Compositions and methods for treating and preventing neurodegenerative diseases and disorders

By using TRIM protein activators, TRIM proteins are activated to reduce the aggregation of tau, α-Syn, SOD1, TDP-43, FUS/TLS, ataxia protein 1, Htt, Aβ42, and hnRNPA1, solving the treatment challenges of neurodegenerative diseases and achieving a significant reduction in tau aggregates and improved neurological function.

CN121729239APending Publication Date: 2026-03-24THE TRUSTEES OF THE UNIV OF PENNSYLVANIA
View PDF 42 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-05-23
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

Currently, there are no effective treatments or preventative methods for neurodegenerative diseases such as Alzheimer's disease and other tau protein disorders, especially due to limited understanding of protein quality control systems, which hinders the development of meaningful therapies.

Method used

Using activators containing one or more TRIM proteins, including compounds, proteins, peptides, peptide mimics, antibodies, small molecule compounds, nucleic acids, vectors, antisense nucleic acids, siRNA, shRNA, and guide RNA, TRIM proteins are activated to reduce the aggregation of tau, α-Syn, SOD1, TDP-43, FUS/TLS, ataxia protein 1, Htt, Aβ42, and hnRNPA1.

Benefits of technology

It significantly reduces tau aggregates, lowers the ratio of insoluble to soluble tau, reduces tau aggregates by more than 60%, and reduces tau aggregates by 90% within 6-8 days, improving symptoms of neurodegenerative diseases and preventing their progression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present invention relates to compositions and methods for facilitating the removal of misfolded proteins and protein aggregates. The compositions and methods may be used to treat or prevent neurodegenerative diseases or disorders associated with misfolded proteins or protein aggregates. In various embodiments, the compositions and methods relate to one or more TRIM protein activators.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Statement regarding federally funded research or development

[0002] This invention was carried out with government support from the National Institutes of Health (NIH) under grants TR001878 and CA243520. The government holds certain rights to this invention.

[0003] Citations of relevant applications

[0004] This application claims priority to U.S. Provisional Patent Application No. 63 / 503,835, filed May 23, 2023, the entire contents of which are incorporated herein by reference. Background Technology

[0005] Neurodegenerative diseases are pathologically and genetically associated with protein misfolding and aggregation, and subsequent neuronal loss (F. Chiti, CM Dobson, Annu Rev Biochem 75, 333-366, 2006). With an aging population, these diseases—including Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS), Huntington's disease (HD), and spinocerebellar ataxia (SCA)—have become major threats to human health and well-being in the modern world. However, there are currently no effective treatments for any of these diseases.

[0006] The transition of the microtubule-associated protein tau from its soluble monomeric state to its superphosphorylated and filamentous state is associated with a variety of neurodegenerative diseases, collectively known as tau proteinopathy (VM Lee, M. Goedert, JQ Trojanowski, Annu Rev Neurosci 24, 1121-1159, 2001; MG Spillantini, M. Goedert, Lancet Neurol 12, 609-622, 2013; J. Gotz, G. Halliday, RM Nisbet, Annu Rev Pathol 14, 239-261, 2019). These diseases include Alzheimer's disease (AD), Picker's disease (PiD), frontotemporal dementia (FTD), chronic traumatic encephalopathy (CTE), corticobasal degeneration (CBD), frontotemporal dementia and Parkinson's disease associated with chromosome 17 (FTDP-17), progressive supranuclear palsy (PSP), primary age-related tau proteinosis (PART), and aerobatic granulomatosis (AGD). Among these, Alzheimer's disease (AD) is the most common form of dementia (CL Masters et al., Nat Rev Dis Primers 1, 15056, 2015) (DS Knopman et al., Nat Rev Dis Primers 7, 33, 2021). It is estimated that there are currently 6 million people with AD in the United States, and this number is projected to reach nearly 13 million by 2050 (Alzheimers Dement, 2020). There is currently no treatment that can effectively prevent or slow the progression of Alzheimer's disease (AD) and other tau protein diseases, and the limited understanding of PQC systems, especially those in animal cells, hinders the development of meaningful therapies.

[0007] Therefore, there is a need in the art for improved compositions and methods for treating neurodegenerative diseases. The present invention addresses this unmet need. Summary of the Invention

[0008] In some embodiments, the present invention provides compositions for treating or preventing diseases or conditions associated with aggregations selected from one or more of the following: tau, α-synuclein (α-Syn), superoxide dismutase 1 (SOD1), TAR DNA-binding protein 43 (TDP-43), sarcoma fusion / liposarcoma translocation protein (FUS / TLS), ataxin 1, huntingtin (Htt), Aβ42, and heterogeneous ribonucleoprotein A1 (hnRNPA1), said compositions comprising one or more tripartite motifs (TRIMs). Activators of the level or activity of a TRIM protein, wherein one or more TRIM proteins are selected from one or more of the following: human TRIM10, TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM11, TRIM17, TRIM18, TRIM19, TRIM21, TRIM24, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM37, TRIM39, TRIM40, TRIM41, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM56, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, TRIM70, TRIM71, TRIM73, and TRIM77. In some embodiments, the activator is selected from one or more of the following: compounds (chemical compounds), proteins, peptides, peptide mimics, antibodies, ribozymes, small molecule compounds (small molecule chemical compounds), nucleic acids, vectors, antisense nucleic acids, siRNA, shRNA, and guide RNA.

[0009] In some embodiments, the disease or symptom is associated with the aggregation of tau; and the one or more TRIM proteins are selected from TRIM10, TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM11, TRIM12, TRIM17, TRIM18, TRIM19, TRIM21, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, and TRIM70.

[0010] In some embodiments, the disease or symptom is associated with the aggregation of α-Syn; and the one or more TRIM proteins are selected from TRIM10, TRIM2, TRIM3, TRIM17, TRIM18, TRIM19, TRIM26, TRIM29, TRIM30, TRIM31, TRIM36, TRIM41, TRIM42, TRIM43, TRIM46, TRIM49, TRIM55, TRIM56, TRIM63, TRIM64, TRIM68, TRIM69, TRIM70, TRIM71 and TRIM73.

[0011] In some embodiments, the disease or condition is associated with the aggregation of SOD1; and the one or more TRIM proteins are selected from TRIM10, TRIM11, TRIM24, TRIM36, and TRIM58.

[0012] In some embodiments, the disease or condition is associated with the aggregation of TDP-43; and the one or more TRIM proteins are selected from TRIM10, TRIM11, TRIM17, TRIM36, TRIM37, TRIM40, TRIM49 and TRIM55.

[0013] In some embodiments, the disease or condition is associated with the aggregation of FUS / TLS, ataxia protein 1, Htt, Aβ42, and hnRNPA1; and the one or more TRIM proteins are TRIM10.

[0014] In some embodiments, the activator of the TRIM protein is a peptide containing the amino acid sequence of the TRIM protein or a functional variant thereof.

[0015] In some implementations, the activator of the TRIM protein is a nucleic acid encoding the TRIM protein or a functional variant thereof.

[0016] In some embodiments, the activator of the TRIM protein is a vector containing nucleic acid encoding the TRIM protein or a functional variant thereof. In some embodiments, the vector is a virus. In some embodiments, the virus is an adeno-associated virus.

[0017] In some embodiments, the present invention provides a method for treating or preventing neurodegenerative diseases or conditions associated with the aggregation of one or more proteins selected from the following: tau, α-Syn, SOD1, TDP-43, FUS / TLS, ataxia protein 1, Htt, Aβ42, and HnRNPA1, said method comprising administering a composition according to the present invention to said subject.

[0018] In some implementations, the tau-related neurodegenerative diseases or conditions are selected from Alzheimer's disease, frontotemporal degeneration (FTLD-tau), progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), aurophilic granulomatosis (AGD), frontotemporal dementia and Parkinson's disease associated with chromosome 17 (FTDP-17), vacuoletau disease, Lytico-bodig disease, globular tau disease (GGT), age-related tau astropathy (ARTAG), Pick's disease and amyotrophic lateral sclerosis (ALS), primary age-related tau disease (PART), tangles-only dementia (TOD), chronic traumatic encephalopathy (CTE), anti-IgLON5-related tau disease, and Guadeloupe Parkinson's syndrome. Parkinsonism, multisystem protein disease (MSP), nodding syndrome (NS), ganglioglioma, gangliocytoma, meningioma, post-encephalitis Parkinson's syndrome, subacute sclerosing panencephalitis (SSPE), lead poisoning encephalopathy, tuberous sclerosis, pantothenic acid kinase-associated neurodegeneration, and lipofuscin deposition disease; and the activator of one or more TRIM proteins is selected from one or more of TRIM10, TRIM11, and TRIM55.

[0019] In some embodiments, application of the composition is effective for reducing tau aggregates by at least about 60%; reducing the ratio of insoluble tau to soluble tau by at least about 50%; and c) reducing tau aggregates by about 90% 6-8 days after application of the composition.

[0020] In some embodiments, the neurodegenerative diseases or conditions associated with α-Syn are selected from Parkinson's disease (PD), Lewy body dementia (DLB), multiple system atrophy (MSA), Shy-Drager syndrome, striatal substantia nigra degeneration, olivopontocerebellar atrophy, Hallervorden-Spatz syndrome, REM sleep behavior disorder (RPD), and Alzheimer's disease with amygdala-restricted Lewy bodies (AD / ALB); and the activator of the one or more TRIM proteins is an activator selected from one or more of TRIM10, TRIM36, TRIM55, and TRIM68.

[0021] In some embodiments, the neurodegenerative disease or condition associated with SOD1 is selected from amyotrophic lateral sclerosis (ALS) and Parkinson's disease (PD); and the activator of the one or more TRIM proteins is selected from one or more of TRIM10, TRIM11, TRIM24, TRIM36 and TRIM58.

[0022] In some implementations, the neurodegenerative diseases or conditions associated with TDP-43 are selected from frontotemporal dementia (FTD), frontotemporal degeneration (FTLD-TDP), multisystem proteinopathy (MSP), Perry's disease, facial onset sensory and motor neuron disease (FOSMN), Alzheimer's disease (AD), cerebral age-related TDP-43 with sclerosis (CARTS), limbic-predominant age-related TDP-43 encephalopathy (LATE), sporadic inclusion body myositis (sIBM), chronic traumatic encephalopathy (CTE), primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), Guam Parkinson-dementia complex (G-PDC), and Guam amyotrophic lateral sclerosis (G-ALS). sclerosis); Parkinson's disease (PD) and Huntington's disease (HD); and the activator of one or more TRIM proteins is one or more selected from TRIM10, TRIM11, TRIM17, TRIM36, TRIM37, TRIM40, TRIM49 and TRIM55.

[0023] In some embodiments, the composition is administered to the subject in the subject's cerebrospinal fluid (CSF). In some embodiments, the composition is administered via intraventricular injection (ICV).

[0024] In some embodiments, the composition is administered to the subject before the onset of symptoms of the disease or condition. In some embodiments, the composition is administered to the subject after the onset of symptoms of the disease or condition.

[0025] In some embodiments, the method further includes administering one or more other therapeutic agents. Attached Figure Description

[0026] The following detailed description of embodiments of the invention will be better understood when read in conjunction with the accompanying drawings. It should be understood that the invention is not limited to the exact embodiments and tools shown in the drawings.

[0027] Figure 1, including Figures 1A to 1I This shows representative results from the screening of TRIM proteins. Figure 1A Representative images of Western blots of various TRIM proteins are shown in HEK293T cells transfected with GFP-tauP301L and control vector (-) or a vector specifying TRIM. Cells were lysed in buffer containing NP-40 and separated by sedimentation into soluble supernatant (SN) and insoluble precipitate particles (PE). These fractions (top two rows) and whole-cell lysate (WCL, bottom two rows) were analyzed. Arrows indicate expected full-length TRIM bands. Boxes indicate TRIM proteins with significantly reduced insoluble GFP-tauP301L content. Figure 1B It shows, as Figure 1A Representative images of Western blots of various TRIM proteins in HEK293T cells. Figure 1C This showed the effect of HEK293T cells on Figure 1A and Figure 1B The relative GFP-tau P301L (PE) / HSP90 ratio of a given TRIM protein is shown in the figure. Figure 1D The image shows a representative proteomic blot of the TRIM protein, which significantly reduces... Figure 1A and Figure 1B Insoluble GFP-tau P301L expressed in SH-SY5Y cells. Figure 1E It shows that there is Figure 1D The ratio of relative GFP-tau P301L (PE) in SH-SY5Y cells in the case of the specified TRIM protein shown. Figure 1F The images show representative protein blots of TRIM expression in designated TRIM-knockout HEK293T cells transfected with GFP-tauP301L. Figure 1G Showing Figure 1F The ratio of relative GFP-tau P301L (PE) / HSP90 for the specified TRIM protein is shown. Figure 1H The images show representative protein blots of TRIM expression knocked down in N2a cells by transfection with GFP-tauP301L using specified TRIM knockdown. Figure 1I Showing Figure 1H The ratio of relative GFP-tau P301L (PE) / HSP90 for the specified TRIM protein is shown. Figure 1C , Figure 1E , Figure 1G and Figure 1I The data are mean ± SD; n=3; p<0.05; p<0.01; , p<0.001; unpaired student t-test.

[0028] Figure 2, including Figures 2A to 2J This study presents representative results of TRIM11 downregulation in the brain of sporadic Alzheimer's disease (AD). Figure 2A A representative table summarizing the demographic data of the controls and AD subjects used in this study is shown. Figure 2B Representative images of protein blots from the postmortem frontal cortex gray matter of 14 controls and 23 AD individuals are shown. Figure 2C It shows, as Figure 2B The relative levels of TRIM10 and TRIM55 are shown. Figure 2D It shows, as Figure 2B The relative levels of TRIM11 are shown. A #1 control and a #1 AD sample were used for comparison between each blot. p-Tau material was modified at residues S202 and T205 (reacted with AT8); Ser262; T231 (reacted with AT180); and S396 and S404 (reacted with PHF-1). Figure 2E Representative IHC images of TRIM11 and AT8 reactive p-tau in the frontal cortex are shown (scale bar, 50 μm). Figure 2F Representative quantitative data for TRIM11 and AT8 signals are shown, such as... Figure 2E As shown (mean ± SD, n=4). Figure 2G Representative images of TRIM11 and NeuN staining in the frontal cortex of control and AD samples are shown (scale bar, 10 μm). Figure 2H This shows the quantitative representation of the TRIM11 signal, such as... Figure 2G As shown, normalized to the number of neurons (mean ± SD, n=4). A single neuron is indicated by a white arrow. Figure 2I The study showed a representative negative correlation between TRIM11 expression and the levels of different p-tau substances in AD and control tissues. Figure 2J This shows a representative negative correlation between TRIM11 expression and the levels of different p-tau substances only in AD tissues. For Figure 2E and Figure 2H The data are expressed as mean ± SD; n=4; p < 0.05; ns, not significant; unpaired Student's t-test. For Figure 2I and Figure 2J This shows the Pearson correlation coefficient. r andp value.

[0029] Figure 3, including Figures 3A to 3M This demonstrates representative results of TRIM11 targeting tau for proteasome degradation. Figure 3A Representative images of Western blots showing tau or tau P301L expressed in HEK293T cells with increased amounts of TRIM11 are displayed. Cells were lysed in a buffer containing sodium dodecyl sarcosyl (sarkosyl) and analyzed by Western blot. Figure 3B Representative images of protein blots measured by CHX tracking of GFP-tau-P301L turnover in HEK293T cells are shown, with and without TRIM11. To better compare the half-life of GFP-tau-P301L under different conditions, the blots on the left and the corresponding blots on the right were exposed for different times to achieve similar band intensities at time 0. Figure 13A The figure shows the relative ratio of GFP-tau p301L / actin. Figure 3C Representative Western blots of QBI293 / tau P301L-GFP cells stably expressing mCherry or mCherry+TRIM11, cultured in doxycycline (Dox)-containing medium to induce tau P301L-GFP expression and then in Dox-free medium, are shown. Western blot analysis was performed to assess the turnover of pre-existing tau P301L-GFP over time after Dox removal. Figure 13B The data shows the quantitative values. Figure 3D Representative blots of GFP-tau expressed alone or with Flag-TRIM11 in HEK293T cells, with or without okadaic acid (OA, 100 nM) treatment. To achieve comparable levels of GFP-tau, the amount of GFP-tau plasmid increased when expressed with TRIM11. Figure 13E ). Figures 13F to 13I The data shows the quantitative values. Figure 3E Representative images of BiFC assays of TRIM11-VN and tau-VC expressed in HEK293T cells are shown (scale bar, 100 μm). Figure 14D The quantitative analysis of the BiFC signal is shown in the figure. Figure 3F Representative images of co-IP assays of the interaction between Flag-TRIM11 and GFP-tau in HEK293T cells with and without OA (100 nM) treatment are shown. Figure 3GRepresentative images of the protein blots are shown when GST or GST-TRIM11 immobilized on beads are incubated with 6×His-GFP-tau or 6×His-GFP-tau P301L. Pulldown and input samples were analyzed by protein blotting and / or Coomassie Brilliant Blue staining. Figure 3H Representative images (scale bar, 10 μm) showing the localization of endogenous TRIM11 and tau in SH-SY5Y cells with and without OA (100 nM) treatment are shown. Figure 3I Showing via from Figure 3H Quantitative analysis of colocation by Mendes colocation coefficients (n=6). Figure 15A The image shows the individual TRIM11 and tau images. Figure 3J Representative images (scale bar, 10 μm) of PLA assays for endogenous TRIM11-tau interaction in SH-SY5Y cells with and without OA (100 nM) treatment are shown. Figure 3K Showing from Figure 3J Quantitative analysis of PLA signals (n=10). Figure 15D The image shows the individual PLA and DAPI images. Figure 3L The results showed that, as indicated, purified recombinant Flag-TRIM11 or Flag-TRIM11, incubated with GST-tau P301L in the presence or absence of ATP, along with SUMO E1, E2, and 6×His-SUMO2, yielded the desired results. 2EA Representative images of the protein blot. The reaction mixture was denatured and analyzed by IP (d-IP) for GST-tau P301L SUMOylation. Figure 3M Representative images of the protein blot are shown, confirming the presence of increased amounts of TRIM11 or TRIM12. 2EA The level of GFP-tau-P301L in HEK293T cells under certain conditions. Figure 3I and Figure 3K The data are expressed as mean ± SD; , p<0.001; unpaired student t-test.

[0030] Figure 4, including Figures 4A to 4P The results show representative findings of testing TRIM11 as a molecular chaperone and depolymerase of tau, thereby improving its solubility. Figure 4ARepresentative images of the protein blots are shown, confirming that TRIM11 increases the solubility of tau in cells. HEK293T cells were transfected with different amounts of GFP-tau plasmid to make its levels comparable in the presence or absence of TRIM11. Cells were treated with MG132 (10 μM) or NH4Cl (20 μM) as indicated. Figure 4B Representative images (scale bar, 100 μm) of HEK293T cells transfected with tau-VN, tau-VC, and TRIM11 are shown, as indicated. Figure 4C It shows, as Figure 4B The relative fluorescence signal (top) and protein expression (bottom) are shown. Figure 4D Representative images of HEK293 / RD(LM)-YFP cells transfected with empty vector (EV) or TRIM11 and with or without tau PFF treatment are shown. Intracellular tau inclusions (inclusion bodies) were analyzed by IF (scale bar, 100 μm). Figure 4E Showing Figure 4D The quantitative data of tau inclusions shown (n=12). Figure 4F Representative images of QBI293 / tau P301L-GFP cells stably expressing mCherry or mCherry+TRIM11 are shown. These cells were treated with Dox to induce tau P301L expression and incubated with or without tau PFF. Tau inclusions in the cells were analyzed by IF (scale bar, 50 μm). Figure 4G Showing Figure 4F The quantitative data of tau inclusions shown (n=8 to 10). Figure 4H Representative images of protein blots of insoluble tau substances are shown. Figure 4I The study shows representative formation of tau amyloid fibrils when tau protein (10 μM) was incubated with heparin (30 μM) in the presence of GST (1 μM) or GST-TRIM11 (0.25, 0.5 or 1 μM) and tested for ThT binding. Figure 4J Representative images of the protein blot are shown, confirming, as Figure 4I The formation of tau amyloid fibrils was detected by sedimentation. Figure 4K This shows what was detected by electron microscopy, such as Figure 4I Representative image of tau amyloid fibrils formation (scale bar, 500 nm). Figure 4L The study shows representative formation of tau amyloid fibrils when Tau P301L protein was incubated with buffer, GST (1 μM), or GST-TRIM11 (0.25, 0.5, or 1 μM) and tested for ThT binding. Figure 4MRepresentative images of the protein blot are shown, confirming the production of high molecular weight tau substances, such as... Figure 4L As shown. Figure 4N Representative results (n=3) of reconstituted tau PFF (1 μM) treated with GST or GST-TRIM11 at specified concentrations, analyzed by ThT binding, are shown. Figure 4O This shows the results detected through settlement, such as Figure 4N Representative images of the protein blot results of the re-formed tau PFF processed in the medium. Figure 4P Representative images are shown, illustrating the effects of electron microscopy (scale bar, 200 nm). Figure 4N The result of the re-formed tau PFF processed in the middle. For Figure 4C , Figure 4E , Figure 4G and Figure 4N The data are expressed as mean ± SD; p<0.01; , p<0.001; unpaired student t-test.

