence; B shows the interaction between PEDV and HSPG as detected by immunofluorescence; C shows the cytotoxicity of different concentrations of HSPG on Vero E6 cells; DE shows the viral RNA level and viral titer in the supernatant of different groups of cells as detected by RT-qPCR and plaque formation assay, respectively. Figure 5Figure A shows the results of the effects of lactoferrin and its inhibitors on cytotoxicity. Figure B shows the distribution of HSPG in Vero E6 cells as detected by immunofluorescence. Figure C shows the predicted three-dimensional structures of HSPG and LF by homology modeling. HSPG is represented as a dark blue cartoon model, and LF is shown as a cyan cartoon model. Figure D shows the key binding sites of HSPG and LF proteins, which are shown as stick structures of the corresponding colors. Figure D shows the classification based on the interactions of functional residues, including hydrogen bonding interactions and electrostatic interactions, and scores them, selecting the forces with higher scores. Figure 6 Figure 1 shows the effect of lactoferrin mutants on PEDV replication; AB shows the effect of different concentrations of lactoferrin inhibitors on PEDV replication detected by plaque formation assay and RT-qPCR, respectively; C is a schematic diagram of LF mutants; DF shows the viral RNA level, viral titer in supernatant and viral load in cells of different LF mutant treatment groups detected by plaque formation assay, RT-qPCR and immunofluorescence. Figure 7 Figure 1 shows the effect of lactoferrin on DC phenotype; A is a schematic diagram of different concentrations of LF acting on DCs; BC shows the expression levels of MHCII, CD40 and CD80 on the surface of DCs detected by flow cytometry; D shows the levels of IL-1β and IL-6 mRNA in cells of different groups and the concentration of IL-6 in the supernatant detected by RT-qPCR and ELISA, respectively. Figure 8 A is a schematic diagram showing how lactoferrin can enhance the ability of DCs to induce T lymphocyte proliferation; A is a schematic diagram showing the effect of different concentrations of LF on T lymphocyte proliferation activity; BC is the flow cytometry detection of T lymphocyte proliferation activity; D is the statistical mean fluorescence intensity and the significant differences between different treatment groups were analyzed by one-way ANOVA. Detailed Implementation

[0012] The technical solution of the present invention will be described below with reference to the embodiments. However, the present invention is not limited to the embodiments described below. Unless otherwise specified, the experimental methods and detection methods described in the embodiments are conventional methods; unless otherwise specified, the reagents and materials can be purchased commercially.

[0013] This example demonstrates that lactoferrin affects the replication of PEDV.

[0014] 1.1 Virus strains and cell lines Wild-type strain PEDV Zhejiang 08 and its susceptible Vero E6 cells were donated by Professor Yang Qian of Nanjing Agricultural University. The cells were grown and maintained in high-glucose DMEM medium (purchased from Nanjing Senbega Biotechnology Co., Ltd., catalog number: BC-M-005) supplemented with 10% (V / V) fetal bovine serum (purchased from Nanjing Senbega Biotechnology Co., Ltd., catalog number: BC-SE-FBS01).

[0015] 1.2 Experimental Animals and Grouping All pigs used in this experiment were three-way crossbred pigs (Duroc × Landrace × Large White), purchased from a pig farm of the Jiangsu Academy of Agricultural Sciences. The pig herd was negative for PEDV, porcine reproductive and respiratory syndrome virus (PRRSV), porcine respiratory coronavirus (PRCV), transmissible gastroenteritis virus (TGEV), and porcine circovirus (PCV) type 2 antibody serum. Twenty-five healthy newborn piglets were randomly selected from the farm and fed commercially available milk powder (purchased from AnYou Biotechnology Group Co., Ltd., product number: 10084431528874) for 7 consecutive days. Piglets were then challenged with PEDV (10⁴ PFU / mL) at day 5. One hour before PEDV challenge, they were divided into five groups: Control group (piglets fed 1 mL PBS); Positive control group (piglets fed 1 mL PBS); Lactoferrin group 1 (LF1): piglets fed 1 mL lactoferrin (100 mg / kg); Lactoferrin group 2 (LF2): piglets fed 1 mL lactoferrin (200 mg / kg); Lactoferrin group 3 (LF3): piglets fed 1 mL lactoferrin (400 mg / kg). All lactoferrin was a commercially available product (purchased from Leshengyuan Biotechnology Co., Ltd., catalog number: 201-788-0). All newborn piglets were euthanized 48 hours after infection. Fecal samples were collected from piglets at 0, 6, 12, 24, 36, and 48 hours post-infection, and the duodenum, jejunum, and ileum were collected for relevant tests.

[0016] 1.3 CCK8 assay to detect the cytotoxic effects of heparan sulfate proteoglycans, lactoferrin, and their inhibitors This study used the CCK8 kit (purchased from Yisheng Biotechnology Co., Ltd., catalog number: 40203ES60) to detect the cytotoxicity of heparan sulfate proteoglycan (HSPG), lactoferrin, and its inhibitors. Specific operating procedures were performed according to the kit instructions.

[0017] 1.4 Effects of HSPG or lactoferrin on PEDV replication Different concentrations of HSPG (10, 100, 250, and 500 ug / mL) or lactoferrin (100, 250, and 500 ug / mL) and lactoferrin inhibitors (purchased from Beijing Bio-Sens Biotechnology Co., Ltd., catalog number: bs-5810P) (1, 25, and 50 uM) were first mixed with Vero E6 cells and incubated at 37ºC for 1 h. The cells were then washed with DMEM medium to remove residual whey. Then, PEDV (10... 4 Cells were seeded with PFU / mL and cultured at 4°C and 37°C for 1 h each. Finally, the cells were washed with DMEM medium to remove residual virus, and 1 mL of DMEM medium was added to each well. After 24 h, the supernatant and RNA samples were collected for plaque reduction neutralization assay and RT-qPCR detection. PEDV load in cells was detected by relative quantitative PCR. GAPDH was used as an internal control, and the PEDV-N gene was used as the target gene for amplification; primer sequences are shown in Table 1.

[0018] Table 1 Primer sequence listing 1.5 Detection of PEDV viral load in piglet feces and tissues A sterile cotton swab was used to collect a swab containing feces from the anal mucosa of piglets. The swab was then centrifuged at 12,000 rpm for 15 min, and the supernatant was collected. Next, piglet tissue was ground and centrifuged, and the supernatant was collected. Then, 500 μL of Trizol reagent (Thermo Fisher Scientific (China) Co., Ltd., catalog number: 15596026CN) was added, and total RNA was extracted from cells using the conventional Trizol method. Before reverse transcription, the RNA concentration of different treatment groups was standardized. cDNA was then obtained by reverse transcription according to the HiScript™ QRT SuperMix kit (Nanjing Novizan Biotechnology Co., Ltd., catalog number: C214-01). The PEDV load in feces was determined using an absolute quantitative method, with a plasmid constructed from the PEDV-N gene sequence as a standard, and a standard curve was constructed. The PEDV load in the piglet intestine was detected by relative quantitative PCR. GAPDH was used as an internal control, and the PEDV-N gene was used as the target gene for amplification. Primer sequences are shown in Table 1.

[0019] 1.6 Data Analysis All experimental results are expressed as mean ± standard deviation (mean ± SD). SPSS 17.0 software was used for statistical analysis of the experimental data. One-way ANOVA was used to analyze the significance of differences. Statistical significance was defined as: * indicating p < 0.05, ** indicating p < 0.01, and ns indicating no significant difference.

[0020] 1.7 Results Analysis Figure 1 A illustrates the replication process of PEDV, which is divided into three stages: adsorption, invasion, and replication. Figure 2 AC results indicate that incubating cells with lactoferrin before inoculating them with the virus effectively inhibits PEDV replication. Therefore, this invention hypothesizes that lactoferrin affects PEDV replication through its interaction with cells.