[0031] Figure 5, including Figures 5A to 5U This shows representative results of the TRIM11 test, used to maintain neural integrity and connectivity. Figure 5A Representative images confirming the localization of endogenous TRIM11 and tau in wild-type cortical neurons are shown (scale bar, 10 μm). Figure 19A The data shows the quantitative co-location. Figure 5B Representative images of PS19 cortical neurons transduced with control or TRIM11 ASO #5 are shown, with tau aggregates detected using AT8 (scale bar, 10 μm). Cells were treated with myc-K18 / P301L PFF. Figure 5C Showing Figure 5B The representative quantification of intracellular tau aggregates shown (n=4). Figure 5D Representative images of PS19 cortical neurons transduced with AAV9-GFP or AAV9-TRIM11 are shown, with tau aggregates detected using AT8 (scale bar, 50 μm). Cells were treated with myc-K18 / P301L PFF. Figure 5E Showing Figure 5D The representative quantification of intracellular tau aggregates shown (n=3). Figure 5F Representative images (scale bar, 10 μm) of wild-type cortical neurons treated with control or TRIM11 ASO #5 are shown for analysis of SYP expression. Figure 5G Showing Figure 5FQuantification of SYP-reactive spots (puncta) shown (n=3). Figure 5H Representative images (scale bar, 10 μm) of wild-type cortical neurons treated with control or TRIM11ASO #5 are shown for PSD95 expression analysis. Figure 5I Showing Figure 5H The quantification of PSD95-reactive spots shown (n=3). Figure 5J Representative images (scale bar, 10 μm) of wild-type cortical neurons treated with control or TRIM11 ASO #5 are shown for analysis of NFL and MAP2 expression. Figure 5K Showing Figure 5J The quantitative representation of relative NFL intensity is shown (n=3). Figure 5L Showing Figure 5J The quantitative representation of dendrite length is shown (n=3). Figure 12C The images are displayed in the image. Figure 5M The representative viability of wild-type cortical neurons treated with either the control ASO or the specified TRIM11 ASO for 14 days is shown (n=3). Figure 5N Representative images (scale bar, 10 μm) of wild-type cortical neurons transduced with AAV9-GFP or AAV9-TRIM11 (the latter tagged with HA) stained with antibodies against SYP and HA are shown. Figure 5O Showing Figure 5N Quantification of SYP-spots shown (n=3). Figure 5P It shows, as Figure 5N Representative images of wild-type cortical neurons stained with antibodies against PSD95 and HA (scale bar, 10 μm). Figure 5Q Showing Figure 5P The quantitative analysis of PSD95 spots shown (n=3). Figure 5R Representative images (scale bar, 10 μM) of wild-type cortical neurons transduced with AAV9-GFP or AAV9-TRIM11 explored with antibodies against NFL and MAP2 are shown. Figure 5S The quantitative representation of relative NFL intensity normalized to the number of neurons (n=3) is shown. Figure 5T The quantitative representation of the relative MAP2 intensity normalized to the number of neurons is shown (n=3). Figure 5U The representative viability (n=3) of wild-type cortical neurons transduced with AAV9-GFP or AAV9-TRIM11, with or without tau PFF treatment, is shown. For Figure 5C , Figure 5E , Figure 5G , Figure 5I , Figures 5K to 5M , Figure 5O , Figure 5Q and Figures 5S to 5U The data are expressed as mean ± SD; p<0.05; p<0.01; p<0.005; ns, not significant; unpaired Student's t-test.

[0032] Figure 6, including Figures 6A to 6O This study presents representative results of testing the protective effect of TRIM11 against tau pathology and cognitive / behavioral impairment in PS19 mice. Figure 6A This diagram illustrates the effects of TRIM11 on PS19 mice. Human TRIM11 was tagged with HA from AAV9 and detected using an anti-HA antibody to distinguish it from endogenous mouse TRIM11. Figure 6B Representative images confirming TRIM11 reduction in tau pathology in the hippocampus of PS19 mice are shown. Brain staining of PS19 mice injected with AAV9-GFP or AAV9-TRIM11 using AT8 is also shown. Representative images of the hippocampus and CA1 region are shown (left; scale bar: 0.2 mm) and relative AT8 intensity (right; n=6 mice). Figure 21A Other images are displayed. Figure 6C Representative images of total tau and p-tau content in the hippocampus of mice injected with AAV9-GFP or AAV9-TRIM11 are shown. Each line represents one mouse. Figures 21B to 21D The data shows the quantitative values. Figure 6D Representative images demonstrating TRIM11's reduction of astrocyte gliosis are shown. Brains of age-matched wild-type mice or PS19 mice injected with AAV9-GFP or AAV9-TRIM11 were stained with anti-GFAP antibody. A representative image of the hippocampus is shown (scale bar, 0.2 mm). Figure 6E Showing Figure 6D Quantification of the GFAP immune response zone (n=5 WT mice or 6 mice injected with GFP or TRIM11). Figure 6F Representative images demonstrating TRIM11's reduction of microgliosis are shown. Brains of age-matched wild-type mice or PS19 mice injected with AAV9-GFP or AAV9-TRIM11 were stained with anti-Iba1 antibody (scale bar, 0.2 mm). Figure 6G Showing Figure 6F Quantification of the Iba1 immunoreactive region (n=5 WT mice or 6 mice injected with GFP or TRIM11). Figure 21E and Figure 21FOther images are displayed. Figure 6H Representative images confirming TRIM11's rescue of dendritic degradation are shown. Brains of wild-type mice or PS19 mice injected with AAV9-GFP or AAV9-TRIM11 were stained with antibodies detecting MAP2. An image of the hippocampus is shown (scale bar, 0.2 mm). Figure 6I Showing Figure 6H Quantification of MAP2 immunoreactivity (n=4 WT mice, 6 GFP-AAV mice or 7 AAV-TRIM11 PS19 mice). Figure 6J Representative images confirming TRIM11 rescue axonal degeneration are shown. Brains of wild-type mice or PS19 mice injected with AAV9-GFP or AAV9-TRIM11 were stained with antibodies that detect NFL (scale bar: 0.2 mm). Figure 6K Showing from Figure 6J Quantitative analysis of NFL-immunoreactivity (n=4 WT mice, 6 GFP-AAV mice, or 7 AAV-TRIM11 PS19 mice). Figure 21G and Figure 21H Other images are shown in Figure 21L. A representative image confirming TRIM11's protection against neuronal loss is shown. Brains of wild-type mice or PS19 mice injected with AAV9-GFP or AAV9-TRIM11 were stained with antibodies detecting NeuN. A representative image of the hippocampus is shown (scale bar: 0.2 mm). Figure 6M Showing from Figure 6L Quantification of NeuN-immunoreactivity (n=3 mice). Figure 21I Other images are displayed. Figure 6N The results show representative results confirming that mice injected with AAV9-TRIM11 exhibited an increased preference for novel targets (n=6 WT or GFP or 7 TRIM11 mice). Figure 6O Representative results confirming TRIM11's improvement in grip strength are shown (n=4 WT, 5 GFP, or 6 TRIM11). For Figure 6B (Left side) Figure 6E , Figure 6G , Figure 6I , Figure 6K and Figures 6M to 6O The data are expressed as mean ± SD; p<0.05; p<0.01; p<0.005; ns, not significant; unpaired Student's t-test.

[0033] Figure 7, including Figures 7A to 7JThis study presents representative results of testing the protective effect of TRIM11 against PFF-accelerated tau pathology and cognitive and behavioral impairments in PS19 mice. Figure 7A This diagram illustrates the effect of TRIM11 on PS19 (PS19-PFF) mice injected with pFF. Figure 7B Representative results confirming TRIM11's reduction of tau pathology are shown. The brains of PS19 mice injected with AAV9-GFP or AAV9-TRIM11 along with tau PFF were stained with AT8. Representative images of the hippocampus and CA1 region are shown (left; scale bar, 0.2 mm) and relative AT8 intensity (right; n=6 mice). Figure 22A Other images are displayed. Figure 7C Representative images of total tau and p-tau content in the hippocampus of mice injected with AAV9-GFP or AAV9-TRIM11 along with PFF are shown. Each line represents one mouse. Figures 22B to 22D The data shows the quantitative values. Figure 7D Representative results confirming TRIM11's reduction of astrocyte gliosis are shown. The brains of PS19 mice injected with AAV9-GFP or AAV9-TRIM11 along with PFF were stained with anti-GFAP antibody. Representative images of the hippocampus are shown (left; scale bar, 0.2 mm) and quantification of the GFAP immunoreactive region (right, n=5 WT mice or 6 PS19 mice injected with GFP or TRIM11). Figure 7E This demonstrates representative results confirming that TRIM11 reduces microglial proliferation. (For example...) Figure 7D The brains of PS19 mice treated with anti-Iba1 antibody are shown. A representative image of the hippocampus is shown (left; scale bar, 0.2 mm) and quantification of the Iba1 immunoreactive region is shown (right, n=5 WT or 6 GFP or TRIM11-injected PS19 mice). Figure 22E and Figure 22F Other images are displayed. Figure 7F This study presents representative results confirming TRIM11's ability to maintain mouse recognition of novel objects. Data represent the percentage of preference for novel objects (n = 9 WT, TRIM11, or 7 GFP mice). Figure 7G The results showed representative findings that mice injected with AAV9-TRIM11 exhibited alternating elevations in the Y-maze test compared to mice injected with AAV9-GFP. Figure 7H Representative open field trajectory plots were shown, which confirmed that mice injected with AAV9-TRIM11 traveled a greater distance compared to mice injected with AAV9-GFP. Figure 7I Showing Figure 7HThe quantification of the distance traveled is shown (n=9 WT or GFP or 10 TRIM11 mice). Figure 7J Representative results were shown, confirming that mice injected with AAV9-TRIM11 had a reduced freezing time compared to mice injected with AAV9-GFP (n=9 WT or GFP or 10 TRIM11 mice). For Figure 7B (Right side) Figure 7D (Right side) Figure 7E (Right side) Figure 7F , Figure 7G , Figure 7I and Figure 7J The data are expressed as mean ± SD; p<0.05; p<0.01; p<0.005; ns, not significant; unpaired Student's t-test.

[0034] Figure 8, including Figures 8A to 8Q The results show representative findings of testing TRIM11 to improve tau pathology and cognitive deficits in 3×Tg-AD mice. Figure 8A A schematic diagram of bilateral hippocampal injections in 3×Tg-AD mice is shown. Figure 8B The results are representative and confirm the findings based on... Figure 8A Intraparenchymal injection of AAV9-TRIM11 reduced tau aggregates in the hippocampus of 3×Tg-AD mice. Representative images of the hippocampus are shown (left; scale bar, 0.2 mm) and quantification of tau aggregates (right; n=6 mice). Figure 8C It shows, as Figure 8A Representative images of Western blot analysis of total tau and p-tau substances in the hippocampus processed in the study. Each line represents one mouse. Figures 23B to 23D Quantitative data is provided. Figure 8D The results showed representative findings that confirmed TRIM11 reduced, for example, Figure 8A Astrocyte gliosis in mice treated with GFAP. Representative images (left; scale bar, 0.2 mm) and quantifications (right; n=5 to 6 mice) of the GFAP-immunized area are shown. Figure 23E Other images are displayed. Figure 8E The results showed representative findings that confirmed TRIM11 reduced, for example, Figure 8A Microglial proliferation in mice treated with Iba1. Representative images (left; scale bar, 0.2 mm) and quantification (right; n=5 to 6 mice) of the Iba1 immunoreactive zone are shown. Figure 23F Other images are displayed. Figure 8F The results show representative findings, which confirm the findings as follows: Figure 8AMice treated with TRIM11 spent more time on new targets (n=9 GFP mice or 13 TRIM11 mice). Figure 8G The results show representative findings, which confirm the findings as follows: Figure 8A Mice treated with TRIM11 showed increased correct alternation in the Y maze test (n=9 GFP mice or 14 TRIM11 mice). Figure 8H The results show representative findings, which confirm the findings as follows: Figure 8A Mice treated with TRIM11 had increased walking distance in open field tests (n=14 GFP mice or 17 TRIM11 mice). Figure 8I The results show representative findings, which confirm the findings as follows: Figure 8A Mice treated with TRIM11 had reduced resting time in open field tests (n=14 GFP mice or 17 TRIM11 mice). Figure 8J A schematic diagram of unilateral ICV injection in 3×Tg-AD mice is shown. Figure 8K The results are representative and confirm the findings based on... Figure 8J ICV injection of AAV9-TRIM11 reduced tau aggregates in the hippocampus of 3×Tg-AD mice. Representative images of the hippocampus are shown (left; scale bar, 0.2 mm) and quantification of tau aggregates (right; n=6 mice). Figure 8L It shows, as Figure 8J Representative images of Western blot analysis of total tau and p-tau substances in the hippocampus after processing. Each line represents one mouse. Figures 24A to 24C Quantitative data is provided. Figure 8M The results showed representative findings that confirmed TRIM11 reduced, for example, Figure 8J Astrocyte gliosis in mice treated with GFAP was observed. Quantification of the GFAP-immunoreactive zone was shown (n=5 to 6 mice). Figure 24D Other images are displayed. Figure 8N The results showed representative findings that confirmed TRIM11 reduced, for example, Figure 8J Microglial cell proliferation in mice treated with the drug. Quantification of the Iba1 immunoreactive zone is shown (n=5 to 6 mice). Figure 24E Other images are displayed. Figure 8O The results show representative findings, which confirm the findings as follows: Figure 8J Mice treated with TRIM11 spent more time on new targets (n=6 GFP or 8 TRIM11 mice). Figure 8P The results show representative findings, which confirm the findings as follows: Figure 8J Mice treated with TRIM11 showed increased correct alternation in the Y maze test (n=7 mice). Figure 8Q The results show representative findings, which confirm the findings as follows: Figure 8JMice treated with TRIM11 showed increased walking distance in the open field test (n=7 mice). For Figure 8B (Right side) Figure 8D (Right side) Figure 8E (Right side) Figures 8F to 8I , Figure 8K (Right side) and Figures 8M to 8Q The data are expressed as mean ± SD; p<0.05; p<0.01; p<0.001; ns, not significant; unpaired Student's t-test.

[0035] Figure 9 A schematic diagram of the TRIM protein structure is shown. All TRIMs except for mouse-derived TRIM12 and TRIM30 are human proteins. TRIM53 (pseudogene) and TRIM57 (identical to TRIM59) are not listed. ARF, ADP-ribosylation factor-like protein; B, B box; BR, bromine domain; CC, coiled helix; COS, a feature of the C-terminal subgroup; FN3, type 3 fibronectin; FIL, filamentin-type immunoglobulin; MATH, meprin homology with tumor necrosis factor receptor-associated factor; MID, midline; N-terminus, amino terminus; PHD, plant homology domain; PRY, SPRY-associated domain; R, ring finger; SPRY, SPIA and ryanodine receptor domain (calcium channel receptor domain); TM, transmembrane. Missing domains are shown in parentheses. Not drawn to scale.

[0036] Figure 10, including Figures 10A to 10H The results show representative results of forced expression of TRIM10, TRIM11 and TRIM55. Figure 10A This shows the representative relative GFP-tauP301L(SN) / HSP90 ratio in SH-SY5Y cells in the presence of the specified TRIM protein. Figure 1D and Figure 1E Related. Figure 10B Representative images of Western blot analysis of GFP-tau P301L transfected with either the control vector or the specified TRIM are shown in N2a cells. Cells were lysed in a buffer containing NP40 and separated by sedimentation into soluble supernatant (SN) and insoluble precipitate (PE) fractions. Figure 10C Showing from Figure 10B The ratio of relative tau / HSP90 in the PE and SN portions. Figure 10D It shows, as Figure 10BRepresentative images of Western blot analysis of N2 cells treated with Sarkosyl buffer instead of NP40 buffer. Figure 10E Showing from Figure 10D The relative tau / HSP20 ratio in the PE and SN portions. Figure 10F The representative relative GFP-tau P301L mRNA levels in HEK293T cells are shown in the presence of the specified TRIM protein. Figure 10G The representative relative GFP-tau P301L mRNA levels in SH-SY5Y cells are shown in the presence of the specified TRIM protein. Figure 10H The representative relative GFP-tau P301L mRNA levels in N2a cells are shown in the presence of the specified TRIM protein. For Figure 10A , Figure 10C and Figures 10E to 10H The data are average ± SEM; n=3; p<0.05; p<0.01; p<0.001; ns, not significant; unpaired Student's t-test.

[0037] Figure 11, including Figures 11A to 11H The results show representative knockout and knockdown of TRIM10, TRIM11, or TRIM55. Figure 11A The representative relative ratio of GFP-tauP301L in the supernatant (SN) of the specified TRIM-knockout HEK293T cells is shown. Figure 11B The ratio of representative relative GFP-tau P301L mRNA in specified TRIM-knockout HEK293T cells is shown. Figure 11C Representative images of Western blots of N2a cells transfected with GFP-tau P301L and pretreated with either control or TRIM10-siRNA are shown. Cells were lysed in a buffer containing NP-40. Figure 11D It shows, as Figure 11C Representative images of Western blots of N2a cells in which TRIM11-siRNA was used instead of TRIM-10 siRNA. Figure 11E It shows, as Figure 11C Representative images of Western blots of N2a cells in which TRIM36-siRNA was used instead of TRIM10-siRNA. Figure 11F It shows, as Figure 11C Representative images of Western blots of N2a cells in which TRIM55-siRNA was used instead of TRIM10-siRNA. Figure 11G Showing Figures 11C to 11F The ratio of relative GFP-tauP301L / HSP90 in the precipitated particles (PE) and supernatant (SN) portions is shown. Figure 11H Showing Figures 11C to 11F The relative GFP-tau P301L mRNA level is shown. For Figure 11A , Figure 11B , Figure 11G and Figure 11H The data are average ± SEM; n=3; p<0.05; p<0.01; ns, not significant; unpaired Student's t-test.

[0038] Figure 12, including Figures 12A to 12G This demonstrates the representative effect of TRIM11 downregulation in the brain of sporadic AD. Figure 12A The images show AT8 in control and AD brain tissue. p Representative relative ratios of Ser262, AT180, and PHF-1 tau substances to GAPDH. Figure 12B Representative images of protein blots containing high MW tau material from the frontal cortex gray matter of AD and control individuals are shown. The #1 control and #1 AD samples were used for comparison between blots in each sample. Figure 12C Showing control and AD frontal cortex MAPT and TRIM Representative results of qRT-PCR analysis of mRNA levels. Figure 12D Representative images of anti-TRIM11 staining and DAPI in the frontal cortex of control and AD samples are shown (scale bar, 10 μm). Figure 12E Showing normalization to Figure 12D The total number of neurons shown is quantified by the TRIM11 signal. Figure 12F The representative relative TRIM11 mRNA (†) and protein ( ) values ​​in each control and AD sample are shown. )level. Figure 12G Representative correlation analysis of TRIM11 expression with tau AT8 and AT180 in AD samples is shown. Pearson correlation coefficients are also presented. r and p Value. For Figure 12A , Figure 12B and Figure 12E The data are average ± SEM; n=3; p<0.05; p<0.01; ns, not significant; unpaired Student's t-test.

[0039] Figure 13, including Figures 13A to 13M This shows representative results of testing the degradation of TRIM11 targeting tau. Figure 13A Showing Figure 3B The experiment shown illustrates the ratio of relatively insoluble GFP-tau P301L to actin. Figure 13B Showing Figure 3C The relative levels of PHF-1 in the experiment shown. Figure 13C Representative images of Western blots showing GFP-tau P301L expression in control and TRIM11-knockout HEK293T cells are displayed. Cells were treated with CHX for a specified duration. Figure 13D Showing Figure 13C The relative GFP-tau P301L / actin ratio is shown. Figure 13E Representative images of GFP-tau expressed alone or in combination with Flag-TRIM11 are shown in HEK293T cells treated with or without okadaic acid (OA, 100 nM; scale bar, 100 μm). To achieve comparable levels of GFP-tau, more GFP-tau plasmids were expressed in combination with TRIM11. Figure 13F It shows, as Figure 13E Representative quantification of total tau relative to actin in precipitate particles (PE), supernatant (SN), or whole-cell lysate (WCL) of cells treated with the medium. Figure 13G It shows, as Figure 13E Representative quantification of p-tau substances (AT8 and Ser-396) relative to actin in the precipitate particles (PE) of the treated cells. Figure 13H It shows, as Figure 13E Representative quantification of p-tau substances (AT8 and Ser-396) relative to actin in the supernatant (SN) of the treated cells. Figure 13I It shows, as Figure 13E Representative quantification of p-tau substances (AT8 and Ser-396) relative to total tau in the supernatant (SN) of the treated cells. Figure 13J Representative images of GFP-tau expressed alone or in conjunction with TRIM11 are shown in Western blots of HEK293T cells. Cells were treated with CHX for a specified duration and then lysed. Figure 13K Showing from Figure 13J Quantitative relative GFP-tau / actin ratio. Figure 13L Representative images of GFP-tau expressed in control and TRIM11-knockout cells after treatment with CHX for a specified time and subsequent lysis are shown. Figure 13M Showing from Figure 13L Quantitative relative GFP-tau / actin ratio. Figure 13C , 13J To better compare the half-life of GFP-tau under different conditions, the left and right blots were exposed for different times to achieve similar band intensities at time 0. For 13L... Figure 13A , Figure 13B , Figure 13D , Figures 13F to 13I , Figure 13K and Figure 13M The data are average ± SEM; n=3; p<0.05; p<0.01 p<0.001; ns, not significant; unpaired Student's t-test.