[0021] First, the effect of lactoferrin on cell viability was verified using the CCK-8 assay, and the results are as follows: Figure 3 As shown in Figure A, this indicates that different concentrations of lactoferrin are not toxic to cells. Secondly, lactoferrin was added during the adsorption phase of the in vitro experiment, and the results are as follows... Figure 1 As shown in Figure BD, lactoferrin can inhibit PEDV replication, and the higher the dose of lactoferrin added, the better its antiviral effect, exhibiting a dose-dependent relationship. In in vivo experiments, piglets were orally administered different doses of lactoferrin before being infected with PEDV. Figure 1 E represents the results of viral load detection in feces, indicating that piglets in the oral lactoferrin group shed significantly less virus 36 and 48 hours after infection. Furthermore, this invention detected viral distribution in the piglet intestine using RT-qPCR. Figure 1 The results showed that PEDV was mainly present in the jejunum and ileum of piglets, and the viral RNA content in the jejunum and ileum of piglets in the lactoferrin group was significantly lower than that in the PBS group. Figure 1 GH represents the results of the WB test, indicating that the PEDV protein content in the jejunum and ileum of piglets in the lactoferrin group was relatively low.

[0022] This example demonstrates that PEDV promotes viral replication by binding to heparan sulfate proteoglycan (HSPG) on the cell surface.

[0023] 2.1 Co-location of PEDV and HSPG Vero cells were seeded onto cell culture slides and incubated with PEDV after reaching confluence. After 2 hours, the cells were washed and blocked with 5% (m / v) BSA. After washing five times with PBS, antibodies against HSPG (Rabbit Anti-HSPG) and anti-PEDV N protein were added, and the cells were incubated overnight at 4°C. After washing with PBS, antibodies against Alexa Fluor 594 goat anti-rabbit IgG and FITC-goat anti-mouse IgG were added, and the cells were incubated for 2 hours. After washing five times with PBS, DAPI (purchased from Beijing Solarbio Science & Technology Co., Ltd., catalog number: C0065) was added to stain the cell nuclei. Subsequently, the co-localization of PEDV and HSPG was observed using a fluorescence confocal microscope.

[0024] 2.2 Colocalization of PEDV and lactoferrin Lactoferrin was first incubated with Vero cells at 37ºC for 1 h, followed by washing with DMEM medium. Then PEDV (10... 4 Cells were seeded with PFU / mL and cultured at 4℃ and 37℃ for 1 h each. After washing, they were blocked with 5% (M / V) BSA. Cells were stained with antibodies against lactoferrin and HSPG (Rabbit Anti-HSPG) and corresponding secondary antibodies (with fluorescent labels). The colocalization of lactoferrin and HSPG on the cell surface was verified by fluorescence confocal microscopy.

[0025] 2.3 Results Analysis HSPG is located on the cell surface, and viruses must attach to it before invading the cell. Figure 4 A shows the distribution of HSPG in Vero E6 cells as detected by immunofluorescence. Anti-HSPG antibody appears red, and cell nuclei are stained with DAPI (blue) (scale bar = 100 μm). Figure 4 B shows the immunofluorescence assay used to detect the interaction between PEDV and HSPG. Anti-HSPG antibody appeared red, and anti-PEDV-N antibody appeared green. Cell nuclei were stained with DAPI (blue) (scale bar = 20 μm), revealing a large number of HSPGs distributed on the surface of Vero cells, and HSPGs co-localizing with PEDV. Heparin is an inhibitor of HSPGs; therefore, heparin was used to verify the effect of HSPGs on PEDV replication. First, the effect of different concentrations of heparin on cell viability was detected using a CCK-8 assay, and the results are as follows... Figure 4 As shown in Figure C, this indicates that high concentrations of heparin are not toxic to cells. Secondly, Figure 4The results of RT-qPCR and plaque assays in DE showed that heparin can affect PEDV replication and inhibit it in a dose-dependent manner. These results indicate that PEDV promotes its own replication by adhering to HSPGs on the cell surface.

[0026] This example demonstrates that lactoferrin inhibits PEDV replication by binding to HSPG.

[0027] 3.1 Screening of interaction sites between lactoferrin and HSPG To further determine the binding site of lactoferrin and HSPG, this study predicted their three-dimensional structures through homology modeling and then used molecular docking (protein-protein) to find the optimal binding conformation of lactoferrin and HSPG. This experiment was performed by the company. Next, based on the molecular docking results, a specific site mutant of lactoferrin was constructed. The specific steps of protein mutation were performed according to the Mut Express® II Fast Mutagenesis Kit V2 instructions. The mutant was incubated with Vero cells at 37ºC for 1 h, followed by washing with DMEM medium. Then, PEDV (10... 4 Cells were seeded with PFU / mL and cultured at 4°C and 37°C for 1 h each. Finally, the cells were washed with DMEM medium to remove residual virus, and 1 mL of DMEM medium was added to each well. After 24 h, the supernatant and RNA samples were collected for plaque reduction neutralization assays and RT-qPCR detection.

[0028] 3.2 Plaque Reduction and Neutralization Test Vero E6 cells were seeded into 12-well cell culture plates and cultured at 37°C with 5% (V / V) CO2 until approximately 90% (V / V) confluence was reached for subsequent experiments. First, the supernatants from different treatment groups were serially diluted 10-fold with blank DMEM medium. The cell surface was washed three times with blank DMEM medium, and the diluted supernatant was seeded onto the cells. The cells were then incubated at 37°C with 5% (V / V) CO2 for 1 h. After incubation, the diluent was washed away with blank DMEM medium. A mixture of 2×DMEM and 1.6% (M / M) sterile low-melting-point agarose at a 1:1 ratio was applied to the cells and allowed to solidify. The cells were then incubated at 37°C with 5% (V / V) CO2. Once visible plaques have formed (approximately 48-72 h), add 4% (V / V) paraformaldehyde to each well to fix the cells at room temperature. After 1 h, discard the paraformaldehyde and gel block on the cell surface, and stain with 0.5% (M / V) crystal violet for 2 h. Then wash away the crystal violet with running water, air dry, count the number of plaques, and take a picture.

[0029] 3.3 Results Analysis Figure 5 A shows the distribution of HSPG in Vero E6 cells as detected by immunofluorescence. Anti-HSPG antibody appears red, and anti-lactoferrin (LF) antibody appears green. Cell nuclei are stained with DAPI (blue) (scale bar = 20 μm), indicating co-localization of lactoferrin and HSPG. To further determine the interaction between lactoferrin and HSPG, molecular docking was used to predict their binding sites. Figure 5 Figure B shows the protein-protein docking results after predicting the 3D structures of lactoferrin and HSPG through homology modeling. HSPG is represented by a dark blue cartoon model, and LF is displayed as a cyan cartoon model. Figure 5 C represents the optimal binding conformation of lactoferrin and HSPG, with key binding sites for HSPG and LF proteins shown as stick structures of corresponding colors. Figure 5 D represents the protein-protein interaction analysis results. This invention identified all functional residues and classified them according to their interactions. In hydrogen bond interactions, multiple groups of residues exist between HSPG and LF for hydrogen bond formation, such as GLU2250, TYR2395, and GLN1930 of HSPG and PRO1963, PHE1641, and GLN1607 of LF. However, LYS1910 and GLU1575 form an electrostatic interaction. Under the influence of these interactions, the HSPG-LF score is -336.95. These results indicate that lactoferrin can bind to HSPG, and also demonstrate that lactoferrin can compete with PEDV for binding to HSPG on the cell surface.

[0030] This study used lactoferrin inhibitors and constructed lactoferrin mutants to verify whether lactoferrin affects PEDV replication by binding to HSPG. First, the effect of lactoferrin inhibitors on cell viability was verified using a CCK-8 assay, and the results are as follows: Figure 3 As shown in Figure B, different concentrations of lactoferrin inhibitors are not toxic to cells. Figure 6 AB represents the results of RT-qPCR and plaque assays, indicating that the addition of lactoferrin inhibitors to cells promotes PEDV replication. To further determine whether lactoferrin affects PEDV replication via HSPG, such as... Figure 6 As shown in C, mutants of lactoferrin were constructed based on the results of molecular docking. The sequences of lactoferrin and its mutants are shown in SEQ ID NO: 1-3, respectively. Figure 6 DE used three constructed mutants to verify their effect on PEDV replication. The results showed that lactoferrin with point mutations at the PRO1963 (L1963) and PHE1641 (L1641) sites could not inhibit PEDV replication. Figure 6F shows the immunofluorescence results. The anti-PEDV-N antibody appears green, and the cell nuclei are stained with DAPI (blue) (scale bar = 100 μm). The fluorescence results are consistent with those of RT-qPCR and plaque assays. This result indicates that lactoferrin inhibitors or mutations at related sites prevent them from binding to HSPG, thereby promoting PEDV replication.