[0040] Figure 14, including Figures 14A to 14I This demonstrates representative results confirming that TRIM11 interacts with tau and SUMOylates tau to promote its degradation. Figure 14A Representative images of Western blots from HEK293T cells expressing GFP-tau P301L with elevated levels of TRIM11 are shown. Cells were treated with MG132 (with c-Myc as a control) or NH4Cl (with p62 and LC3 as controls). Figure 14B It shows, as Figure 14A A representative image of Western blots on HEK293T cells expressing GFP-tau. Figure 14C A schematic diagram of BiFC assays for TRIM11-tau interaction (left and middle) and tau-tau interaction (right) is shown. VN173 and VC155 contain amino acids 1 to 172 and 155 to 238 of Venus, respectively. Figure 14D Representative quantifications of BiFC assays for TRIM11-VN and tau-VC expressed in HEK293T cells are shown. Figure 3E Related. Figure 14E Representative images of BiFC signaling in HEK293T cells expressing Tau-VN and TRIM-VC are shown (scale bar, 100 μm). Figure 14F Showing from Figure 14E Quantification of BiFC signals. Figure 14G Representative images of Western blots from HEK293T cells transfected with TRIM11 along with GFP-tau and GFP-tauP301L are shown, confirming that TRIM11 interacts with tau and preferentially interacts with mutant or phosphorylated forms. Cell lysates were immunoprecipitated with anti-FLAG antibody. Immunoprecipitates and WCLs were analyzed. Figure 14H It shows, as Figure 14GRepresentative Western blot images of HEK293T cells transfected with TRIM11 along with GFP-tau and GFP-tau AT8. Figure 14I It shows that from Escherichia coli ( E. coli Purified recombinant GST-TRIM11, GFP-tau-6×His, and GFP-tau P301L-6×His proteins, and Flag-TRIM11 and Flag-TRIM12 purified from HEK293T cells. 2EA Representative images of SDS-PAGE gels containing proteins stained with Coomassie Brilliant Blue. BSA was used as the protein standard. Figure 14D and Figure 14F The data are expressed as mean ± SD; n=10.

[0041] Figure 15, including Figures 15A to 15J The results showed representative findings that confirmed that endogenous TRIM11 and tau co-localize and interact in N2a and SH-SY5Y cells. Figure 15A Representative immunofluorescence images (100 nM; scale bar, 10 μm) of endogenous TRIM11 and tau in SH-SY5Y with and without OA treatment are shown. Figure 3H and Figure 3I Related. Figure 15B Representative immunofluorescence images of endogenous TRIM11 and tau in N2a with and without OA treatment are shown (100 nM; scale bar, 5 μm). Figure 15C This shows the results obtained through Manders colocation coefficient analysis. Figure 15A and Figure 15B Quantitative analysis of colocation (n=6). Figure 15D Representative images (scale bar, 10 μm) of the interaction between endogenous TRIM11 and tau in SH-SY5Y cells treated with and without OA (100 nM) are shown by PLA test. Figure 3J and Figure 3K Related. Figure 15E Representative images (scale bar, 10 μm) of the interaction between endogenous TRIM11 and tau in N2a cells treated with and without OA (100 nM) are shown by PLA test. Figure 15F Showing from Figure 15E Quantitative analysis of PLA signals (n=10). Figure 15G Representative results for SH-SY5Y cells with and without OA (100 nM) treatment are shown. TRIM11 and p-tau levels were analyzed by Western blotting, and TRIM11 was quantified relative to HSP90. Figure 15H Showing from such Figure 15GTRIM11 mRNA in cells treated with the medium was quantified by qRT-PCR. Figure 15I Representative results for N2a cells with and without OA (100 nM) treatment are shown. TRIM11 protein and p-tau levels were analyzed by Western blotting, and TRIM11 was quantified relative to HSP90. Figure 15J Showing from such Figure 15I TRIM11 mRNA in cells treated with this method was quantified by qRT-PCR. Figures 15G to 15J n=3. Regarding Figure 15, for Figure 15C , Figure 15D and Figures 15G to 15J The data are average ± SEM. p<0.05; p<0.01; p<0.001; ns, not significant; unpaired Student's t-test.

[0042] Figure 16, including Figure 16A and Figure 16B This image shows representative images confirming that TRIM11 promotes SUMOylation of tau in cellular and cell-free systems. Figure 16A Representative images of Western blots from HEK293T cells transfected with specified TRIM11, GFP-tau, and GFP-tau P301L are shown, confirming that TRIM11 promotes SUMOylation of GFP-tau and GFP-tau P301L in the cells. Cells were treated with MG132 and lysed in SDS-containing buffer. After dilution in SDS-free buffer, cell lysates were immunoprecipitated (d-IP) with anti-GFP antibody. The immunoprecipitates and input tau and total SUMOylation, as well as protein expression, were analyzed. Figure 16B Representative images of purified recombinant Flag-TRIM11 blotted with GST-tau or GST-tau P301L, in the presence or absence of ATP, are shown, as indicated. SUMOylation of GFP-tau and GFP-tau P301L in the reaction mixture was analyzed by d-IP.

[0043] Figure 17, including Figures 17A to 17J This demonstrates representative results confirming that TRIM11 enhances tau solubility in cells. Figure 17A Representative images of Western blots of HEK293T cells expressing GFP-tau with or without Flag-TRIM11 are shown. Figure 17B Showing from Figure 17A Quantification of the ratio of insoluble to soluble GFP-tau. Figure 17C Showing Figure 4A The image shows a representative fluorescence image of cells in the experiment (scale bar, 100 μm). Figure 17D This shows the effects of using GFP or GFP-tau p301 alone or with Flag-TRIM11 or Flag-TRIM11 alone. 2EA A representative image of the Western blot of co-transfected HEK293T cells, which confirms that TRIM11 prevents tau P301L from accumulating in cells. Figure 17E Representative fluorescence images (scale bar, 100 μm) of HEK293T cells transfected with tau-VN or tau-VC and pretreated with control or TRIM11 siRNA are shown. Figure 17F Showing Figure 17E Quantification of relative fluorescence signal (top) and protein expression (bottom) in cells. Figure 17G Representative fluorescence images (scale bar, 100 μm) of HEK293T or TRIM11 knockout HEK293T cells transfected with tau-VN and tau-VC alone or together are shown. Figure 17H Showing Figure 17G Quantification of relative fluorescence signal (top) and protein expression (bottom) in cells. Figure 17I Representative images of Western blots of HEK293 / RD(P301L / V337M)-YFP cells transfected with empty vector (-) or TRIM11 and with or without tau PFF treatment are shown. Figure 17J Showing from Figure 17I Quantitative relative tau(SN) / tau(WCL) and tau(SN) / tau(WCL) ratios. Relevant to Figures 4, D and E. For Figure 17B , Figure 17F , Figure 17H and Figure 17J The data are expressed as mean ± SD; n=3; p<0.05; p<0.01; ns, not significant; unpaired Student's t-test.

[0044] Figure 18, including Figures 18A to 18E This demonstrates representative results confirming that TRIM11 is both a molecular chaperone and a depolymerase of tau. Figure 18A Representative results of tau amyloid fibrillation via ThT binding are shown, confirming that TRIM11 inhibits spontaneous tau aggregation. Purified GST-tau (20 μM) was incubated with heparin (30 μM) for 24 h in the absence or in the presence of a specified concentration of GST or GST-TRIM11. Figure 18BThis shows a representative image of the protein imprint formed by the sedimentation of tau amyloid fibrils. Figure 18C Representative electron microscopy images (scale bar, 500 nm) confirming inhibition of tau amyloid fibrillation by TRIM11 are shown. Figure 18D Representative images of the protein blot are shown, confirming that GST-TRIM11 dissolves pre-formed tau aggregates. PFFs formed from GST-tau (1 μM) were treated with a specified concentration of GST or GST-TRIM11 and obtained by sedimentation. Figure 18E A representative electron microscopy image (scale bar, 500 nm) confirms that TRIM11 dissolves pre-formed tau aggregates.

[0045] Figure 19, including Figures 19A to 19M The results showed representative findings that confirmed TRIM11 interacts with tau and eliminates its aggregation in neurons. Figure 19A This study shows the representative co-localization of endogenous TRIM11 and tau in cortical neurons derived from wild-type (WT) mice, as analyzed by Pearson correlation coefficient. Figure 5A Related. Figure 19B Representative images of PLAs with endogenous TRIM11-tau interaction in WT cortical neurons with and without OA treatment are shown (100 nM; scale bar 10 μm). Figure 19C Showing from Figure 19B Quantitative analysis of PLA signals (n=10). Figure 19D Representative protein blot analysis (top) and quantification of TRIM11 levels (bottom; n=3) of WT cortical neurons treated with and without OA (100 nM) are shown. Figure 19E Representative images (scale bar, 20 μm) of WT cortical neurons treated with and without SCR CTRL-FAR RED for 3 days and stained with MAP are shown. Figure 19F Representative images of protein blots from WT cortical neurons treated for 3 days with AUMInc-scrctrl or AUMSiI-TRIM11-1 / 2 / 3 / 4 / 5 are shown. Cells were lysed in RIPA buffer. Figure 19G Representative images of cortical neurons from PS19 mice transduced with control or TRIM11 #5 ASO and treated with PFFs generated by myc-K18 / P301L are shown. Tau aggregates were detected using MC1 (scale bar, 10 μm). Figure 19H Showing from Figure 19G Quantitative analysis of MC1 intensity (n=8). Figure 19IRepresentative images (scale bar, 50 μm) of PS19 cortical neurons transduced with AAV9-GFP or AAV9-TRIM11 and stained with DAPI, p-tau, GFP, and TRIM11 are shown. Figure 4D Related. Figure 19J Representative images of PS19 cortical neurons transduced with AAV9-GFP or AAV9-TRIM11, treated with myc-K18 / P301L PFF, are shown. Cells were treated with myc-K18 / P301L PFF, and tau aggregates were detected using antibody MC1. Cells were stained for DAPI, p-tau, GFP, and TRIM11 (tagged with HA and detected with anti-HA antibody) (scale bar, 50 μm). Figure 19K Showing from Figure 19J Quantification of the MC1 signal (n=9). Figure 19L Representative images of PS19 hippocampal neurons transduced with AAV9-GFP or AAV9-TRIM11 vectors and treated with myc-K18 / P301L PFF are shown. Tau aggregates were detected using AT8 (scale bar, 100 μm). Figure 19M It shows, as Figure 19M Representative images of PS19 hippocampal neurons detected using MC1 (scale bar, 100 μm). For Figure 19A , Figure 19C , Figure 19D , Figure 19H and Figure 19K The data are expressed as mean ± SEM; p<0.05; p<0.01; ns, not significant; unpaired Student's t-test.

[0046] Figure 20, including Figures 20A to 20C The results showed representative findings that confirmed TRIM11 maintains neural integrity and connectivity. Figure 20A Representative images (scale bar, 5 μm) of WT cortical neurons treated with control or TRIM11 ASO #5 are shown, as analyzed for the expression of SYP and PSD95. Figure 20B Showing from Figure 20A Co-localization of SYP-reactive and PSD95-reactive spots (mean ± SEM, n=6). Figure 20C Representative images (scale bar, 10 μm) of NFL and MAP2 staining in WT cortical neurons treated with control or TRIM11 ASO #5 are shown. Corresponding to Figure 5, J to L. For Figure 20B , p<0.01; unpaired student t-test.

[0047] Figure 21, including Figures 21A to 21I The results showed representative findings that TRIM11 reduced tau pathology and neuroinflammation in PS19 mice. Figure 21A Representative images (scale bar, 0.2 mm) of the CA1 and DG regions of the brains of PS19 mice injected with AAV-GFP or AAV9-TRIM11 and stained with AT8 are shown. Figure 6B Related. Figure 21B Showing Figure 6C The quantification of the protein blot normalized to the loading control shown in the figure confirms that TRIM11 strongly reduced p-tau content in the SN and PE fractions of the hippocampal lysate (AT8 in PE, ~81%; PHF1 in PE, ~98%; AT8 in SN, ~52%; PHF1 in SN, ~89%). Figure 21C Showing Figure 6C The quantification of total tau in the protein blot normalized to the corresponding fractions shown in the figure confirms that TRIM11 strongly reduces p-tau content in the SN and PE fractions of the hippocampal lysate (AT8 in PE, ~59%; PHF1 in PE, ~83%; AT8 in SN, ~56%; PHF1 in SN, ~92%). Figure 21D Showing Figure 6C The normalization to the loading control protein blot quantification is shown in the figure. Figure 21E Representative images of the hippocampus and CA3 region of the brains of PS19 mice injected with AAV9-GFP or AAV9-TRIM11 and age-matched wild-type littermates, stained with anti-GFAP antibody, are shown. Figure 21F It shows, as Figure 21E Representative images of the hippocampus and CA3 region of the brain of PS19 mice stained with anti-Iba1 antibody after treatment. Figures 6D to 6G Related. Figure 21G Representative images of the hippocampus of the brains of PS19 mice injected with AAV9-GFP or AAV9-TRIM11 and wild-type mice were shown, probed with anti-MAP2(G) antibody. Figure 21H It shows, as Figure 21G Representative images of the hippocampus in the brains of PS19 mice probed with anti-NFL antibody. (Compared to...) Figures 6H to 6K Related. Figure 21I Representative images of the brains of PS19 mice injected with AAV9-GFP or AAV9-TRIM11 and wild-type mice, stained with antibodies detecting NeuN, are shown. Corresponding to Figure 6, L and M. For Figure 21A and Figures 21E to 21I The scale is 0.2 mm. For Figures 21B to 21D The data are expressed as mean ± SD; n=3; p<0.05; p<0.01; p<0.001; ns, not significant; unpaired Student's t-test.

[0048] Figure 22, including Figures 22A to 22F The results showed representative findings that TRIM11 improved PFF-accelerated tau pathology and neuroinflammation in PS19 mice. Figure 22A Representative images of the CA1 and DG regions of the brain of PS19 mice injected with tau K18 PFF along with AAV-GFP or AAV9-TRIM11 and stained with AT8 are shown. Figure 7B Related. Figure 22B Showing Figure 7C The normalized quantification of protein blots to the sample loading shown in the figure confirms that TRIM11 strongly reduces p-tau content in the SN and PE fractions of hippocampal lysates (AT8 in PE, ~86%; PHF1 in PE, ~76%; AT8 in SN, ~100%; PHF1 in SN, ~89%). Figure 22C Showing Figure 7C The quantitative analysis of total tau in the protein blot normalized to the corresponding fractions, shown in the figure, confirms that TRIM11 strongly reduces p-tau content in the SN and PE fractions of the hippocampal lysate (AT8 in PE, ~74%; PHF1 in PE, ~57%; AT8 in SN, ~100%; PHF1 in SN, ~93%). Figure 22D Showing Figure 7C The normalized quantification of protein blots to the sample loading shown in the figure confirms that TRIM11 reduces total tau in the insoluble fraction (~45%) and increases total tau in the soluble fraction (~38%), while having minimal effect on total tau in the WCL. Figure 22E Representative images of the hippocampus and CA3 region of the brain of PS19 mice injected with tau K18 PFF along with AAV9-GFP or AAV9-TRIM11 and stained with antibody against GFAP are shown. Figure 22F It shows, as Figure 22E Representative images of the hippocampus and CA3 region of the brain of PS19 mice stained with anti-Iba1 antibody after treatment. Figure 7D and Figure 7E Related. For Figure 22A , Figure 22E and Figure 22F The scale is 0.2 mm. For Figures 22A to 22D The data are expressed as mean ± SD; n=5; p<0.05; p<0.01; p<0.001; ns, not significant; unpaired Student's t-test.

[0049] Figure 23, including Figures 23A to 23F Representative results confirmed that intraperitoneal (IP) injection of AAV9-TRIM11 improved tau pathology and neuroinflammation in 3×Tg-AD mice. Figure 23A Representative images of the CA1 region of the brain, stained with AT8, are shown in uninjected 3×Tg-AD mice at 12 months of age and in 3×Tg-AD mice injected with AAV-GFP- or AAV9-TRIM11- at 13 months of age. Figure 7B Related. Figure 23B Showing Figure 8C The normalized quantification of protein blots to the sample loading shown in the figure confirms that TRIM11 strongly reduces p-tau material (~70 to 90%) in the SN and PE portions of hippocampal lysates. Figure 23C Showing Figure 8C The quantitative analysis of total tau in the protein blot, normalized to the corresponding fractions, shown in the figure confirms that TRIM11 strongly reduces p-tau content in the SN and PE fractions of the hippocampal lysate. Figure 23D Showing Figure 8C Normalized to the quantification of protein blots loaded with samples, TRIM11 strongly reduced total tau in PE (~45%) and moderately reduced total tau in SN and WCL (both ~20%). Figure 23E Representative images of the CA3 and DG regions of the brains of 3×Tg-AD mice injected with tau K18 PFF and AAV9-GFP or AAV9-TRIM11 and stained with GFAP antibody are shown. Figure 23F Shown in Figure 23E Representative images of the CA3 and DG regions of the brain in 3×Tg-AD mice stained with iBl1 antibody after treatment. Figure 8D and Figure 8E Related. For Figure 23A , Figure 23E and Figure 23F The scale is 0.2 mm. For Figures 23B to 23C The data are expressed as mean ± SD; n=5; p<0.05; ns, not significant; unpaired Student's t-test.

[0050] Figure 24, including Figures 24A to 24E The results showed representative findings that delivery of AAV9-TRIM11 via ICV injection improved tau pathology and neuroinflammation in 3×Tg-AD mice. Figure 24A Showing Figure 8LThe normalized quantification of protein blots to the sample loading shown in the figure confirms that TRIM11 reduces p-tau material in the SN and PE portions of hippocampal lysates by ~80 to 93%. Figure 24B Showing Figure 8L The normalization to the quantification of the loaded protein blots shown in the figure confirms that TRIM11 reduces total tau in the insoluble fraction (~80%) and WCL (~65%), and moderately reduces total tau in the soluble fraction (~43%). Figure 24C Showing Figure 8L The quantification of total tau normalized to each fraction shown in the Western blot confirms that TRIM11 strongly reduces SN p-tau (~68-80%), but only minimally or moderately reduces PE p-tau (~45% to 0%). Figure 24D Representative images of the hippocampus and CA1, CA3 and DG regions of the brain of 3×Tg-AD mice injected with tau K18 PFF and AAV9-GFP or AAV9-TRIM11 and stained with GFAP antibody are shown. Figure 24E It shows, as Figure 24D Representative images of the hippocampus and CA1, CA3, and DG regions of the brain of 3×Tg-AD mice stained with Iba1 antibody after treatment. Figure 8M and Figure 8N Related. For Figure 24D and Figure 24E The scale is 0.2 mm. For Figures 24A to 24C The data are expressed as mean ± SD; n=6; p<0.05; p<0.01; p<0.001; ns, not significant; unpaired Student's t-test.

[0051] Figure 25, including Figures 25A to 25C This study presents representative results confirming the effect of TRIM protein on tau protein levels. Figure 25A A schematic diagram of the BiFC assay for tau self-binding is shown. VN173 and VC155 contain amino acids 1 to 172 and 155 to 238 of Venus, respectively. Figure 25B Representative images (top) and quantifications of BiFC signaling are shown in HEK293T cells expressing tau-VN and tau-VC alone or together. Figure 25C Representative images of Western blots from HEK293T cells co-expressing tau-VN and tau-VC, along with the specified TRIM protein, are shown. The TRIM protein that reduces BiFC signaling levels is highlighted in the box.

[0052] Figure 26Representative images of HEK293T cells co-expressing tau-VN and tau-VC, as well as the specified TRIM protein, are shown, confirming the effect of TRIM protein on tau self-binding. Figure 25C Related.