[0031] The nucleotide sequence of lactoferrin is shown in SEQ ID NO: 1: atgaagctct tcatccccgc cctgctgttc ctcgggacac ttggactgtg tctggctgcccctaagaaag gggttcgatg gtgtgtcata tccacagcag agtattcaaa atgccgccag tggcaatcaaagataagaag aactaatccc atgttctgca taaggagggc ttctcccact gactgtatcc gggccatcgcggcaaaaagg gcagatgctg tgacccttga tggtggtttg gtgtttgaag cagaccagta caaactgcggccggtagcag cggagatcta cgggacagaa gagaatcccc aaacctacta ttatgctgtg gctgtagtgaagaaaggttt caactttcag ctgaaccagc tacaaggtcg aaagtcctgc cacacaggcc ttggcagggtctgccgggtgg aatatcccta tagggttact tcgccggttc ttggactggg cagggccacc tgagcccctccagaaagct tggccaaatt cttctctcag agctgtgtgc cctgcgcaga tggaaatgcg tatcccaacctgtgtcagct gtgcataggg aagggaaag ataaatgtgc ttgttcctcc caggaaccgt attttggctattccggtgcc ttcaactgtc tgcacaaagg gattggagat gtggcttctg tcaaggagag tacagtgtttgagaacctgc cacagaaggc tgaccgggac aaatacgagc tactctgccc agaatact cgaaagccagtggaagcatt cagggagtgc caccttgccc gggtcccttc tcatgctgtt gtggcccgaa gggtgaatggcaagggagaac tccatctggg agcttctcta ccagtcacag aaaaagtttg gaaaaagcaa tccacaggagttccagctct ttggctctcctggtcagcag aaggacctcc tgtttagaga tgcattacc gggtttgagatcccctc aaagatagat tctaagctgt acctggcct cccgtacctt actgccatc agggctgagggaacggca gcggaggtgg gggcgcggctg ggcgaccggtg agaggagctgcgcaagtgcc ggcagtggag cagccagagc agccagaacc tgaactgcag cctggcctcc accaccgaggactgcatcgt ccaggtgctg aaggagaag ctgatgctat gagcttggat ggaggattta tctacactgcggtg gggcgtgt agagaaccaa aaatctcgcc aaagcagtag ctcagactgtgtgcatagac siacacaagg gtatttgcc gtggcggttg tcaggaagc aaatggtggt atcacctggactgtgag agcacgag tcctgccaca ctgctgtgga caggactgcgcct aaccagacag gctcctgcaa atttgacgaa ttctttagtc aaagctgtgc tcctggtctcagccgggat ccaatctg tgcactgtgt gtgcccagtagtaatgag atactgacgt acttcaggggt ccttcaggggt atgtggcgtttgtgaaggat gtcactgtct tggacacac gatggacag aacacagaag agtgggccag ggaattgaggtcagatgact tgagctgct gtgccttgat ggcaccagga agcctgtgac tgaggctcag aactgtcacctggctgtgtggcag ccctcggaagga aaaggcagca caggtggaac aggtgctactcactgagcag gctcagtttg gaagatacgg aaaagactgc ccggacaagt tttgcttgtt cctgtctgagaccaaaaacc ttctgttcaa cgacaacacg gagtgtctgg cccaactcca aggcaaaaca acatacgaaaaatatttggg atcagagtat gtcacagcca tcgctaacct gaaacagtgc tcagtctccc cgcttctgggagcctgtgcc ttcatgatga ggtaa. (Including the start codon atg and the stop codon taa).