[0053] Figure 27 Representative quantifications of BiFC fluorescence in HEK293T cells expressing tau-VN and tau-VC, as well as the designated TRIM protein, are shown, confirming the effect of TRIM protein on tau self-binding. TRIM proteins with reduced fluorescence signal are indicated in red. Figure 1C Related to Figure 2. Data are mean ± SD; n=3; p<0.005; unpaired student t-test.

[0054] Figure 28 Representative images of Western blots from HEK293T cells expressing GFP-α-Syn-A53T and designated TROM proteins are shown, confirming the effect of TRIM proteins on α-Syn-A53T aggregation. TRIM proteins that reduce α-Syn-A53T levels are marked in red. The expected full-length TRIM band is indicated by a red arrow.

[0055] Figure 29, including Figures 29A to 29C This demonstrates the representative effect of TRIM protein on α-Syn self-binding. Figure 29A A schematic diagram of a BiFC assay based on Venus (an improved form of yellow fluorescent protein (YFP)) for self-binding of α-Syn is shown. Figure 29B Representative images (top) of HEK293T cells expressing V1S and SV2 individually or together and quantification of BiFC signaling are shown (bottom). Figure 29C Representative images of Western blots from HEK293T cells co-expressing V1S and SV2, as well as the designated TRIM protein, are shown. TRIM proteins with reduced BiFC signaling are marked in red. The expected full-length TRIM bands are indicated by red arrows.

[0056] Figure 30 Representative fluorescence images of tHEK293T cells co-expressing V1S and SV2, as well as the designated TRIM protein, are shown, confirming the effect of TRIM protein on α-Syn self-binding. Figure 29C Related.

[0057] Figure 31 Representative quantifications of BiFC fluorescence signals in HEK293T cells co-expressing V1S and SV2, as well as the specified TRIM protein, are shown, confirming the effect of TRIM protein on α-Syn self-binding. Data are mean ± SD; n=3. Figure 29C and Figure 30 Related.

[0058] Figure 32 Representative images of Western blots of SOD1 G93A-GFP lysed in a buffer containing NP-40 and separated by sedimentation into soluble supernatant (SN) and insoluble precipitate particles (PE), and HEK293T cells transfected with a control vector (-) or a specified TRIM protein, confirm the effect of TRIM protein on SOD1. The expected full-length TRIM band is indicated by a green arrow. TRIM protein that significantly reduces insoluble SOD1 G93A-GFP material is marked in red.

[0059] Figure 33, including Figures 33A to 33F This demonstrates representative results of testing TRIM11, which targets pathogenic SOD1 for proteasome degradation. Figure 33A This demonstrates the expression of SOD1 93A-GFP using empty vector (EV), TRIM11, or TRIM11. 2EA A representative image of Western blots on transfected HEK293T cells, which confirms that TRIM11 reduces the level of SOD1 G93A. Figure 33B Representative images of Western blots of HEK293T cells transfected with SOD1 G93A-GFP and EV or TRIM11 and treated with CHX for a specified duration are shown, confirming that TRIM11 accelerates the degradation of SOD1 G93A-GFP. Figure 33C Representative images of Western blots from NSC-34 cells expressing WT-hSOD-GFP or G93A-hSOD-GFP are shown. Cells were treated with 1 μg Dox for 24 h to induce SOD1 expression, followed by transfection with an empty vector (EV) or gradually increasing doses of FLAG-TRIM11, with 0.5 μg mCherry-N1 as a control for transfection efficiency. Cells were treated with the proteasome inhibitor MG132 (10 μM) for 8 h, or with the lysosomal inhibitor leucine (10 mM) plus NH4Cl (20 mM) (L+N) for 16 h. c-Myc and p62 were used to validate proteasome and lysosomal inhibition, respectively. The data are representative of three independent experiments. Figure 33D Representative images of Western blots from Neuo-2A cells treated with 100 μM H2O2 for 48 h and transiently transfected with EV or gradually increasing amounts of FLAG-TRIM11 are shown, followed by grading analysis to explore endogenous SOD1. 0.5 μg mCherry-N1 was co-transfected with a FLAG vector as an indicator of equivalent transfection. Figure 33ERepresentative images of Western blots from NSC-34 cells expressing WT-hSOD-GFP or G93A-hSOD-GFP are shown. These cells were treated with 1 μg Dox for 24 h to induce SOD1 expression and transiently transfected with 2 μg EV or FLAG-TRIM11 plus 0.5 μg mCherry-N1. Cells were then cultured in Dox-free medium for a specified time, followed by Western blot analysis of the SN and PE fractions, as well as whole-cell lysates (WCL). Figure 33F Representative images of Western blots from NSC-34 cells expressing WT-hSOD-GFP and G93A-hSOD-GFP are shown. These cells were treated with Dox to induce SOD1 expression and transfected with either EV or FLAG-TRIM11 (2 μg each). Forty h post-transfection, cells were lysed in RIPA buffer and then subjected to reciprocal IP using either anti-FLAG (M2) beads or anti-GFP conjugated agarose beads. Inputs represent 10% RIPA lysis. Stable NSC-34 cells expressing TRIM11, uninduced by Dox, were used as controls (lane 1) to demonstrate binding specificity. Data are representative of three independent experiments.

[0060] Figure 34, including Figures 34A to 34J The results show representative findings of testing TRIM11's improvement of pathological and neuroinflammatory effects in SOD1-G93A mice. Figure 34A A schematic diagram of the study is shown. Figure 34B Representative images of the cortex and spinal cord of control mice and mice injected with AAV9-GFP or AAV9-TRIM11 are shown, which confirm that TRIM11 reduces SOD1-G93A staining in the cortex and spinal cord. Figure 34C Showing Figure 34B Quantitative analysis of SOD1 G93A staining in the cortex (n=15 mice / group). Figure 34D Showing Figure 34B Quantification of SOD1 G93A staining in the spinal cord (WT, n=7; GFP, n=8; and TRIM11, n=10). Figure 34E Representative images of the cortex and spinal cord of control SOD1-G93A mice stained with antibodies specific to GFAP and SOD1-G03A mice injected with AAV9-GFP- or AAV9-TRIM11 are shown, which confirm that TRIM11 reduces astrocyte gliosis in SOD1-G93A mice. Figure 34F Showing Figure 34E Quantification of GFAP immunoreactivity in the cortex (WT, n=13; GFP and TRIM11, n=15). Figure 34G Showing Figure 34EQuantification of GFAP immunoreactivity in the spinal cord (WT, n=7; GFP, n=8; or TRIM11, n=10). Figure 34H It shows, as Figure 34E Representative images of the cortex and spinal cord of mice stained with an antibody specific to Iba1, which confirmed that TRIM11 reduced microglial proliferation in SOD1 G93A mice. Figure 34I Showing Figure 34H Quantification of Iba1 immunoreactivity in the cortex. Figure 34J Showing Figure 34H Quantification of Iba1 immunoreactivity in the spinal cord. Figure 34I and Figure 34J WT, n=7; GFP, n=8; or TRIM11, n=10. For Figure 34B , Figure 34E and Figure 34H The scale is 0.2 mm. For Figure 34C , Figure 34F and Figure 34I Six to seven cortical areas were analyzed in each mouse. For Figure 34D , Figure 34G and Figure 34J Three to four spinal cord regions were analyzed in each mouse. For Figure 34C , Figure 34D , Figure 34F , Figure 34G , Figure 34I and Figure 34J The data are expressed as mean ± SD; p<0.01; p < 0.005; , p<0.001; unpaired student t-test.

[0061] Figure 35, including Figure 35A and Figure 35B This study presents representative results of testing TRIM11 in SOD1 G93A mice to reduce protein aggregation, neuroinflammation, and apoptosis. Figure 35A Representative images of cortical proteomic blots from non-transgenic (Ntg) and hSOD1 G93A transgenic mice injected with AAV9-GFP or AAV9-TRIM11-HA fractions graded as NP-40 soluble (SN) and 2% SDS soluble (PE). Figure 35B Showing from Figure 35ARepresentative images of protein blots from the spinal cord of mice. GFP and HA indicate successful intraventricular (ICV) injection of AAV into the central and peripheral nervous systems. GFAP and Iba1 were used as markers for astrocytes and microglia, respectively. Cleavage of caspase 3 (C-CASP3) is a marker of apoptosis. Arrows indicate SOD1 monomers and dimers. SE: short exposure; LE: long exposure. Data are representative of two independent experiments.

[0062] Figure 36, including Figures 36A to 36E This demonstrates representative results of testing TRIM11 to rescue behavioral deficits in SOD1 G93A mice. Figure 36A Representative quantifications of travel distance in mice injected with AAV9-GFP and mice injected with AAV9-TRIM11 are shown (n=27 for GFP; n=29 for TRIM11). Figure 36B Representative quantifications of kinetic time were shown for mice injected with AAV9-GFP and mice injected with AAV9-TRIM11 (n=22 for GFP; n=21 for TRIM11). Figure 36C The study showed representative improvements in motor performance in mice injected with AAV9-TRIM11 compared to mice injected with AAV9-GFP, as indicated by increased latency to fall on wire hang (n=21). Figure 36D The study showed a representative improvement in motor performance in mice injected with AAV9-TRIM11 compared to mice injected with AAV9-GFP, as indicated by the increased latency to fall on rotarod, where the speed was increased from 4 RPM to 40 RPM (n=22 for GFP; n=21 for TRIM11). Figure 36E This study demonstrates a representative correlation between TRIM11 expression levels and improvements in motor function during the rotarod test. For Figures 36A to 36D The data are expressed as mean ± SD; p<0.05; p<0.01; p<0.005; unpaired student t-test.

[0063] Figure 37, including Figures 37A to 37C This presents representative results from a systematic analysis of the effects of TRIM on TDP43. Figure 37A Representative images of Western blots from HEK293T cells transfected with TDP43-Q331K-GFP and control vector (-) or specified TRIM protein are shown. Figure 37BRepresentative images of Western blots from HEK293T cells transfected with TDP43-Q331K-GFP and control vector (-) or the specified TRIM protein are shown. Cells were lysed in buffer containing NP-40, separated into soluble supernatant (SN) and insoluble precipitate (PE) fractions by sedimentation, and analyzed by Western blot. Figure 37A and Figure 37B Blue arrows indicate the expected full-length TRIM bands. Red arrows mark TRIM proteins that significantly reduce the insoluble TDP43-Q331K-GFP material. Figure 37C Representative images of Western blots from SH-SY5Y cells stably expressing GFP-TDP-43 5FL or GFP-TDP-43 Q331K, transduced with either a control lentiviral vector (-) or a lentiviral vector expressing TRIM11, are shown, confirming that TRIM11 reduced the level of insoluble TDP43 mutants, rather than soluble TDP43 mutants. Cells were lysed in buffer containing NP40, and the soluble supernatant (SN) and insoluble fraction were separated by sedimentation. Insoluble precipitate particles were dissolved in buffer containing SDS. SDS-resistant precipitate particles (SR) were analyzed by dot blot analysis. WCL, whole cell lysate.

[0064] Figure 38, including Figures 38A to 38J This study demonstrates representative results of TRIM11's ability to improve protein aggregation and neuroinflammation in a TDP-43-ALS mouse model. Figure 38A A schematic diagram of the study is shown. Figure 38B Representative images of the cortex and spinal cord of control Tar4 / 4 mice and Tar4 / 4 mice injected with AAV9-GFP or AAV9-TRIM11 are shown, confirming that TRIM11 reduces the level of TDP-43 in the cortex and spinal cord. Figure 38C Showing Figure 28 Quantification of TDP-43 staining in the cortex of B (n=9 for WT; n=13 for GFP and TRIM11). Figure 38D Showing Figure 38B Quantification of TDP-43 staining in the spinal cord (n=5 for WT; n=13 for GFP and TRIM11). Figure 38E Representative images of the cortex and spinal cord of control Tar4 / 4 mice stained with antibodies specific to GFAP and Tar4 / 4 mice injected with AAV9-GFP or AAV9-TRIM11 are shown, which confirm that TRIM11 reduces astrocyte gliosis in Tar4 / 4 mice. Figure 38F Showing Figure 38EQuantification of GFAP immunoreactivity in the cortex (n=5 for WT; n=6 for GFP; or n=10 for TRIM11). Figure 38G Showing Figure 38E Quantification of GFAP immunoreactivity in the spinal cord (n=4 for WT; or n=6 for GFP and TRIM11). Figure 38H It shows, as Figure 38E Representative images of the cortex and spinal cord of mice treated with an antibody specific to Iba1, which confirmed that TRIM11 reduced microglial cell proliferation. Figure 38I Showing Figure 38H Quantification of Iba1 immunoreactivity in the cortex (n=5 for WT; n=6 for GFP; or n=8 for TRIM11). Figure 38J Quantification of Iba1 immunoreactivity in the spinal cord was shown (n=5 for WT and GFP; or n=7 for TRIM11). Figure 38B , Figure 38E and Figure 38H The scale is 0.2 mm. For Figure 38C , Figure 38D , Figure 38F , Figure 38G , Figure 38I and Figure 38J The data are expressed as mean ± SD; p<0.05; p<0.01; p < 0.005; , p<0.001; unpaired student t-test.

[0065] Figure 39 Representative results of testing TRIM11's reduction of TDP-43 aggregation and apoptosis in a TDP-43-ALS mouse model are shown. Whole brain lysates from non-transgenic (Ntg) and ALS-affected mice (TAR4 / 4) injected with AAV9-GFP or AAV9-TRIM-HA were separated into NP-40-soluble (SN) and 2% SDS-soluble (PE) fractions. GFP and HA indicate successful intraventricular (ICV) injection of AAV into the brain. GFAP and Iba1 were used as markers for astrocytes and microglia, respectively. Cleavage of PARP and cleavage of caspase 3 (C-CASP3) were both markers of apoptosis. Arrows indicate full-length, 35 kDa, or 25 kDa TDP-43. The 25 kDa fragment was associated with TDP-43 protein aggregation load. GAPDH and lamin A / C were selected as markers for the cytoplasmic and nuclear fractions, respectively. SE: short exposure; LE: long exposure. The data are representative of two independent experiments.

[0066] Figure 40, including Figures 40A to 40P The results show representative findings of testing TRIM10 to reduce the levels of a variety of misfoldable proteins. Figure 40A Representative images of Western blots are shown of HEK293T cells transfected with GFP-tagged tau or tau P301L and gradually increasing amounts of Flag-TRIM10 for 36 hours. Figure 40B Representative images of Western blots are shown of HEK293T cells transfected with GFP-tagged α-Syn-A53T and gradually increasing amounts of Flag-TRIM10 for 36 hours. Figure 40C Representative images of Western blots from HEK293T cells transfected with GFP-tagged SOD1 and gradually increasing amounts of Flag-TRIM10 for 36 hours are shown. Figure 40D Representative images of Western blots are shown of HEK293T cells transfected with GFP-tagged TDP-40, TDP-43 M337V, or TDP-43 Q331K, and gradually increasing amounts of Flag-TRIM10 for 36 hours. Figure 40E Representative images of Western blots from HEK293T cells transfected with GFP-tagged FUS and gradually increasing amounts of Flag-TRIM10 for 36 hours are shown. Figure 40F Representative images of Western blots are shown of HEK293T cells transfected with GFP-tagged Atxn1 82Q and gradually increasing amounts of Flag-TRIM10 for 36 hours. Figure 40G Representative images of Western blots are shown of HEK293T cells transfected with Flag-TRIM10 and GFP-Atxn1 82Q or 30Q for 36 hours, or HEK293T cells knocked down with TRIM10 for 36 hours. Figure 40H Representative images of Western blots are shown 36 hours after TRIM10 knockdown of HEK293T cells with or without GFP-Atxn1 82Q transfection. Figure 40I Representative images of Western blots are shown of HEK293T cells transfected with GFP-tagged Htt-72Q and gradually increasing amounts of Flag-TRIM10 for 36 hours. Figure 40J This shows the results of RT-PCR analysis of samples from... Figure 40A Quantification of tau mRNA in cells treated with the medium. Figure 40K This shows the results of RT-PCR analysis of samples from... Figure 40B Quantification of α-Syn-A53T mRNA in cells treated with the medium. Figure 40L This shows the results of RT-PCR analysis of samples from... Figure 40C Quantification of SOD1 mRNA in cells treated with the medium. Figure 40M This shows the results of RT-PCR analysis of samples from... Figure 40D Quantification of TDP-43 mRNA in cells treated with the medium. Figure 40N This shows the results of RT-PCR analysis of samples from... Figure 40E Quantification of FUS mRNA in cells treated with the medium. Figure 40O This shows the results of RT-PCR analysis of samples from... Figure 40G Quantification of Htt 72Q mRNA in cells treated with the medium. Figure 40P This shows the results of RT-PCR analysis of samples from... Figure 40H Quantification of ataxia protein mRNA in cells treated with [a specific method]. Figures 40J to 40P Data are expressed as mean ± SD; n = 3; ns, not significant; unpaired Student's t-test. WCL, whole cell lysate; PE, precipitate particle fraction; SN, soluble supernatant fraction.

[0067] Figure 41, including Figures 41A to 41K This demonstrates representative results of testing TRIM10's ability to promote proteasomal degradation of proteins prone to misfolding. Figure 41A Representative images of Western blots of HEK293T cells expressing GFP-Atxn1 82Q and gradually increasing amounts of TRIM10 are shown. Cells were treated with 10 μM MG132 for 6 hours and / or NH4Cl and leucine (LN) (with p62 and LC3 as controls). Figure 41B Representative images of Western blots are shown, obtained after transfection of HEK293T cells with GFP-tagged tau or tau P301L for 36 hours with or without Flag-TRIM10 and treatment with MG132 for 6 hours. Figure 41C Representative images of Western blots are shown, with or without Flag-TRIM10, after 36 hours of transfection of HEK293T cells with GFP-tagged α-Syn-A53T followed by 6 hours of treatment with MG132. Figure 41D Representative images of Western blots are shown, obtained after transfection of HEK293T cells with GFP-tagged SOD1 or SOD1 G93A for 36 hours and treatment with MG132 for 6 hours, with or without Flag-TRIM10. Figure 41E Representative images of Western blots are shown, obtained by transfecting HEK293T cells with GFP-tagged TDP-43, TDP-43 M337V, or TDP-43 Q331K for 36 hours with or without Flag-TRIM10 and then treating them with MG132 for 6 hours. Figure 41FRepresentative images of Western blots are shown, obtained by transfecting HEK293T cells with GFP-tagged FUS for 36 hours with or without Flag-TRIM10 and then treating them with MG132 for 6 hours. Figure 41G Representative images of Western blots are shown, obtained by transfecting HEK293T cells with GFP-tagged Htt-72Q for 36 hours with or without Flag-TRIM10 and then treating them with MG132 for 6 hours. Figure 41H Representative images of Western blots obtained from GFP-Atxn1 82Q turnover of actinomycin (CHX) tracking assays in HEK293T cells with or without Flag-TRIM10 are shown. Figure 41I The relative GFP-Atxn1 82Q / actin ratio is shown as a quantification by Image J analysis. Data are expressed as mean ± SD. P <0.001. Figure 41J Representative confocal images of HEK293T cells expressing GFP-Atxn1 82Q and mCherry-TRIM10, treated with 10 μM MG132 for 6 hours, fixed, and stained with Hoechst, are shown. Figure 41K Showing from Figure 41J A representative quantification of the percentage of cells with TRIM10 accumulation in the nucleus.

[0068] Figure 42, including Figures 42A to 42I This demonstrates representative results of testing TRIM10 as a molecular chaperone for a variety of client proteins. Figure 42A Representative results of ThT binding assays of α-Syn monomer fibrillation (70 μM) are shown with or without specified concentrations of GST or Flat-TRIM10. Quantification is shown on the left, and Western blot is shown on the right. Figure 42B Representative electron microscopy images (scale bar, 500 nm) of α-Syn monomer fibrillation (70 μM) in the presence of GST or 0.5 μM Flag-TRIM10 are shown. Figure 42C Representative results of ThT binding assays for α-Syn (70 μM) fibrillation are shown in the presence or absence of GST, Flag-TRIM10, or Hsp70 / Hsp40-Hsp104 (0.5 μM each). The ATP regeneration system includes heat shock proteins but excludes TRIM10 (all subsequent experiments used heat shock proteins but not TRIM10, and also included ATP and the ATP regeneration system). Figure 42DRepresentative images of protein blots showing α-Syn fibrillation (70 μM) in the presence of GST and TRIM10 (50–500 nM), as well as dot blots of precipitated particles (PE) and SDS-resistant (SR) aggregates, and total α-Syn and cross-linked via disuccinimide octanoate (DSS) (for soluble oligomers). Figure 42E Representative images of Western blots are shown 36 hours after HEK293T cells were transfected with Flag-TRIM10 and GFP-α-Syn-A53T. Figure 42F Representative protein blots of Aβ42 monomer (10 μM) fibrillation are shown in the absence or presence of TRIM10 (50–200 nM). Figure 42G Representative results of ThT binding assays of Aβ42 monomer (10 μM) are shown in the presence or absence of TRIM10 (50–200 nM). Figure 42H Representative viability of SH-SY5Y cells treated with Aβ42, with or without pre-incubation with TRIM10, is shown. Figure 42I Representative images of the protein blots showing the inhibition of Atxn1 82Q aggregation mediated by Flag-TRIM10 (0.5 μM) are displayed. The relative amounts of Atxn1 82Q in each fraction are shown. Figure 42A , Figure 42C and Figure 42H The data are mean ± SD; n=3; p<0.05; p<0.01; unpaired student t-test.

[0069] Figure 43, including Figures 43A to 43H This shows representative results of testing TRIM10 as a depolymerase for a variety of client proteins. Figure 43A Representative results for ThT binding assays of α-Syn PFF (0.5 μM) treated with GST, Flag-TRIM10 (at gradually increasing concentrations), or HSP are shown. Figure 43B Representative images of protein blots of α-Syn PFF (0.5 μM) treated with GST, Flag-TRIM10 (0.1, 0.2, and 0.5 μM), or HSP are shown. Figure 43C Representative images of dotted imprints of α-Syn fibrils (0.5 μM) treated with GST (0.2 μM), a specified concentration of Glag-TRIM10, or HSP are shown, confirming that TRIM10 dissolves α-Syn. Figure 43D Representative electron microscopy images of the depolymerization of α-Syn PFF (0.5 μM) fibrils when treated with GST or 0.5 μM Flag-TRIM10 (scale bar, 500 nm) are shown. Figure 43E Representative images of dotted blots of α-Syn fibrils (0.5 μM) treated with GST (0.2 μM), Flag-TRIM10 (0.5 μM), HSP, or TRIM10 and HSP are shown, confirming that TRIM10 dissolves α-Syn. Quantification of soluble α-Syn relative to total α-Syn (n=3). Figure 43F Representative images of protein blots and dot blots of Aβ42 fibrils incubated with GST, TRIM10 (50–500 μM), or DAXX (400 nM) are shown. Figure 43G Representative results of ThT binding assays of Aβ42 fibrils incubated with GST, TRIM10 (50-500 nM), or DAXX (400 nM) are shown. Figure 43H Representative images of protein blots and dot blots of Atxn1 82Q aggregates pre-formed at 50 nM with GST or Flag-TRIM10 (at 0, 200 nM, and 500 nM, respectively) incubated for 3 hours are shown. For Figure 43A and Figure 43G The data are expressed as mean ± SD; n=4; p<0.01; , p<0.001; unpaired student t-test.

[0070] Figure 44, including Figures 44A to 44E This shows representative experimental results of TRIM that can prevent TDP-43 aggregation. GFP-TDP-43 NLRm Transfect HeLa cells alone (-) or with the specified TRIM. Treat cells with sodium arsenite (Ars) (+) or not (-) and stain with anti-HA antibody (for TRIM) and Hoechst 33342 (for DNA). Figure 44A The study showed that cytoplasmic GFP-TDP-43 was present or absent with TRIM10, TRIM11, TRIM17, and TRIM55. NLRm Representative immunofluorescence images of cells in aggregates. Figure 44B , Figure 44C , Figure 44D and Figure 44E The results show the effects of cytoplasmic GFP-TDP-43 in the presence or absence of TRIM10, TRIM11, TRIM17, and TRIM55. NLRm Quantification of cells in aggregates. Data are mean ± SD, n=3. (Scale bar, 10 μm). P <0.01, P <0.001, unpaired Student's t-test.

[0071] Figure 45, including Figures 45A to 45G The results showed representative experimental findings that confirmed the downregulation of TRIM11 and TRIM10 in the FTLD-TDP brain. Figure 45A Representative immunoblots of postmortem frontal cortical gray matter from 11 controls and 11 FTLD-TDP individuals are shown. Figure 45B The relative TRIM11 / actin ratio was quantified. Figure 45C Representative IHC images of TRIM11 and pS409 / 410 TDP-43 in the frontal cortex are shown. (Scale bar, 160 mm). Figure 45D A graph illustrating the negative correlation between TRIM11 and pS409 / 410 TDP-43 levels in FTLD-TDP and control tissues is shown. The r and p values ​​of the Pearson correlation coefficient are also displayed. Figure 45E Representative immunoblots of postmortem frontal cortical gray matter from 11 controls and 11 FTLD-TDP individuals are shown. Figure 45F The relative TRIM10 / GAPDH protein ratio was quantified. Figure 45G The relative mRNA levels were quantified. The #1 control and #1 and #7 FTLP-TDP samples were used for both blots to compare between them. P <0.01, P <0.001; ns, not significant; unpaired Student's t-test.

[0072] Figure 46, including Figures 46A to 46G The results show representative experimental findings that confirm the role of endogenous TRIM11 and TRIM10 in regulating TDP-43. Figure 46A , Figure 46B and Figure 46C Representative immunofluorescence images, quantitative data of pS409 / 410 intensity, and representative Western blots of cortical neurons treated with control or TRIM11 ASO are shown, respectively. Figure 46D Representative immunofluorescence images of endogenous TDP-43 in control and TRIM10 KO HeLa cells treated with either control or TRIM10 ASO are shown (scale bar, 10 μm). Figure 46E This demonstrates the quantification of HeLa cells with TDP-43 mislocalization. P <0.001, unpaired Student's t-test). Figure 46FRepresentative immunofluorescence images of endogenous TDP-43 in primary cortical neurons of mice treated with either control or TRIM10 ASO are shown (scale bar, 10 μm). Figure 46G This demonstrates the quantification of cells with TDP-43 mislocalization in primary neurons. P <0.001, unpaired Student's t-test).

[0073] Figure 47, including Figures 47A to 47D The results show representative experimental results, which confirm that TRIM10 is the molecular chaperone and depolymerase of TDP-43. Figure 47A Representative electron microscope images of the experiment are shown, and Figure 47B Representative protein blots from sedimentation assays are shown, in which MBP-TDP-43 (5 μM) was treated with TEV and incubated for 24 h with or without TRIM10 (0.25 or 0.5 μM). Figure 47C Representative electron microscope images of the experiment are shown, and Figure 47D Representative protein blots from sedimentation assays are shown, with TDP-43 protofibrils (5 μM monomer concentration) incubated with or without TRIM10 (0.25 or 0.5 μM). SN, supernatant; PE, SDS-soluble precipitate particles; SR, SDS-resistant precipitate particles (detected by dot blot). Scale bar, 500 nm. Kapβ2 (2.5 and / or 5 μM), which does not act on TDP-43, was used as a negative control.

[0074] Figure 48, including Figures 48A to 48Q The results show representative experimental results, which confirm that TRIM10 maintains the nuclear localization of FUS. Figure 48A Representative immunofluorescence images of HeLa cells transfected with EGFP-FUS plus empty vector (EV), TRIM10-FLAG-HA, or Kapβ2-FLAG-HA are shown, treated with (+Ars) or without (-Ars) 0.5 mM sodium arsenite for 90 min. Cells were stained with anti-HA, G3BP1, and Hoechst 33342. (Scale bar, 10 μm). Figure 48B The percentage of cells with GFP-FUS in the SG is quantified. Figure 48C Representative Western blots from the experiments are shown, in which HeLa cells were transfected with EGFP-FUS and either an empty vector or TRIM10 for 24 hours, followed by treatment with 0.5 mM sodium arsenite for 90 min. Cytoplasmic and nuclear components were separated for Western blotting. Laminarin A / C and GAPDH were used as loading controls for the nuclear and cytoplasmic components, respectively. Figure 48DRepresentative immunofluorescence images of HeLa cells transfected with mCherry-N1 or mCherry-N1-TRIM10, treated with (+Ars) or without (-Ars) 0.5 mM sodium arsenite for 90 min, are shown. Cells were stained with anti-G3BP1, FUS, and Hoechst 33342. (Scale bar, 10 μm). Figure 48E The percentage of cells with FUS in the SG is quantified. Figure 48F Representative immunofluorescence images of WT spinal cord neurons transfected with empty vector or TRIM10 24 h are shown. Cells were treated with arsenite (0.5 mM) or without for an additional hour and stained with anti-HA, FUS, and MAP2 antibodies and Hoechst 33342. (Scale bar, 10 μm). Figure 48G The quantification of cells with FUS in the cytoplasm is shown. Figure 48H Representative immunofluorescence images are shown, demonstrating that TRIM10 knockout promotes SG binding of GFP-FUS. GFP-FUS was transfected into control or TRIM10 knockout HeLa cells for 24 hours. Cells were treated with arsenite (0.5 mM) or without for an additional 30 min and stained with anti-G3BP1 antibody and Hoechst 33342. (Scale bar, 10 μm). Figure 48I The quantification of cells with FUS in SG is shown. Figure 48J Representative immunofluorescence images are shown, demonstrating that TRIM10 knockout promotes SG binding of endogenous FUS. Control and TRIM10-knockdown HeLa cells were stained with anti-FUS antibody and Hoechst 33342 (scale bar, 10 μm). Figure 48K This shows a quantification of the percentage of cells with FUS in the cytoplasm. Figure 48L Representative immunofluorescence images are shown, depicting WT cortical neurons transduced for 3 days with control or TRIM10 #1 ASO and stained with anti-FUS, MAP2 antibody and Hoechst 33342. (Scale bar, 10 μm). Figure 48M The quantification of cells with FUS in the cytoplasm is shown. Figure 48N Representative immunofluorescence images are shown, depicting HeLa cells transfected with EGFP-FUS (G156E) along with TRIM10. Cells were treated with 0.5 mM sodium arsenite (+Ars) or without (-Ars) for 90 min, stained with anti-HA and anti-G3BP1 antibodies and Hoechst 33342, and analyzed by confocal microscopy. (Scale bar, 10 μm). Figure 48O This shows a quantification of the percentage of cells with FUS G156E in the SG, with or without TRIM10. Figure 48PRepresentative immunofluorescence images are shown, depicting wild-type spinal cord neurons transfected for 24 h with EGFP-FUS (R521H) along with an empty vector or TRIM10. Cells were treated with arsenite (0.5 mM) or without for an additional 1 h and stained with anti-HA and MAP2 antibodies and Hoechst 33342. (Scale bar, 10 μm). Figure 48Q This shows the quantification of cells with FUS inclusions (inclusion bodies) in the cytoplasm. The data shown are mean ± SD [n=3, for...]. Figure 48B , Figure 48E , Figure 48G , Figure 48I , Figure 48M , Figure 48O and Figure 48Q Count each >20 cells; for Figure 48K Counting was performed on each >60 cells. P <0.05, P <0.01, P <0.001, unpaired Student's t-test.

[0075] Figure 49, including Figures 49A to 49D The results show representative experimental results, which confirm that TRIM10 prevents and reverses SG binding of hnRNPA1. Figure 49A Representative immunofluorescence images of HeLa cells transfected with GFP-hnRNPA1 alone or with TRIM10 for 24 h are shown under a confocal microscope. Cells were treated with 0.5 mM sodium arsenite (+Ars) or without (-Ars) for 90 min and stained with anti-HA and anti-TIA1 antibodies and Hoechst 33342 (scale bar, 10 μm). Figure 49B The percentage of cells with hnRNPA1 in the SG was quantified. Figure 49C Representative immunofluorescence images of endogenous hnRNPA1 in WT cortical neurons transduced with control or TRIM10 ASO are shown (scale bar, 10 μm). Figure 49D Showing Figure 49C Quantitative analysis. Data shown are mean ± SD, n = 3 independent experiments. 25 or more cells were counted in each experiment. P <0.001, unpaired Student's t-test.

[0076] Figure 50, including Figures 50A to 50K The results show representative experimental results, which confirm that TRIM10 is a molecular chaperone and depolymerase of prion-like RBP. Figure 50A Representative protein blots from sedimentation assays were displayed, and Figure 50B Representative EM images of the experiment are shown, in which GST-FUS was treated with TEV (5 μM) and incubated for 24 h with or without TRIM10 (0.5 μM). (Scale bar, 500 nm). Figure 50C Representative protein blots from sedimentation assays were displayed, and Figure 50D Representative EM images from the experiment are shown, in which GST-hnRNPA1 (5 μM) was treated with TEV, and TRIM10 or Kapβ2 was applied in the presence or absence of 0.5 or 5 μM. Figure 50C ) or 0.5μM TRIM10 or 5μM Kapβ2 ( Figure 50D Incubate for 24 hours under the following conditions. Figure 50E Representative protein blots from sedimentation assays were displayed, and Figure 50F Representative EM images from the experiment are shown, in which FUS-EGFP fibrils (5 μM monomer concentration) were incubated with specified concentrations of TRIM10 or Kapβ2. (Scale bar, 500 nm). Arrows indicate fibril FUS assemblies formed during PSC cleavage. Figure 50G It shows representative protein blots from sedimentation assays, and Figure 50H Representative EM images of the experiment are shown, in which hnRNPA1 fibrils (5 μM monomer concentration) were mixed with buffer, 0.5 or 5 μM TRIM10 or Kapβ2 (… Figure 50G ), or 0.5 μM TRIM10 or 5 μM Kapβ2 ( Figure 50H Incubation. (Scale bar, 500 nm). Figure 50I Representative images were displayed, and Figure 50J Representative EM analyses of FUS hydrogels (480 μM monomer concentration) treated with buffer, TRIM10 (20 μM), or Kapβ2 (54 μM) are shown. Figure 50K Representative images from the experiments are shown, depicting the treatment of hnRNPA1 hydrogels (3.3 mM monomer concentration) with buffer, TRIM10 (20 μM), or Kapβ2 (270 μM). Dissolution was evaluated by EM. The molar ratio of TRIM10 to hnRNPA1 was 1:83, and the molar ratio of Kapβ2 to hnRNPA1 was 1:6. Scale bar, 500 nm.

[0077] Figures 51 to 53 Representative immunofluorescence images show the effects of TRIM on TDP-43 aggregation in a systematic analysis. GFP-TDP-43 NLRmTransfected into HeLa cells alone (-) or with the specified TRIM. Cells were treated with sodium arsenite (Ars) and stained with anti-HA antibody (for TRIM) and Hoechst 33342 (for DNA). Representative images are shown. (Scale bar, 10 μm).

[0078] Figures 54 to 56 Representative confocal images showcasing the effects of TRIM on FUS cytoplasmic mislocalization and SG binding in a systematic analysis. HeLa cells were transfected with GFP-FUS and the specified TRIM protein for 36 h. Cells were treated with 0.5 mM sodium arsenite (Ars) for 90 min, fixed, and stained with anti-HA and anti-TIA1 antibodies and Hoechst 33342. (Scale bar, 10 μm).

[0079] Figure 57, including Figures 57A to 57K The results show representative experimental results, which confirm that TRIM10 maintains the nuclear localization of wild-type FUS. Figures 57A to 57C Representative results of the experiment are shown, in which HeLa cells were transfected with or without HA-TRIM10 for 24 h, and treated with (+Ars) or (-Ars) 0.5 mM sodium arsenite for 90 min. Cells were fixed and stained with anti-HA and anti-G3BP1 antibodies and Hoechst 33342. Figure 57A The image shows a representative protein blot that indicates the expression of the specified protein. Figure 57B Representative cell images are shown. (Scale bar, 10 μm). Figure 57C The quantification of the average fluorescence intensity of SG is shown. Figure 57D and Figure 57E Representative results of the experiment are shown, in which cortical neurons derived from wild-type mice were transfected with empty vector or TRIM10 for 24 h. Cells were treated with or without arsenite (0.5 mM) for an additional 1 h and stained with anti-HA, FUS and MAP2 antibodies and Hoechst 33342. Figure 57D Representative cell images are shown. (Scale bar, 10 μm). Figure 57E The quantification of cells with FUS in the cytoplasm is shown. Figure 57F Representative protein blots were displayed, showing protein levels in Ctr and TRIM10 knockout cell lines. Figures 57G to 57I Representative results of the experiment are shown, including control cells treated with or without 0.5 mM sodium arsenite or TRIM10 knockout HeLa cells for 60 min, and stained with anti-G3BP1 antibody and Hoechst 33342. Figure 57G Representative protein blots were displayed, showing TRIM10 knockdown efficiency and G3BP1 expression. Figure 57H Representative cell images are shown. (Scale bar, 10 μm). Figure 57I The quantification of the average fluorescence intensity of SG is shown. Figure 57J Representative fluorescence images of primary cortical neurons after 3 days with and without SCR CTRL-FARRED treatment are shown. (Scale bar, 10 μm). Figure 57K Representative protein blots of primary cortical neurons incubated with AUMInc-scrctrl or AUMSiI-TRIM 10⁻¹ / ³ for 3 days are shown. Cells were lysed in RIPA buffer. Data shown are mean ± SD [n=3, for Figure 57C and Figure 57I For each ≥25 cells, count ≥20 SGs; for Figure 57E Counting in every >20 cells. P <0.05. ns, not significant, unpaired Student's t-test.

[0080] Figure 58, including Figures 58A to 58C The results show representative experimental results, which confirm that TRIM10 maintains the nuclear localization of the FUS mutant. Figure 58A Representative immunofluorescence images of wild-type spinal cord neurons transfected with EGFP-FUS (R521H) along with an empty vector or TRIM10 for 24 h are shown. Cells were treated with arsenite (0.5 mM) or without for an additional 1 h and stained with anti-HA, G3BP1, and MAP2 antibodies and Hoechst 33342. Figure 58B Representative immunofluorescence images of wild-type cortical neurons transfected 24 h with EGFP-FUS (R521H) and empty vector or TRIM10 are shown. Cells were treated with arsenite (0.5 mM) or without for an additional hour and stained with anti-HA, G3BP1, and MAP2 antibodies and Hoechst 33342. (Scale bar, 10 μm). Figure 58C The data show the quantification of cells with FUS inclusions in the cytoplasm. The data shown are mean ± SD [n=3, ≥20 cells per cell]. P <0.05, P <0.01, unpaired Student's t-test.

[0081] Figure 59, including Figures 59A to 59K The results show representative experimental results, which confirm that TRIM10 prevents SG binding of hnRNPA1. Figure 59ARepresentative immunofluorescence images of HeLa cells transfected with GFP-hnRNPA1 alone or with TRIM10 for 24 h are shown. Cells were treated with 0.5 mM sodium arsenite (+Ars) or without (-Ars) for 90 min, stained with anti-HA and anti-TIA1 antibodies and Hoechst 33342, and analyzed by confocal microscopy. (Scale bar, 10 μm). Figure 59A Related to Figure 45L. Figure 59B Representative Western blots of cytoplasmic and nuclear fractions isolated from HeLa cells transfected with EGFP-hnRNPA1 plus empty vector or TRIM10 for 24 hours and treated with 0.5 mM sodium arsenite for an additional 90 min are shown. Laminin A / C and GAPDH were used as loading controls for the nuclear and cytoplasmic fractions, respectively. Figure 59C Representative proteomic blots of protein expression from HeLa cells transfected with GFP-hnRNPA1 alone or with TRIM10 for 24 hours are shown. Cells were treated with 0.5 mM sodium arsenite (+Ars) or without (-Ars) for 90 min. Figure 59D Representative immunofluorescence images of HeLa cells transfected with GFP-hnRNPA1 for 24 hours and then transfected with designated TRIM10 are shown. After 24 hours, cells were treated with 0.5 mM sodium arsenite (+Ars) or without (-Ars) for 90 min, then fixed and stained with anti-TIA1 antibody and Hoechst 33342 for confocal microscopy. (Scale bar, 10 μm). Figure 59E The percentage of cells with hnRNPA1 in the SG was quantified. Figure 59F The results show representative protein blots from the protein expression analysis. Figure 59G Representative Western blots of HeLa cells transfected with empty vector or TRIM10 for 24 h and treated with 0.5 mM sodium arsenite for an additional 90 min are shown. Total cell lysates, as well as cytoplasmic and nuclear fractions, were analyzed by Western blot analysis. Laminin A / C and GAPDH were used as controls for nuclear and cytoplasmic fractions, respectively. Figure 59H Representative immunofluorescence images (scale bar, 10 μm) of GFP-hnRNPA1 transfected into control- or TRIM10 knockdown-HeLa cells 36 h later, fixed, and stained with anti-G3BP1 antibody and Hoechst 33342 for confocal microscopy are shown. Figure 59I This shows a quantification of the percentage of cells with hnRNPA1 in the cytoplasm. Figure 59J Representative immunofluorescence images of endogenous hnRNPA1 in control- or TRIM10 knockdown-HeLa cells are shown. (Scale bar, 10 μm). Figure 59KThe quantitative percentage of cells containing hnRNPA1 in the cytoplasm is shown. Data shown are mean ± SD [n=3, for...]. Figure 59F , Figure 59I and Figure 59K In each case, count >20 cells. P <0.001, unpaired Student's t-test.