[0032] The nucleotide sequence of the lactoferrin mutant PRO1963 is shown in SEQ ID NO: 2: atgaagctct tcatccccgc cctgctgttc ctcgggacac ttggactgtg tctggctgcccctaagaaag gggttcgatg gtgtgtcata tccacagcag agtattcaaa atgccgccag tggcaatcaaagataagaag aactaatccc atgttctgca taaggagggc ttctcccact gactgtatcc gggccatcgcggcaaaaagg gcagatgctg tgacccttga tggtggtttg gtgtttgaag cagaccagta caaactgcggccggtagcag cggagatcta cgggacagaa gagaatcccc aaacctacta ttatgctgtg gctgtagtgaagaaaggttt caactttcag ctgaaccagc tacaaggtcg aaagtcctgc cacacaggcc ttggcagggtctgccgggtgg aatatcccta tagggttact tcgccggttc ttggactggg cagggccacc tgagcccctccagaaagct tggccaaatt cttctctcag agctgtgtgc cctgcgcaga tggaaatgcg tatcccaacctgtgtcagct gtgcataggg aagggaaag ataaatgtgc ttgttcctcc caggaaccgt attttggctattccggtgcc ttcaactgtc tgcacaaagg gattggagat gtggcttctg tcaaggagag tacagtgtttgagaacctgc cacagaaggc tgaccgggac aaatacgagc tactctgccc agaatact cgaaagccagtggaagcatt cagggagtgc caccttgccc gggtcccttc tcatgctgtt gtggcccgaa gggtgaatggcaagggagaac tccatctggg agcttctcta ccagtcacag aaaaagtttg gaaaaagcaa tccacaggagttccagctct ttggctctcctggtcagcag aaggacctcc tgtttagaga tgcattacc gggtttgagatcccctc aaagatagat tctaagctgt acctggcct cccgtacctt actgccatc agggctgagggaacggca gcggaggtgg gggcgcggctg ggcgaccggtg agaggagctgcgcaagtgcc ggcagtggag cagccagagc agccagaacc tgaactgcag cctggcctcc accaccgaggactgcatcgt ccaggtgctg aaggagaag ctgatgctat gagcttggat ggaggattta tctacactgcggtg gggcgtgt agagaaccaa aaatctcgcc aaagcagtag ctcagactgtgtgcatagac siacacaagg gtatttgcc gtggcggttg tcaggaagc aaatggtggt atcacctggactgtgag agcacgag tcctgccaca ctgctgtgga caggactgcgcct aaccagacag gctcctgcaa atttgacgaa ttctttagtc aaagctgtgc tcctggtctcagccgggat ccaatctg tgcactgtgt gtgcccagtagtaatgag atactgacgt acttcaggggt ccttcaggggt atgtggcgtttgtgaaggat gtcactgtct tggacacac gatggacag aacacagaag agtgggccag ggaattgaggtcagatgact tgagctgct gtgccttgat ggcaccagga agcctgtgac tgaggctcag aactgtcacctggctgtgtggcag ccctcggaagga aaaggcagca caggtggaac aggtgctactcactgagcag gctcagtttg gaagatacgg aaaagactgc ctggacaagt tttgcttgtt cctgtctgagaccaaaaacc ttctgttcaa cgacaacacg gagtgtctgg cccaactcca aggcaaaaca acatacgaaaaatatttggg atcagagtat gtcacagcca tcgctaacct gaaacagtgc tcagtctccc cgcttctgggagcctgtgcc ttcatgatga ggtaa. (Including the start codon atg and the stop codon taa).