[0082] Figure 60, including Figure 60A and Figure 60B The analysis shows the expression construct scheme and the purified protein. Figure 60A A schematic diagram of the recombinant proteins used in this study is shown. Human FUS and hnRNPA1 were fused to the N-terminus of glutathione S-transferase (GST). GST was cleaved from the fusion vessel using TEV to initiate protein aggregation. Figure 60B The image shows recombinant TRIM10 protein expressed in HEK293T cells (human TRIM10 is tagged with both HA and Flag epitopes at the C-terminus) and in Escherichia coli. E. coli Representative Western blot images of FUS and hnRNPA1 proteins expressed in the sample, purified and analyzed by SDS-PAGE and Coomassie Brilliant Blue staining. BSA was used as a protein standard. Detailed Implementation

[0083] This invention relates to the discovery of the role of TRIM proteins as molecular chaperones, depolymerases, and identifiers for protein degradation, which play a role in the pathology of various neurodegenerative diseases.

[0084] In one aspect, the present invention provides compositions and methods for treating or preventing neurodegenerative diseases or conditions. In some embodiments, the neurodegenerative diseases or conditions are associated with misfolded proteins or protein aggregates. Therefore, in some aspects, the present invention can be used to eliminate intracellular or extracellular misfolded proteins, protein aggregates, or protein inclusions.

[0085] In some embodiments, the present invention provides compositions and methods for treating conditions associated with misfolded proteins or protein aggregates. For example, in some embodiments, the compositions and methods are used to treat diseases and conditions associated with misfolded proteins and / or protein aggregates of amyloid-β, α-synuclein, tau, prions, SOD1, TDP-43, FUS, p53, p53 mutants, or polyglutamine repeat-related proteins (such as huntingtin and ataxia proteins).

[0086] In some embodiments, the present invention provides compositions and methods for treating or preventing neurodegenerative conditions in subjects in need of such treatment. In some embodiments, the present invention provides compositions and methods for treating or preventing neurodegenerative conditions as polyglutamine (polyQ) disorders, wherein the CAG codon repeat encodes a protein having a polyglutamine tract that can lead to the production of misfolded protein aggregates. Exemplary polyQ disorders include, but are not limited to, spinocerebellar ataxia type 1 (SCA1), SCA2, SCA3, SCA6, SCA7, SCA17, Huntington's disease, and dentate nucleus-globus pallidus hypothalamic atrophy (DRPLA).

[0087] Exemplary neurodegenerative diseases associated with misfolded proteins or protein aggregates include, but are not limited to, SCA1, SCA2, SCA3, SCA6, SCA7, SCA17, Huntington's disease, dentate nucleus-rubra-pallidus-thalamus atrophy (DRPLA), Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), infectious spongiform encephalopathy (prion disease), Lewy body dementia (DLB), multiple system atrophy (MSA), frontotemporal lobe degeneration (FTLD), AL amyloidosis, AA amyloidosis, familial Mediterranean fever, senile systemic amyloidosis, and familial amyloidosis. Polyneuropathy, Icelandic hereditary cerebral amyloid angiopathy, hereditary cerebral hemorrhage with amyloidosis, pituitary prolactinoma, frontotemporal degeneration (FTLD-tau), progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), argyrophilic granulation disease (AGD), frontotemporal dementia and Parkinson's disease associated with chromosome 17 (FTDP-17), vacuoletau disease, Lytico-Bodig disease, globular tau disease (GGT), age-related tau astrocytosis (ARTAG), Pick's disease, primary age-related tau disease (PART), tangles-only dementia (TOD), Chronic traumatic encephalopathy (CTE), anti-IgLON5-associated tau protein disease, Guadeloupe Parkinson's syndrome, nodding syndrome (NS), ganglioglioma, gangliocytoma, meningioma, post-encephalitis Parkinson's syndrome, subacute sclerosing panencephalitis (SSPE), lead poisoning encephalopathy, tuberous sclerosis, pantothenic kinase-associated neurodegeneration, lipofuscinosis, Shy-Drager syndrome, striatal substantia nigra degeneration, olivopontocerebellar atrophy, Hallervorden-Spatz syndrome, REM sleep behavior disorder (RPD), Lewy syndrome with amygdala restriction. The following are listed: Alzheimer's disease (AD / ALB), frontotemporal degeneration (FTLD-TDP), multisystem protein disease (MSP), Perry's disease, facial-onset sensory and motor neuron disease (FOSMN), age-related TDP-43 brain disease with sclerosis (CARTS), limbic system-predominant age-related TDP-43 encephalopathy (LATE), sporadic inclusion body myositis (sIBM), chronic traumatic encephalopathy (CTE), primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), Guam Parkinson's dementia syndrome (G-PDC), and Guam amyotrophic lateral sclerosis (G-ALS).

[0088] In one aspect, the present invention provides compositions and methods for enhancing the expression, activity, or both of one or more TRIM proteins. In some embodiments, the compositions comprise nucleic acid molecules, expression vectors, proteins, peptides, small molecules, etc., which enhance the expression, activity, or both of one or more TRIM proteins.

[0089] definition

[0090] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While any methods and materials similar to or equivalent to those described herein may be used in the practice or testing of this invention, preferred methods and materials are described.

[0091] As used herein, each of the following terms has the meaning relating to it in this section.

[0092] The article “a” is used in this text to refer to one or more (i.e., at least one) grammatical objects of the article. For example, “an element” means one element or more.

[0093] When referring to measurable values, such as quantities, durations of time, etc., the word “about” as used herein means that it covers variations of ±20%, ±10%, ±5%, ±1%, or ±0.1% of the specified value, such variations being appropriate for implementing the disclosed method.

[0094] When used in the context of organisms, tissues, cells, or components thereof, the term "abnormal" means that at least one observable or detectable characteristic (e.g., age, treatment, time of day, etc.) differs from those of organisms, tissues, cells, or components thereof that exhibit "normal" (expected) characteristics. A characteristic that is normal or expected for one cell or tissue type may be abnormal for different cell or tissue types.

[0095] As used herein, “cell therapy” refers to the administration of live cells to a subject as a therapeutic agent for the treatment or prevention of one or more diseases or conditions. The cells may be unmanipulated or manipulated, such as cells genetically engineered to overexpress a therapeutic protein of interest. Cells used in cell therapy may be xenogeneic, allogeneic, syngeneic, or autologous.

[0096] "Disease" is a state of health in an animal in which the animal is unable to maintain homeostasis, and in which the animal's health continues to deteriorate if the disease is not improved.

[0097] Conversely, an "illness" in an animal is a condition in which the animal is able to maintain homeostasis, but its health is not as good as it would be without the illness. If left untreated, the illness does not necessarily lead to a further decline in the animal's health.

[0098] The disease or condition is said to be "reduced" if the severity of the symptoms or signs of the disease or condition, the frequency with which the patient experiences such symptoms or signs, or both, are reduced.

[0099] The “effective amount” or “therapeutic effective amount” of a compound is the amount of the compound sufficient to provide a beneficial effect to a subject administering the compound. The “effective amount” of a delivery medium is the amount sufficient to effectively bind or deliver the compound.

[0100] As used herein, “illustrating material” includes publications, records, charts, or any other medium of expression that can be used to convey the usefulness of the compounds, compositions, carriers, or delivery systems of the present invention in the kit for producing an effect that alleviates one or more of the diseases or conditions listed herein. Optionally or alternatively, the illustrating material may describe one or more methods for alleviating a disease or condition in mammalian cells or tissues. The illustrating material of the kit of the present invention may, for example, be affixed (affixed) to a container containing the compounds, compositions, carriers, or delivery systems identified in the present invention, or may be shipped together with the container containing the identified compounds, compositions, carriers, or delivery systems. Alternatively, the illustrating material may be shipped separately from the container for the purpose of cooperative use of the illustrating material and the compounds by the recipient.

[0101] The terms “patient,” “subject,” “individual,” etc., are used interchangeably herein and refer to any animal or its cells that respond (suitably) to the methods described herein, whether in vitro or in vivo. In some non-limiting embodiments, the patient, subject, or individual is a human being.

[0102] "Therapeutic" treatment is treatment administered to a subject who exhibits signs or symptoms of a disease or condition in order to alleviate or eliminate those signs or symptoms.

[0103] As used in this article, “treating a disease or condition” means reducing the severity and / or frequency of the symptoms or signs of a disease or condition experienced by a patient.

[0104] As used herein, the term "biological sample" is intended to include any sample containing the expression of nucleic acids or the presence or detectability of polypeptides in cells, tissues, or body fluids. Samples that are naturally in a liquid state are referred to herein as "body fluids." Biological samples can be obtained from patients using a variety of techniques, including, for example, by scraping or wiping an area of ​​the subject or by using a needle. Methods for collecting a variety of bodily samples are well known in the art.

[0105] As used herein, “immunoassay” refers to any binding assay that uses an antibody capable of specifically binding to a target molecule to detect and quantify said target molecule.

[0106] For antibodies, the term "specific binding," as used herein, refers to antibodies that recognize a specific antigen but do not substantially recognize or bind to other molecules in the sample. For example, an antibody that specifically binds to an antigen from one species may also bind to antigens from one or more species. However, this cross-species cross-reactivity itself does not alter the antibody's classification as a specific antigen. In another instance, an antibody that specifically binds to an antigen may also bind to different allelic forms of said antigen. However, this cross-reactivity itself does not alter the antibody's classification as a specific antigen.

[0107] In some contexts, the term "specific binding" can be used in conjunction with the interaction of an antibody, protein, or peptide with a second chemical substance to indicate that the interaction depends on the presence of a specific structure (e.g., an antigenic determinant or epitope) on the chemical substance; for example, typically, the antibody recognizes and binds to a specific protein structure, rather than the protein itself. If an antibody is specific for epitope "A," then in a reaction containing labeled "A" and the antibody, the presence of a molecule containing epitope A (or free, unlabeled A) will reduce the amount of labeled A bound to the antibody.

[0108] The “coding region” of a gene consists of nucleotide residues in the coding strand of the gene and nucleotides in the non-coding strand of the gene, which are homologous to or complementary to the coding region of the mRNA molecule produced by transcription of the gene.

[0109] The “coding region” of an mRNA molecule is composed of nucleotide residues that match the anticodon region of a transfer RNA molecule during translation of the mRNA molecule or encode a stop codon. Therefore, the coding region may include nucleotide residues that contain codons for amino acid residues not present in the mature protein encoded by the mRNA molecule (e.g., amino acid residues in a protein output signal sequence).

[0110] As used herein to refer to "complementarity" of nucleic acids, it is a broad concept referring to sequence complementarity between regions of two nucleic acid strands or between two regions of the same nucleic acid strand. It is known that adenine residues in a first nucleic acid region can form specific hydrogen bonds ("base pairing") with residues in a second nucleic acid region antiparallel to the first region (if the residues are thymine or uracil). Similarly, it is known that cytosine residues in a first nucleic acid strand can pair with bases of residues in a second nucleic acid strand antiparallel to the first strand (if the residues are guanine). If, when the two regions are arranged antiparallel, at least one nucleotide residue in the first region can pair with a base of a residue in the second region, then the first region of the nucleic acid is complementary to the second region having the same or different nucleic acids. Preferably, the first region comprises a first portion, and the second region comprises a second portion, wherein, when the first and second portions are arranged antiparallel, at least about 50%, and preferably at least about 75%, at least about 90%, or at least about 95% of the nucleotide residues in the first portion can pair with bases of nucleotide residues in the second portion. More preferably, all nucleotide residues in the first portion can pair with bases of nucleotide residues in the second portion.

[0111] "Separated" means altered or removed from its natural state. For example, nucleic acids or peptides that are naturally present in living animals in their normal background are not "separated," but the same nucleic acids or peptides that are partially or completely separated from the material coexisting with their natural background are "separated." Separated nucleic acids or proteins can be in a substantially purified form or can exist in non-natural environments, such as, for example, host cells.

[0112] "Separated nucleic acid" refers to a segment or fragment of nucleic acid that has been separated from the sequence flanked to it in its naturally occurring state, i.e., a DNA fragment that has been removed from the sequence normally adjacent to the fragment (i.e., the sequence adjacent to the fragment in its naturally occurring genome). The term also applies to nucleic acids that have been purified substantially from other components naturally accompanying the nucleic acid (i.e., RNA, DNA, or protein naturally accompanying the nucleic acid in cells). Therefore, the term includes, for example, recombinant DNA introduced into vectors, into autonomously replicating plasmids or viruses, or into the genomic DNA of prokaryotes or eukaryotes, or as a separate molecule independent of other sequences (i.e., as cDNA or a fragment of genome or cDNA produced by PCR or restriction enzyme digestion). It also includes recombinant DNA as part of a heterozygous gene encoding other polypeptide sequences.

[0113] In the context of this invention, the following abbreviations for common nucleic acid bases are used: "A" refers to adenosine, "C" refers to cytosine, "G" refers to guanine nucleoside, "T" refers to thymidine nucleoside, and "U" refers to uracil nucleoside.

[0114] As used herein, the term "polynucleotide" is defined as a nucleotide chain. Furthermore, nucleic acids are polymers of nucleotides. Therefore, as used herein, nucleic acids and polynucleotides are interchangeable. Those skilled in the art will understand that nucleic acids are polynucleotides that can be hydrolyzed into monomeric "nucleotides." These monomeric nucleotides can be hydrolyzed into nucleosides. As used herein, polynucleotides include, but are not limited to, all nucleic acid sequences obtained by any means available in the art, including, without limitation, recombination methods, i.e., cloning of nucleic acid sequences from recombinant libraries or cell genomes using conventional cloning techniques such as PCR, and synthetic methods.

[0115] As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably and refer to compounds composed of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limitation on the maximum number of amino acids a protein or peptide sequence can contain. A polypeptide includes any peptide or protein containing two or more amino acids linked together by peptide bonds. As used herein, the term refers to both short chains and long chains, which are also commonly referred to in the art as peptides, oligopeptides, and oligomers, and long chains are commonly referred to in the art as proteins, which exist in various types. “Polypeptide” includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, mimics, fusion proteins, etc. Polypeptides include natural peptides, recombinant peptides, synthetic peptides, or combinations thereof.

[0116] As used in this article, "conjugated" refers to the covalent connection of one molecule to a second molecule.

[0117] As used herein, a “variant” is a nucleic acid or peptide sequence that differs from a reference nucleic acid or peptide sequence in sequence, but retains the essential biological properties of the reference molecule. Sequence changes in nucleic acid variants may not alter the amino acid sequence of the peptide encoded by the reference nucleic acid, or may result in amino acid substitutions, additions, deletions, fusions, and truncations. Sequence changes in peptide variants are generally limited or conserved, such that the sequences of the reference peptide and the variant are very similar overall and identical in several regions. Variants and reference peptides may differ in amino acid sequence by one or more substitutions, additions, or deletions in any combination. Variants of nucleic acids or peptides may be naturally occurring, such as allelic variants, or may be variants known not to be naturally occurring. Non-natural variants of nucleic acids and peptides can be prepared by mutagenesis (mutation) techniques or by direct synthesis.

[0118] As used herein, "an activator of one or more TRIM proteins" is a compound that enhances the expression, activity, or biological function of a TRIM protein compared to the expression, activity, or biological function of a TRIM protein in the absence of an activator.

[0119] Scope: Throughout this disclosure, various aspects of the invention may be presented in a scope format. It should be understood that the scope format is for convenience and brevity only and should not be considered a rigid limitation on the scope of the invention. Therefore, a description of the scope should be considered to include all possible sub-scopes specifically disclosed, as well as the individual values ​​within those scopes. For example, a description of a scope such as 1 to 6 should be considered to have specifically disclosed sub-scopes such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., and the individual values ​​within those scopes, such as 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This is applicable regardless of the breadth of the scope.

[0120] describe

[0121] In one aspect, the present invention provides compositions and methods for treating or preventing neurodegenerative diseases or conditions. In some embodiments, neurodegenerative diseases or conditions are associated with misfolded proteins or protein aggregates. For example, the present invention provides compositions and methods to improve the identification and removal of misfolded proteins. In some embodiments, the present invention assists in protein folding. In some embodiments, the present invention provides depolymerization and refolding of protein aggregates or inclusions. Therefore, the present invention can be used for intracellular or extracellular treatment or prevention of misfolded proteins, protein aggregates, or protein inclusions.

[0122] This invention relates to the discovery of the role of TRIM protein as a molecular chaperone, depolymerase, and identifier of proteins undergoing degradation, which plays a role in the pathology of various neurodegenerative diseases.

[0123] Composition

[0124] In several embodiments, the present invention includes compositions for increasing the level or activity of TRIM proteins. Thus, in some embodiments, the composition comprises an activator of the expression or activity of one or more TRIM proteins. In some embodiments, the activator increases the expression or activity of one or more TRIM proteins. In some embodiments, the compositions of the present invention increase the level of one or more TRIM proteins, the amount of mRNA encoding one or more TRIM proteins, the activity of one or more TRIM proteins, or a combination thereof. The one or more TRIM proteins include any member of the TRIM protein family, including mammalian and non-mammal members. In some embodiments, the composition comprises one or more activators selected from the following: human TRIM1, TRIM2, TRIM3, TRIM4, TRIM5, TRIM6, TRIM7, TRIM8, TRIM9, TRIM10, TRIM11, TRIM13, TRIM14, TRIM15, TRIM16, TRIM17, TRIM18, TRIM19, TRIM20, TRIM21, TRIM22, TRIM23, TRIM24, TRIM25, TRIM26, TRIM27, TRIM28, TRIM29, TRIM30, TRIM31, TRIM32, TRIM33, TRIM34, TRIM35, TRIM36, TRIM37, T RIM38, TRIM39, TRIM40, TRIM41, TRIM42, TRIM43, TRIM44, TRIM45, TRIM46, TRIM47, TRIM48, TRIM49, TRIM50, TRIM51, TRIM52, TRIM54, TRIM55, TRIM56, TRIM58, TRIM59, TRIM60, TRIM61, TRIM62, TRIM63, TRIM64, TRIM65, TRIM66, TRIM67, TRIM68, TRIM69, TRIM70, TRIM71, TRIM72, TRIM73, TRIM74, TRIM76 and TRIM77; and mouse TRIM12 and TRIM30.In some embodiments, the composition comprises one or more activators selected from the following: human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM21, TRIM24, TRIM26, TRIM29, TRIM31, TRIM34, TRIM36, TRIM37, TRIM46, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69 and TRIM70; and mouse TRIM12 and TRIM30. In some embodiments, the composition comprises one or more activators selected from the following: human TRIM10, TRIM11, TRIM24, TRIM36, TRIM37, TRIM40, TRIM49, TRIM55, TRIM58 and TRIM68. In some embodiments, the composition comprises an activator selected from one or more of the following: human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM12, TRIM17, TRIM18, TRIM19, TRIM21, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, and TRIM70. In some embodiments, the composition comprises an activator selected from one or more of the following: human TRIM10, TRIM11, and TRIM55. In some embodiments, the composition comprises one or more activators selected from the following: human TRIM2, TRIM3, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM26, TRIM29, TRIM30, TRIM31, TRIM36, TRIM41, TRIM42, TRIM43, TRIM46, TRIM49, TRIM55, TRIM56, TRIM63, TRIM64, TRIM68, TRIM69, TRIM70, TRIM71 and TRIM73.In some embodiments, the composition comprises an activator selected from one or more of the following: human TRIM10, TRIM11, TRIM36, TRIM55, and TRIM68. In some embodiments, the composition comprises an activator selected from one or more of the following: human TRIM10, TRIM11, TRIM24, TRIM36, and TRIM58. In some embodiments, the composition comprises an activator selected from one or more of the following: human TRIM10, TRIM11, TRIM17, TRIM36, TRIM37, TRIM40, TRIM49, and TRIM55. In some embodiments, the composition comprises an activator of human TRIM10. In some embodiments, the composition comprises an activator of human TRIM11.

[0125] A variety of methods can be used to evaluate the activation of genes or gene products, including those disclosed herein and methods known in the art or to be developed in the future. In other words, based on the disclosures provided herein, those skilled in the art will understand that methods for evaluating the level of nucleic acids encoding gene products (e.g., mRNA), the level of peptide gene products present in biological samples, the activity of peptide gene products present in biological samples, or combinations thereof, can readily evaluate the increased level or activity of genes or gene products.

[0126] The activator compositions and methods for enhancing the level or activity of genes or gene products described in this invention include, but should not be considered as limited to, compounds, proteins, peptides, peptide mimics, antibodies, ribozymes, small molecule compounds, nucleic acids, vectors, antisense nucleic acid molecules (e.g., siRNA, miRNA, etc.), or combinations thereof. Based on the disclosure provided herein, those skilled in the art will readily understand that activator compositions encompass compounds that enhance the level or activity of genes or gene products. Furthermore, activator compositions encompass chemically modified compounds and derivatives, as well as those well known to those skilled in the art of chemistry.

[0127] In some embodiments, the activator composition of the present invention is an agonist that enhances the expression, activity, or biological function of a gene or gene product. For example, in some embodiments, the activator of the present invention is an agonist of one or more TRIM proteins.