[0033] The nucleotide sequence of the lactoferrin mutant PHE1641 is shown in SEQ ID NO: 3: atgaagctct tcatccccgc cctgctgttc ctcgggacac ttggactgtg tctggctgcccctaagaaag gggttcgatg gtgtgtcata tccacagcag agtattcaaa atgccgccag tggcaatcaaagataagaag aactaatccc atgttctgca taaggagggc ttctcccact gactgtatcc gggccatcgcggcaaaaagg gcagatgctg tgacccttga tggtggtttg gtgtttgaag cagaccagta caaactgcggccggtagcag cggagatcta cgggacagaa gagaatcccc aaacctacta ttatgctgtg gctgtagtgaagaaaggttt caactttcag ctgaaccagc tacaaggtcg aaagtcctgc cacacaggcc ttggcagggtctgccgggtgg aatatcccta tagggttact tcgccggttc ttggactggg cagggccacc tgagcccctccagaaagct tggccaaatt cttctctcag agctgtgtgc cctgcgcaga tggaaatgcg tatcccaacctgtgtcagct gtgcataggg aagggaaag ataaatgtgc ttgttcctcc caggaaccgt attttggctattccggtgcc ttcaactgtc tgcacaaagg gattggagat gtggcttctg tcaaggagag tacagtgtttgagaacctgc cacagaaggc tgaccgggac aaatacgagc tactctgccc agaatact cgaaagccagtggaagcatt cagggagtgc caccttgccc gggtcccttc tcatgctgtt gtggcccgaa gggtgaatggcaagggagaac tccatctggg agcttctcta ccagtcacag aaaaagtttg gaaaaagcaa tccacaggagttccagctct ttggctctcctggtcagcag aaggacctcc tgtttagaga tgcattacc gggtttgagatcccctc aaagatagat tctaagctgt acctggcct cccgtacctt actgccatc agggctgagggaacggca gcggaggtgg gggcgcggctg ggcgaccggtg agaggagctgcgcaagtgcc ggcagtggag cagccagagc agccagaacc tgaactgcag cctggcctcc accaccgaggactgcatcgt ccaggtgctg aaggagaag ctgatgctat gagcttggat ggaggattta tctacactgcggtg gggcgtgt agagaaccaa aaatctcgcc aaagcagtag ctcagactgtgtgcatagac siacacaagg gtatttgcc gtggcggttg tcaggaagc aaatggtggt atcacctggactgtgag agcacgag tcctgccaca ctgctgtgga caggactgcgcct aaccagacag gctcctgcaa atttgacgaa ttctttagtc aaagctgtgc tcctggtctcagccgggat ccaatctg tgcactgtgt gtgcccagtaatgag atactgacgt acttaggggt ct tacaggggt atgtggcgtttgtgaaggat gtcactgtct tggacacac gatggacag aacacagaag agtgggccag ggaattgaggtcagatgact tgagctgct gtgccttgat ggcaccagga agcctgtgac tgaggctcag aactgtcacctggctgtgtggcag ccctcggaagga aaaggcagca caggtggaac aggtgctactcactgagcag gctcagtttg gaagatacgg aaaagactgc ccggacaagt tttgcttgtt cctgtctgagaccaaaaacc ttctgttcaa cgacaacacg gagtgtctgg cccaactcca aggcaaaaca acatacgaaaaatatttggg atcagagtat gtcacagcca tcgctaacct gaaacagtgc tcagtctccc cgcttctgggagcctgtgcc ttcatgatga ggtaa. (Including the start codon atg and the stop codon taa).

[0034] This example demonstrates that lactoferrin promotes the maturation of porcine dendritic cells.

[0035] 4.1 Isolation of porcine dendritic cells Porcine bone marrow-derived mononuclear cells were selected and porcine dendritic cells (DCs) were obtained through in vitro induction culture. The specific experimental steps are as follows: After euthanizing piglets, the femur was separated and transferred to a sterile laminar flow hood, where it was sterilized for 5 min each in 75% (v / v) ethanol and physiological saline. It was then immersed in 2% penicillin-antibiotic 1640 culture medium for 15 min. A bone marrow aspiration was performed at the tip of the femur using a bone marrow puncture needle, and red bone marrow was aspirated using a 50 mL syringe. The bone marrow fluid was then diluted with culture medium, centrifuged (1500 rpm, 5 min), and cells were collected. Red blood cells were then lysed using erythrocyte lysis buffer and washed twice with culture medium. Next, 2 × 10⁶ cells were collected from each well. 6 Seed cells at a density of 1 / mL into 6-well cell plates, add culture medium containing porcine GM-CSF (20 ng / mL) and porcine IL-4 (10 ng / mL), and incubate in an incubator. Change the medium every 3 days. After 6 days of culture, collect all suspension and semi-adherent cells for later use.