[0128] Furthermore, those skilled in the art, upon familiarity with this disclosure and the methods exemplified herein, will understand that activators include those to be discovered in the future and identified by standards well-known in the pharmaceutical field, such as physiological outcomes of gene and gene product regulation, as described in detail herein and / or known in the art. Therefore, this invention is not in any way limited to any specific activator composition as exemplified or disclosed herein; rather, it covers those activator compositions known in the art and, as to be discovered in the future, that will be understood to be useful by those skilled in the art.

[0129] Other methods for identifying and generating activator compositions are well known to those skilled in the art. Alternatively, activators can be chemically synthesized. Furthermore, those skilled in the art will understand that, based on the teachings provided herein, activator compositions can be derived from recombinant organisms. Methods for the chemical synthesis of activators and for obtaining them from natural sources are well known in the art and have been described therein.

[0130] Those skilled in the art will understand that activators can be applied as small molecule chemicals, peptides, polypeptides, antibodies, nucleic acid constructs encoding proteins, antisense nucleic acids, nucleic acid constructs encoding antisense nucleic acids, or combinations thereof. Various vectors and other compositions and methods are well known for the application of proteins or nucleic acid constructs encoding proteins to cells or tissues. Therefore, this invention includes peptides or nucleic acids encoding said peptides as activators of genes or gene products. For example, this invention includes peptides or nucleic acids encoding said peptides, said peptides comprising one or more TRIM proteins, one or more functional TRIM peptides, or combinations thereof. (Sambrook et al., 2001, Molecular Cloning: A Laboratory Manual, Cold SpringHarbor Laboratory, New York; Ausubel et al., 1997, Current Protocols in Molecular Biology, John Wiley & Sons, New York).

[0131] In some embodiments, the activator of the present invention results in an increase in the expression of at least one TRIM protein, including transcription, translation, or both. In some embodiments, the activator of the present invention results in an increase in the activity of at least one TRIM protein (e.g., inhibition of USP14). Therefore, increasing the level or activity of at least one TRIM protein includes, but is not limited to, increasing the amount of at least one TRIM protein, increasing the transcription, translation, or both of the nucleic acid encoding at least one TRIM protein; and it also includes increasing any activity of the TRIM polypeptide.

[0132] Those skilled in the art will recognize that reducing the amount or activity of molecules (which themselves reduce the amount or activity of TRIM proteins) can be used to increase the amount or activity of TRIM proteins. This invention covers any inhibitors of negative regulators of TRIM proteins. As a non-limiting example, antisense is described as a form of regulator that inhibits the proteasome or its subunits to increase the amount or activity of the proteasome or its subunits. Antisense oligonucleotides are DNA or RNA molecules that are complementary to some portion of an mRNA molecule. When present in a cell, antisense oligonucleotides hybridize to an existing mRNA molecule and inhibit translation into the gene product. The use of antisense oligonucleotides to inhibit gene expression is well known in the art (Marcus-Sekura, 1988, Anal. Biochem. 172:289), such as methods for expressing antisense oligonucleotides in cells (Inoue, U.S. Patent No. 5,190,931). The method of this invention involves using antisense oligonucleotides to reduce the amount of molecules that cause a decrease in the amount or activity of TRIM proteins, thereby increasing the amount or activity of TRIM proteins. In this invention, antisense oligonucleotides synthesized and supplied to cells by methods well known to those skilled in the art are considered. For example, antisense oligonucleotides can be synthesized to a length of about 10 to about 100 nucleotides, more preferably about 15 to about 50 nucleotides. The synthesis of nucleic acid molecules is well known in the art, as is the synthesis of modified antisense oligonucleotides, thereby improving biological activity compared to unmodified antisense oligonucleotides (Tullis, 1991, U.S. Patent No. 5,023,243).

[0133] Similarly, gene expression can be suppressed by hybridizing antisense molecules with promoters or other gene regulatory elements, thereby affecting gene transcription. Methods for identifying promoters or other regulatory elements that interact with the gene of interest are well known in the art and include methods such as the yeast two-hybrid system (Bartel and Fields, eds., In: The Yeast Two Hybrid System, Oxford University Press, Cary, NC).

[0134] Alternatively, by using siRNA, shRNA, antisense oligonucleotides, or ribonucleases, it is possible to suppress genes expressing proteins that reduce TRIM protein levels or activity. Given the nucleotide sequences of the molecules, those skilled in the art can synthesize antisense oligonucleotides or ribonucleases without excessive experimentation, based on the disclosures herein and the references cited.

[0135] peptides

[0136] In some embodiments, the activator of the present invention comprises an active TRIM polypeptide or a fragment thereof. In some embodiments, the peptide of the composition comprises an amino acid sequence of one or more TRIM proteins. In some embodiments, the peptide of the composition comprises an amino acid sequence selected from one or more of the following: human TRIM1, TRIM2, TRIM3, TRIM4, TRIM5, TRIM6, TRIM7, TRIM8, TRIM9, TRIM10, TRIM11, TRIM13, TRIM14, TRIM15, TRIM16, TRIM17, TRIM18, TRIM19, TRIM20, TRIM21, TRIM22, TRIM23, TRIM24, TRIM25, TRIM26, TRIM27, TRIM28, TRIM29, TRIM30, TRIM31, TRIM32, TRIM33, TRIM34, TRIM35, TRIM36, TRIM37, TRIM38, TRIM29, TRIM30, TRIM31, TRIM32, TRIM33, TRIM34, TRIM35, TRIM36, TRIM37, TRIM38, TRIM29, TRIM2 ... IM38, TRIM39, TRIM40, TRIM41, TRIM42, TRIM43, TRIM44, TRIM45, TRIM46, TRIM47, TRIM48, TRIM49, TRIM50, TRIM51, TRIM52, TRIM54, TRIM55, TRIM56, TRIM58, TRIM59, TRIM60, TRIM61, TRIM62, TRIM63, TRIM64, TRIM65, TRIM66, TRIM67, TRIM68, TRIM69, TRIM70, TRIM71, TRIM72, TRIM73, TRIM74, TRIM76 and TRIM77 peptides; mouse TRIM12 and TRIM30 peptides; and their functional variants. In some embodiments, the peptides of the composition comprise an amino acid sequence selected from one or more of the following: human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM21, TRIM24, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM37, TRIM46, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69 and TRIM70; mouse TRIM12 and TRIM30 peptides; and functional variants thereof.In some embodiments, the peptides of the composition comprise an amino acid sequence selected from one or more of the following: human TRIM10, TRIM11, TRIM24, TRIM36, TRIM37, TRIM40, TRIM49, TRIM55, TRIM58 and TRIM68 peptides and their functional variants. In some embodiments, the peptide of the composition comprises an amino acid sequence selected from one or more of the following: human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM12, TRIM17, TRIM18, TRIM19, TRIM21, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, and TRIM70 peptides and their functional variants. In some embodiments, the peptide of the composition comprises an amino acid sequence selected from one or more of the following: human TRIM10, TRIM11, and TRIM55 peptides and their functional variants. In some embodiments, the peptides of the composition comprise amino acid sequences selected from one or more of the following: human TRIM2, TRIM3, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM26, TRIM29, TRIM30, TRIM31, TRIM36, TRIM41, TRIM42, TRIM43, TRIM46, TRIM49, TRIM55, TRIM56, TRIM63, TRIM64, TRIM68, TRIM69, TRIM70, TRIM71, and TRIM73 peptides and their functional variants. In some embodiments, the peptides of the composition comprise amino acid sequences selected from one or more of the following: human TRIM10, TRIM11, TRIM36, TRIM55, and TRIM68 peptides and their functional variants. In some embodiments, the peptide of the composition comprises an amino acid sequence selected from one or more of the following: human TRIM10, TRIM11, TRIM24, TRIM36, and TRIM58 peptides and their functional variants. In some embodiments, the peptide of the composition comprises an amino acid sequence selected from one or more of the following: human TRIM10, TRIM11, TRIM17, TRIM36, TRIM37, TRIM40, TRIM49, and TRIM55 peptides and their functional variants. In some embodiments, the peptide of the composition comprises the amino acid sequence of the human TRIM10 peptide or a functional variant thereof.In some embodiments, the peptide of the composition comprises the amino acid sequence of human TRIM11 peptide or a functional variant thereof.

[0137] In some embodiments, the composition comprises one or more TRIM proteins. For example, in some embodiments, the composition comprises the amino acid sequence of one or more TRIM proteins provided by the accession number in Table 1.

[0138] This invention should also be interpreted as including any form of peptide that is substantially homologous to the peptides disclosed herein. A peptide that is “substantially homologous” has an amino acid sequence that shares at least about 50%, at least about 70%, at least about 80%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0139] In some embodiments, the compositions of the present invention comprise peptides, fragments of peptides, homologs, variants, derivatives, or salts of peptides as described herein. For example, in some embodiments, the compositions comprise peptides containing one or more TRIM proteins, fragments of one or more TRIM proteins, homologs of one or more TRIM proteins, variants of one or more TRIM proteins, derivatives of one or more TRIM proteins, or salts of one or more TRIM proteins.

[0140] In some embodiments, the peptide includes a targeting domain that targets the peptide to a desired location. For example, in some embodiments, the targeting domain binds to a target cell, protein, or protein aggregate, thereby delivering the therapeutic peptide to the desired location. For example, in some embodiments, the targeting domain is intended to bind to proteins or protein aggregates associated with a disease or condition, including but not limited to amyloid-β, α-synuclein, Tau, prions, SOD1, TDP-43, FUS, p53 mutants, and polyglutamine repeat-associated proteins such as huntingtin and ataxia proteins and their aggregates.

[0141] In some embodiments, the targeting domain includes peptides, nucleic acids, small molecules, etc., which have the ability to bind to target cells, proteins, or protein aggregates. In some embodiments, the targeting domain includes antibodies or antibody fragments that bind to target cells, proteins, or protein aggregates.

[0142] The peptides described in this invention can be prepared using chemical methods. For example, the peptides can be synthesized using solid-phase techniques (Roberge J Y et al. (1995) Science 269: 202-204), cleaved from resin, and purified by preparative high-performance liquid chromatography. For example, automated synthesis can be achieved using an ABI 431 A peptide synthesizer (Perkin Elmer) according to the manufacturer's instructions.

[0143] Alternatively, peptides can be prepared through recombination or by cleaving longer peptides. The composition of the peptide can be confirmed by amino acid analysis or sequencing.

[0144] Variants of the peptide according to the present invention may be (i) a variant in which one or more amino acid residues are replaced by conserved or non-conserved amino acid residues (preferably conserved amino acid residues), and such replaced amino acid residues may or may not be encoded by the genetic code; (ii) a variant in which one or more modified amino acid residues are present, for example, residues modified by linking substituent groups; (iii) a variant in which the peptide is an alternative splicing variant of the peptide according to the present invention; (iv) a fragment of the peptide and / or (v) a variant in which the peptide is fused with another peptide, such as a leader sequence or secretion sequence or a sequence for purification (e.g., His-tag) or for detection (e.g., Sv5 epitope tag). The fragments comprise peptides obtained by proteolytic cleavage (including multisite proteolysis) of the original sequence. Variants may be post-translational modified or chemically modified. Based on the teachings herein, these variants are considered to be within the scope of those skilled in the art.

[0145] The peptides described in this invention can be post-translated. For example, post-translational modifications within the scope of this invention include signal peptide cleavage, glycosylation, acetylation, isoprenylation, proteolysis, myristylation, protein folding, and proteolytic processing. Some modification or processing events require the introduction of additional biological machinery. For example, processing events such as signal peptide cleavage and core glycosylation can be examined by adding canine microsomal membranes or African toad egg cell extracts (US Patent No. 6,103,489) to a standard translation reaction.

[0146] The peptides described in this invention may include non-natural amino acids formed through post-translational modification or by introducing non-natural amino acids during translation. Various methods are available for introducing non-natural amino acids during protein translation. For example, specific tRNAs, such as tRNAs with suppressor characteristics or suppressor tRNAs, are used in site-directed non-natural amino acid substitution (SNAAR). In SNAAR, unique codons are required on both the mRNA and the suppressor tRNA, which play a role in protein synthesis to target non-natural amino acids to specific sites (described in WO90 / 05785). However, suppressor tRNAs are not recognized by aminoacyl-tRNA synthetases present in the protein translation system. In some cases, after aminoacylation of the tRNA molecule, non-natural amino acids can be formed using chemical reactions that specifically modify natural amino acids without significantly altering the functional activity of the aminoacylated tRNA. These reactions are called post-aminoacylation modifications. For example, homologous tRNAs (tRNAs) can be modified using amine-specific photoaffinity labeling. LYS The ε-amino group of lysine linked to )

[0147] The peptides described in this invention can be conjugated with other molecules, such as proteins, to prepare fusion proteins. This can be achieved, for example, by synthesizing N-terminal or C-terminal fusion proteins, as long as the resulting fusion protein retains the functionality of the peptides described in this invention.

[0148] Cyclic derivatives of the peptides described in this invention are also part of this invention. Cyclization allows the peptide to adopt a conformation more favorable for binding with other molecules. Cyclization can be achieved using techniques known in the art. For example, a disulfide bond can be formed between two appropriately spaced components having free thiol groups, or an amide bond can be formed between an amino group of one component and a carboxyl group of another component. Cyclization can also be achieved using amino acids containing azobenzene, as described in Ulysse, L. et al., J.Am. Chem. Soc. 1995, 117, 8466-8467. The bond-forming components can be amino acid side chains, non-amino acid components, or a combination of both. In one embodiment of the invention, the cyclic peptide may contain a β-turn at the correct position. A β-turn can be introduced into the peptides described in this invention by adding the amino acid Pro-Gly at the correct position.

[0149] It may be desirable to generate more flexible cyclic peptides than the aforementioned cyclic peptides containing peptide bonds. More flexible peptides can be prepared by introducing cysteine ​​residues at the right and left positions of the peptide and forming disulfide bridges between the two cysteine ​​residues. The arrangement of the two cysteine ​​residues does not deform the β-sheet and turns. The peptide is more flexible due to the length of the disulfide bonds and the fewer hydrogen bonds in the β-sheet portion. The relative flexibility of the cyclic peptide can be determined through molecular dynamics simulations.

[0150] The peptides described in this invention can be converted into pharmaceutical salts by reacting with inorganic acids, such as hydrochloric acid, sulfuric acid, hydrobromic acid, phosphoric acid, etc., or organic acids, such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, succinic acid, malic acid, tartaric acid, citric acid, benzoic acid, salicylic acid, benzenesulfonic acid, and toluenesulfonic acid.

[0151] The peptides of the present invention may also have modifications. Modifications (generally without altering the primary sequence) include in vivo or in vitro chemical derivatization of the peptide, such as acetylation or carboxylation. Glycosylation modifications are also included, for example, modifications resulting from altering the glycosylation pattern of the peptide during its synthesis and processing or in further processing steps; for example, by exposing the peptide to enzymes that affect glycosylation, such as mammalian glycosylation or deglycosylation enzymes. Sequences containing phosphorylated amino acid residues, such as phosphotyrosine, phosphotyserine, or phosphotythreonine, are also covered.

[0152] This also includes peptides modified using conventional molecular biology techniques to improve their tolerance to proteolytic degradation, optimize solubility, or make them more suitable as therapeutic agents. These variants include residues containing residues other than naturally occurring L-amino acids, such as D-amino acids or non-naturally occurring synthetic amino acids. The peptides described in this invention can be further conjugated with non-amino acid moieties useful in their therapeutic applications. Specifically, moieties that improve the stability, biological half-life, water solubility, and / or immunological characteristics of the peptide are useful. A non-limiting example of such a moiety is polyethylene glycol (PEG).

[0153] Covalent bonding of bioactive compounds to water-soluble polymers is a method for altering and controlling the biodistribution, pharmacokinetics, and general toxicity of these compounds (Duncan et al., 1984, Adv. Polym. Sci. 57:53-101). A variety of water-soluble polymers have been used to achieve these effects, such as poly(sialic acid), dextran, poly(N-(2-hydroxypropyl)methacrylamide) (PHPMA), poly(N-vinylpyrrolidone) (PVP), poly(vinyl alcohol) (PVA), poly(ethylene glycol-co-propylene glycol), poly(N-acryloylmorpholine) (PAcM), and poly(ethylene glycol) (PEG) (Powell, 1980, Polyethyleneglycol. In RL Davidson (ed.) Handbook of Water Soluble Gums and Resins. McGraw-Hill, New York, Chapter 18). PEG possesses a set of desirable properties: extremely low toxicity (Pang, 1993, J. Am. Coll. Toxicol. 12: 429-456), excellent solubility in aqueous solution (Powell, as above), and low immunogenicity and antigenicity (Dreborg et al., 1990, Crit. Rev. Ther. Drug Carrier Syst. 6: 315-365).PEG-conjugated or “PEGylated” protein therapeutics containing single or multiple polyethylene glycol chains have been described in the scientific literature (Clark et al., 1996, J. Biol. Chem. 271: 21969-21977; Hershfield, 1997, Biochemistry and immunology of poly(ethylene glycol)-modified adenosinedeaminase (PEG-ADA). JM Harris and S. Zalipsky (eds.) Poly(ethylene glycol): Chemistry and Biological Applications. American Chemical Society, Washington, DC, pp. 145-154; Olson et al., 1997, Preparation and characterization of poly(ethylene glycol)ylated human growth hormone antagonist. JM Harris and S. Zalipsky (eds.) Poly(ethylene glycol): Chemistry and Biological Applications. American Chemical Society, Washington, DC, pp. 170-181).

[0154] The peptides of the present invention can be synthesized using conventional techniques. For example, the peptides described in the present invention can be synthesized by chemical synthesis using solid-phase peptide synthesis. These methods employ solid-phase or solution-phase synthesis methods (see, for example, for solid-phase synthesis techniques, JM Stewart, and JD Young, Solid Phase Peptide Synthesis, 2nd ed., Pierce Chemical Co., Rockford Ill. (1984) and G. Barany and RB Merrifield, The Peptides: Analysis Synthesis, Biology editors E. Gross and J. Meienhofer, Vol. 2, Academic Press, New York, 1980, pp. 3-254; and for classical solution synthesis, M. Bodansky, Principles of Peptide Synthesis, Springer-Verlag, Berlin 1984 and E. Gross and J. Meienhofer, eds., The Peptides: Analysis, Synthesis, Biology, as above, Vol. 1).

[0155] Peptides can be chemically synthesized using the Merrifield-type solid-phase peptide synthesis method. This method can be routinely performed to produce peptides up to approximately 60-70 residues in length, and in some cases, it can be used to prepare peptides up to approximately 100 amino acids long. Larger peptides can also be synthesized through fragment condensation or natural chemical linking (Dawson et al., 2000, Ann. Rev. Biochem. 69:923-960). The advantage of using the synthetic peptide pathway is the ability to produce large quantities of peptides, even those that are rarely found naturally, with relatively high purity—purity sufficient for research, diagnostic, or therapeutic purposes.

[0156] Solid-phase peptide synthesis is described in Stewart et al., *Solid Phase Peptide Synthesis*, 2nd ed., 1984, Pierce Chemical Company, Rockford, Ill.; and Bodanszky and Bodanszky, *The Practice of Peptide Synthesis*, 1984, Springer-Verlag, New York. First, appropriately protected amino acid residues are linked via their carboxyl groups to a derivatized, insoluble polymer support, such as cross-linked polystyrene or polyamide resins. "Appropriately protected" means that a protecting group is present on both the α-amino group and any side-chain functional groups of the amino acid. Side-chain protecting groups are generally stable to the solvents, reagents, and reaction conditions used throughout the synthesis and are removable without affecting the final peptide product. The stepwise synthesis of oligopeptides is carried out by removing the N-protecting group from the initial amino acid and coupling it to the carboxyl terminus of the next amino acid in the desired peptide sequence. This amino acid is also appropriately protected. By forming reactive groups, such as carbodiimide, symmetrical anhydride, or "active ester" groups, such as hydroxybenzotriazole or pentafluorophenyl ester, the carboxyl group of the introduced amino acid can be activated, causing it to react with the N-terminus of the amino acid bound to the carrier.

[0157] Examples of solid-phase peptide synthesis methods include the BOC method, which uses tert-butyloxycarbonyl as an α-amino protecting group, and the FMOC method, which uses 9-fluorenylmethoxycarbonyl to protect the α-amino of amino acid residues. Both of these methods are well known to those skilled in the art.