[0036] 4.2 After maturation, dendritic cells (DCs) express increased levels of MHCII and CD40, as well as increased expression of the co-stimulatory molecule CD80. Figure 7AF results, obtained by flow cytometry analysis of the effects of lactoferrin on DC phenotype, showed that lactoferrin significantly promoted the expression of MHCII, CD40, and CD80 on the surface of DCs. This result indicates that lactoferrin can promote DC phenotypic maturation. Besides phenotypic changes, functionally mature DCs also secrete certain cytokines. Therefore, this invention uses RT-qPCR and ELISA to detect the production of cytokines in DCs after different treatments. Figure 7 As shown in G, lactoferrin significantly enhances the ability of dendritic cells (DCs) to secrete IL-1β and IL-6. This further demonstrates that lactoferrin can induce DC maturation.

[0037] This example demonstrates that lactoferrin enhances the antigen presentation ability of porcine dendritic cells.

[0038] 5.1 Isolation of porcine T lymphocytes Collecting porcine mesenteric lymph nodes and isolating lymphocytes: After removing the fat surrounding the mesenteric lymph nodes, the lymph nodes were placed in PBS (calcium-free) 2+ The mesenteric lymph nodes were placed in 50 mL centrifuge tubes containing collagenase IV and penicillin-streptomycin, and shaken vigorously to eliminate pathogens on the surface of the lymph nodes. The mesenteric lymph nodes were cut into small pieces and ground thoroughly. They were then placed in PBS (1:100) containing collagenase IV and digested at 37°C for 30 min. Digestion was terminated with serum, followed by filtration through a 70 μm filter membrane and centrifugation at 300 g for 10 min. After washing twice with culture medium, the cells were counted using a cell technology instrument.

[0039] 5.2 Effects of lactoferrin on DC phenotype and cytokine secretion Different concentrations of lactoferrin were added to pig dendritic cells (DCs), and DCs were collected after 24 h for cell phenotype detection. This study used three antibodies—APC-labeled MHC-II, PE-labeled CD40, and CD86—to detect the effects of lactoferrin on the phenotype of piglet DCs. Cells and supernatants were collected, and changes in IL-1β and IL-6 expression and levels were detected using RT-qPCR and ELISA kits. The relevant primer sequences are shown in Table 1.

[0040] 5.3 Mixed Lymphocyte Assay Isolated T lymphocytes were labeled with carboxyfluorescein succinimidyl ester (CFSE) and incubated at 37°C for 8 min. After washing twice with culture medium, the cells were mixed with dendritic cells (DCs) (treated with lactoferrin) at a ratio of 1:1 or 1:5 and cultured at 37°C for 5 days. The fluorescence intensity of CFSE was detected by flow cytometry to verify the effect of lactoferrin on the antigen presentation ability of DCs.

[0041] 5.4 Results Analysis Dendritic cells (DCs) are the most potent antigen-presenting cells, capable of uptake and presenting antigens. After uptake, DCs in the mucosa migrate to draining lymph nodes, activating naïve T lymphocytes and promoting lymphocyte proliferation. Therefore, this invention verifies the effect of lactoferrin on the antigen-presenting capacity of DCs through an in vitro mixed lymphocyte reaction. In vitro isolated and cultured DCs were stimulated with different concentrations of lactoferrin and LPS, and then mixed with in vitro isolated allogeneic lymphocytes (labeled with CFSE) at a ratio of 1:5 for a lymphocyte reaction. Figure 8 As shown in Figure A. Figure 8 The results of the BD assay for T lymphocyte proliferation showed that the proliferation level of T lymphocytes co-cultured with DCs treated with lactoferrin was significantly increased, and the higher the lactoferrin concentration, the higher the proliferation level. This indicates that lactoferrin can enhance the ability of DCs to induce T lymphocyte proliferation.

[0042] The embodiments of this invention are merely illustrative of specific implementation methods and are not intended to limit the scope of protection. Those skilled in the art can make modifications based on these embodiments; therefore, all equivalent changes or modifications made in accordance with the scope of this invention's patent claims fall within the scope of this invention's patent claims.

Claims

1. The application of lactoferrin in the preparation of drugs or feed additives for the prevention of porcine epidemic diarrhea, characterized in that, The nucleotide sequence of the lactoferrin is shown in SEQ ID NO: 1.