[0158] The incorporation of N- and / or C-blocking groups can also be achieved using conventional procedures in solid-phase peptide synthesis. For example, to incorporate C-terminal blocking groups, the desired peptide is typically synthesized using a carrier resin as a solid phase, which has been chemically modified to cleave the peptide from the resin to obtain a peptide with the desired C-terminal blocking group. To provide a peptide with a primary amino blocking group at the C-terminus, for example, a p-methyldiphenylmethylamine (MBHA) resin is used for synthesis, whereby, upon completion of peptide synthesis, treatment with hydrofluoric acid releases the desired C-terminal amidated peptide. Similarly, the incorporation of an N-methylamine blocking group at the C-terminus is achieved using an N-methylaminoethyl-derived DVB resin, which releases a peptide with an N-methylamidated C-terminus after HF treatment. C-terminal blocking can also be achieved via esterification using conventional procedures. This requires the use of a resin / blocking group combination that allows the release of side-chain peptides from the resin, enabling subsequent reaction with the desired alcohol to form an ester functional group. The combination of the Fmoc protecting group and a DVB resin derivatized with methoxyalkoxybenzyl alcohol or an equivalent linker can be used for this purpose, wherein cleavage from the support is achieved via TFA in dichloromethane. Then, esterification of the appropriately activated carboxyl functional groups can be performed, for example with DCC, by adding the desired alcohol, followed by deprotection and separation of the esterified peptide product.

[0159] The peptides described in this invention can be prepared using standard chemical or biological methods of peptide synthesis. Biological methods include, without limitation, the expression of nucleic acids encoding the peptides in host cells or in vitro translation systems.

[0160] This invention includes a nucleic acid sequence encoding the peptide of this invention. In some embodiments, this invention includes a nucleic acid sequence encoding an amino acid sequence of one or more TRIM proteins.

[0161] Therefore, subclones encoding the nucleic acid sequences of the peptides described in this invention can be generated using conventional molecular genetic manipulation techniques for subcloning gene fragments, such as those employed by Sambrook et al. Molecular Cloning: A Laboratory Manual ,Cold Springs Laboratory, Cold Springs Harbor, New York (2012) and Ausubel et al. (eds.) Current Protocols in Molecular Biology John Wiley & Sons (New York, NY) (1999 and earlier editions), each of which is incorporated herein by reference in its entirety. Subclones are then expressed in vitro or in vivo in bacterial cells to produce smaller proteins or peptides for testing specific activities.

[0162] In combination with certain formulations, these peptides can be effective intracellular agents. However, to enhance the potency of these peptides, one or more peptides of the present invention can be provided together with a second peptide to provide a fusion peptide that promotes transcytosis, for example, cellular uptake of the peptide. For example, in some embodiments, the peptide may include a cell-penetrating domain, such as a cell-penetrating peptide (CPP), to allow the peptide to enter the cell. In some embodiments, the CPP is derived from HIV Tat.

[0163] For illustration, one or more peptides of the present invention may be provided as part of a fusion peptide, together with all or a fragment of the N-terminal domain of the HIV protein Tat, which can promote transcytosis, for example, residues 1-72 of Tat or smaller fragments thereof. In some embodiments, the peptide comprises the protein transduction domain of HIV Tat. In other embodiments, one or more peptides may be provided as a fusion peptide together with all or a portion of the antennapedia III protein. Other cell-penetrating domains that mediate peptide uptake are known in the art and are equally suitable for use in the fusion peptides of the present invention.

[0164] Nucleic acid

[0165] In some embodiments, the compositions of the present invention comprise one or more isolated nucleic acids. For example, in some embodiments, one or more isolated nucleic acids encode one or more TRIM proteins. In some embodiments, one or more isolated nucleic acids encode an amino acid sequence selected from one or more of the following: human TRIM1, TRIM2, TRIM3, TRIM4, TRIM5, TRIM6, TRIM7, TRIM8, TRIM9, TRIM10, TRIM11, TRIM13, TRIM14, TRIM15, TRIM16, TRIM17, TRIM18, TRIM19, TRIM20, TRIM21, TRIM22, TRIM23, TRIM24, TRIM25, TRIM26, TRIM27, TRIM28, TRIM29, TRIM31, TRIM32, TRIM33, TRIM34, TRIM35, TRIM36, TRIM37, TRIM38, TRIM3 ... 38, TRIM39, TRIM40, TRIM41, TRIM42, TRIM43, TRIM44, TRIM45, TRIM46, TRIM47, TRIM48, TRIM49, TRIM50, TRIM51, TRIM52, TRIM54, TRIM55, TRIM56, TRIM58, TRIM59, TRIM60, TRIM61, TRIM62, TRIM63, TRIM64, TRIM65, TRIM66, TRIM67, TRIM68, TRIM69, TRIM70, TRIM71, TRIM72, TRIM73, TRIM74, TRIM76 and TRIM77 peptides; mouse TRIM12 and TRIM30 peptides; and their functional variants. In some embodiments, one or more isolated nucleic acids encode amino acid sequences selected from one or more of the following: human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM21, TRIM24, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM37, TRIM46, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69 and TRIM70 peptides; mouse TRIM12 and TRIM30 peptides; and functional variants thereof.In some embodiments, one or more isolated nucleic acids encode amino acid sequences selected from one or more of the following: human TRIM10, TRIM11, TRIM24, TRIM36, TRIM37, TRIM40, TRIM49, TRIM55, TRIM58 and TRIM68 peptides and their functional variants. In some embodiments, one or more isolated nucleic acids encode amino acid sequences selected from one or more of the following: human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM12, TRIM17, TRIM18, TRIM19, TRIM21, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, and TRIM70 peptides and their functional variants. In some embodiments, one or more isolated nucleic acids encode amino acid sequences selected from one or more of the following: human TRIM10, TRIM11, and TRIM55 peptides and their functional variants. In some embodiments, one or more isolated nucleic acids encode amino acid sequences selected from one or more of the following: human TRIM2, TRIM3, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM26, TRIM29, TRIM30, TRIM31, TRIM36, TRIM41, TRIM42, TRIM43, TRIM46, TRIM49, TRIM55, TRIM56, TRIM63, TRIM64, TRIM68, TRIM69, TRIM70, TRIM71, and TRIM73 peptides and their functional variants. In some embodiments, one or more isolated nucleic acids encode amino acid sequences selected from one or more of the following: human TRIM10, TRIM11, TRIM36, TRIM55, and TRIM68 peptides and their functional variants. In some embodiments, one or more isolated nucleic acids encode amino acid sequences selected from one or more of the following: human TRIM10, TRIM11, TRIM24, TRIM36, and TRIM58 peptides and their functional variants. In some embodiments, one or more isolated nucleic acids encode amino acid sequences selected from one or more of the following: human TRIM10, TRIM11, TRIM17, TRIM36, TRIM37, TRIM40, TRIM49, and TRIM55 peptides and their functional variants.In some embodiments, one or more isolated nucleic acids encode the amino acid sequence of a human TRIM10 peptide or a functional variant thereof. In some embodiments, the peptide of the composition comprises the amino acid sequence of a human TRIM11 peptide or a functional variant thereof.

[0166] In some implementations, the isolated nucleic acid comprises a nucleotide sequence encoding an amino acid sequence of one or more TRIM proteins provided by the accession number in Table 1.

[0167] Furthermore, this invention covers isolated nucleic acids comprising nucleotide sequences substantially homologous to those encoding the nucleotide sequences disclosed herein. The “substantially homologous” nucleic acid sequences share at least about 50%, at least about 70%, at least about 80%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, and at least about 99% identity with the nucleotide sequences of the isolated nucleic acids encoding the peptides of this invention.

[0168] Therefore, the present invention covers expression vectors and methods for introducing exogenous DNA into cells and for the expression of said exogenous DNA in said cells, such as those described, for example, in Sambrook et al. (2012, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and Ausubel et al. (1997, Current Protocols in Molecular Biology, John Wiley & Sons, New York).

[0169] Desired nucleic acids encoding one or more TRIM proteins can be cloned into various types of vectors. However, the invention should not be considered limited to any specific vector. Instead, the invention should be considered to encompass a wide range of vectors readily available and / or well-known in the art. For example, the polynucleotides desired by the invention can be cloned into vectors including, but not limited to, plasmids, phages, phage derivatives, animal viruses, and entrapments. Vectors of particular interest include expression vectors, replication vectors, and transgenic vectors.

[0170] In specific embodiments, the expression vector is selected from viral vectors, bacterial vectors, and mammalian cell vectors. Various expression vector systems exist that include at least some or all of the components discussed above. Prokaryotic and / or eukaryotic vector-based systems can be used in conjunction with this invention to produce polynucleotides or their homologous polypeptides. Numerous such systems are commercially available and widely applicable.

[0171] Furthermore, the expression vector can be delivered to cells in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (2012) and Ausubel et al. (1997) and in other virology and molecular biology manuals. Viruses useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, and lentiviruses. Generally, suitable vectors contain an origin of replication that functions in at least one organism, a promoter sequence, a convenient restriction endonuclease site, and one or more optional markers. (See, for example, WO 01 / 96584; WO 01 / 29058; and U.S. Patent No. 6,326,193).

[0172] Several virus-based systems for gene transfer into mammalian cells have been developed. For example, retroviruses provide a convenient platform for gene delivery systems. Selected genes can be inserted into vectors and packaged in retroviral particles using techniques known in the art. The recombinant virus can then be isolated and delivered to recipient cells in vivo or in vitro. Several retroviral systems are known in the art. In some embodiments, adenoviral vectors are used. Some adenoviral vectors are known in the art. In some embodiments, lentiviral vectors are used.

[0173] For example, vectors derived from retroviruses, such as lentiviruses, are suitable tools for achieving long-term gene transfer because they allow for the long-term stable integration of transgenes and their proliferation in daughter cells. Lentiviral vectors have additional advantages over vectors derived from oncogenic retroviruses, such as murine leukemia viruses, because they can transduce non-proliferating cells, such as hepatocytes. They also have the added advantage of low immunogenicity. In a preferred embodiment, the composition comprises a vector derived from adeno-associated virus (AAV). AAV vectors have become powerful gene delivery tools for treating a variety of conditions. AAV vectors possess several characteristics that make them ideally suited for gene therapy, including lack of pathogenicity, minimal immunogenicity, and the ability to transduce postmitotic cells in a stable and efficient manner. By selecting an appropriate combination of AAV serotype, promoter, and delivery method, the expression of a specific gene contained within the AAV vector can be specifically targeted to one or more cell types.

[0174] In some embodiments, the coding sequence is contained within an AAV vector. More than 30 naturally occurring AAV serotypes are available. A variety of natural variants exist within the AAV capsid, allowing for the identification and use of AAVs with properties particularly suited to skeletal muscle. AAV viruses can be engineered using conventional molecular biology techniques, enabling the optimization of these particles for cell-specific delivery of nucleic acid sequences, minimization of immunogenicity, regulation of stability and particle lifespan, efficient degradation, and precise delivery to the nucleus.

[0175] Therefore, the expression of one or more TRIM proteins can be achieved by delivering recombinant engineered AAVs or artificial AAVs containing one or more coding sequences. The use of AAVs is a common mode of exogenous DNA delivery because it is relatively non-toxic, provides efficient gene transfer, and can be easily optimized for specific purposes. Exemplary AAV serotypes include, but are not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9.

[0176] The desired AAV fragments used for assembly into a vector include cap proteins comprising vp1, vp2, vp3 and a hypervariable region, rep proteins comprising rep 78, rep 68, rep 52 and rep 40, and sequences encoding these proteins. These fragments can be readily used in a variety of vector systems and host cells. These fragments can be used alone, in combination with other AAV serotype sequences or fragments, or in combination with elements from other AAV or non-AAV viral sequences. As used herein, artificial AAV serotypes are not limited to AAVs having a non-naturally present capsid protein. Such artificial capsids can be generated by combining selected AAV sequences (e.g., fragments of the vp1 capsid protein) with heterologous sequences obtained from different selected AAV serotypes, non-adjacent portions of the same AAV serotype, non-AAV viral sources, or non-viral sources using any suitable technique. Artificial AAV serotypes can be, without limitation, chimeric AAV capsids, recombinant AAV capsids, or “humanized” AAV capsids. Therefore, exemplary AAVs or artificial AAVs suitable for expressing one or more TRIM proteins include AAV2 / 8 (see U.S. Patent No. 7,282,199), AAV2 / 5 (from the National Institutes of Health), AAV2 / 9 (International Patent Publication No. WO2005 / 033321), AAV2 / 6 (U.S. Patent No. 6,156,303), and AAVrh8 (International Patent Publication No. WO2003 / 042397), etc.

[0177] For the desired expression of a polynucleotide, at least one module in each promoter functions to locate the start site for RNA synthesis. The most well-known example of this is the TATA box, but in some promoters lacking the TATA box, such as the promoters of mammalian terminal transdeoxynucleotidase genes and SV40 genes, the discontinuous elements covering the start site themselves help to fix the start location.

[0178] Other promoter elements, or enhancers, regulate the frequency of transcription initiation. These are typically located 30–110 bp upstream of the start site, although recent studies have shown that many promoters also contain functional elements downstream of the start site. The spacing between promoter elements is generally flexible, allowing promoter function to be preserved when elements are reversed or moved relative to each other. In the thymidine kinase (TK) promoter, the spacing between promoter elements can increase to 50 bp before activity begins to decline. Depending on the promoter, it appears that individual elements can act synergistically or independently to activate transcription.

[0179] A promoter can be a promoter that binds naturally to a gene or polynucleotide sequence, such as one obtained by isolating a 5' non-coding sequence located upstream of the coding segment and / or exon. Such a promoter can be referred to as "endogenous." Similarly, an enhancer can be an enhancer that binds naturally to a polynucleotide sequence, located downstream or upstream of that sequence. Alternatively, certain advantages can be gained by placing the coding polynucleotide segment under the control of a recombinant or heterologous promoter, which refers to a promoter that does not normally bind to the polynucleotide sequence in its natural environment. A recombinant or heterologous enhancer also refers to an enhancer that does not normally bind to the polynucleotide sequence in its natural environment. These promoters or enhancers can include promoters or enhancers of other genes, and promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cells, as well as non-"naturally occurring" promoters or enhancers, i.e., promoters or enhancers containing different elements of different transcriptional regulatory regions and / or mutants that alter expression. In addition to synthesizing nucleic acid sequences that generate promoters and enhancers, the compositions disclosed herein can be used with recombinant cloning and / or nucleic acid amplification techniques, including PCR™ to generate sequences (US Patent 4,683,202, US Patent 5,928,906). Furthermore, control sequences that guide the transcription and / or expression of sequences in non-nuclear organelles, such as mitochondria and chloroplasts, can also be considered.

[0180] Naturally, it is important to use promoters and / or enhancers that effectively direct the expression of DNA segments in the chosen cell type, organelle, and organism for expression. Those skilled in the art of molecular biology are generally familiar with how combinations of promoters, enhancers, and cell types can be used for protein expression; see, for example, Sambrook et al. (2012). The promoters used can be constitutive, tissue-specific, inducible, and / or useful under appropriate conditions to direct high-level expression of the introduced DNA segment, as is advantageous in the large-scale production of recombinant proteins and / or peptides. The promoters can be heterologous or endogenous.

[0181] To evaluate the expression of the desired polynucleotide, the expression vector to be introduced into the cell may also contain an optional marker gene or a reporter gene, or both, to facilitate the identification and selection of expressing cells from a population of cells attempting to be transfected or infected by a viral vector. In other embodiments, the optional marker may be carried on a separate DNA fragment and used in a co-transfection procedure. Both the optional marker and the reporter gene may be side-linked with appropriate regulatory sequences to enable expression in the host cell. Useful optional markers are known in the art and include, for example, antibiotic resistance genes such as neo.

[0182] Reporter genes are used to identify potentially transfected cells and to evaluate the functionality of regulatory sequences. Reporter genes encoding easily measurable proteins are well known in the art. Generally, a reporter gene is a gene that is absent or not expressed in the recipient organism or tissue, and that encodes a protein whose expression is indicated by some easily detectable property, such as enzyme activity. The expression of the reporter gene is measured at an appropriate time after DNA is introduced into the recipient cells.

[0183] Suitable reporter genes may include genes encoding luciferase, β-galactosidase, chloramphenicol acetyltransferase, secretory alkaline phosphatase, or green fluorescent protein (see, for example, Ui-Tei et al., 2000 FEBS Lett. 479:79-82). Suitable expression systems are well-known and can be prepared or commercially available using well-known techniques. Internal deletion constructs can be generated using unique internal restriction sites or by partially digesting non-unique restriction sites. The constructs can then be transfected into cells exhibiting high levels of siRNA polynucleotide and / or polypeptide expression. Generally, constructs containing a minimal 5' flanking region that exhibit the highest expression level of the reporter gene are identified as promoters. These promoter regions can be ligated to the reporter gene and used to evaluate the ability of reagents to regulate promoter-driven transcription.

[0184] In the context of expression vectors, vectors can be readily introduced into host cells, such as mammalian, bacterial, yeast, or insect cells, using any method in the art. For example, expression vectors can be transferred into host cells by physical, chemical, or biological means.

[0185] Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipid transfection, particle bombardment, microinjection, and electroporation. Methods for generating cells containing vectors and / or exogenous nucleic acids are well known in the art. See, for example, Sambrook et al. (2012, Molecular Cloning: A Laboratory Manual, Cold SpringHarbor Laboratory, New York) and Ausubel et al. (1997, Current Protocols in Molecular Biology, John Wiley & Sons, New York).

[0186] Biological methods for introducing polynucleotides of interest into host cells include the use of DNA and RNA vectors. Viral vectors, and particularly retroviral vectors, have become the most widely used method for inserting genes into mammalian, such as human, cells. Other viral vectors can be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, and adeno-associated viruses, among others. See, for example, U.S. Patent Nos. 5,350,674 and 5,585,362.

[0187] Chemical methods for introducing polynucleotides into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes. Liposomes (i.e., artificial membrane capsules) are preferred colloidal systems for use as delivery media in vitro and in vivo. The preparation and use of these systems are well known in the art.

[0188] Regardless of the methods used to introduce exogenous nucleic acids into host cells, various assays can be performed to confirm the presence of recombinant DNA sequences in said host cells. These assays include, for example, "molecular biology" assays well known to those skilled in the art, such as DNA blotting and RNA blotting, RT-PCR and PCR; and "biochemical" assays, such as those by immunological means (ELISA and immunoblotting) or by assays described herein, to detect the presence or absence of specific peptides to identify whether reagents are within the scope of this invention.

[0189] Any DNA vector or delivery medium can be used to transfer desired polynucleotides into cells in vitro or in vivo. In cases where a non-viral delivery system is used, liposomes are the preferred delivery medium. Therefore, the aforementioned delivery systems and procedures can be found in Gene Targeting Protocols, 2nd Edition, pp. 1-35 (2002) and Gene Transfer and Expression Protocols, Vol. 7, edited by Murray, pp. 81-89 (1991).

[0190] "Liposomes" is a general term encompassing a variety of monolayer and multilayer lipid mediators formed through the generation of closed lipid bilayers or aggregates. Liposomes can be characterized as vesicular structures having a phospholipid bilayer membrane and an internal aqueous mediator. Multilayer liposomes have multiple lipid layers separated by an aqueous mediator. They spontaneously form when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo rearrangement before the formation of the closed structure, and water and dissolved solutes are embedded between the lipid bilayers. However, the present invention also covers compositions having structures in solution that differ from normal vesicular structures. For example, the lipids may take the form of micelles or exist simply as heterogeneous aggregates of lipid molecules. Lipofectamine-nucleic acid complexes are also considered.

[0191] In some embodiments, the compositions of the present invention comprise in vitro transcribed (IVT) RNA encoding one or more components of one or more TRIM proteins. In some embodiments, the IVT RNA may be introduced into cells as a transient transfection form. RNA is generated by in vitro transcription using a synthetically produced plasmid DNA template. The DNA of interest from any source can be directly converted into a template for in vitro mRNA synthesis by PCR using appropriate primers and RNA polymerase. The DNA source may be, for example, genomic DNA, plasmid DNA, phage DNA, cDNA, synthetic DNA sequences, or any other suitable DNA source. The desired template for in vitro transcription is one or more TRIM proteins or fragments of TRIM proteins.

[0192] In some embodiments, the DNA used for PCR contains open reading frames. The DNA may be derived from a naturally occurring DNA sequence derived from an organism's genome. In some embodiments, the DNA is a full-length gene of interest or a portion of a gene. The gene may include some or all of the 5' and / or 3' untranslated regions (UTRs). The gene may include exons and introns. In some embodiments, the DNA used for PCR is a human gene. In another embodiment, the DNA used for PCR is a human gene including both 5' and 3' UTRs. Alternatively, the DNA may be an artificial DNA sequence that is not normally expressed in naturally occurring organisms. An exemplary artificial DNA sequence is a sequence containing a portion of a gene linked together to form an open reading frame encoding a fusion protein. The linked DNA portions may originate from a single organism or from more than one organism.

[0193] In some embodiments, the compositions of the present invention comprise modified nucleic acids encoding one or more TRIM proteins described herein. For example, in some embodiments, the compositions comprise nucleoside-modified RNA. In some embodiments, the compositions comprise nucleoside-modified mRNA. Nucleoside-modified mRNA has particular advantages over unmodified mRNA, including, for example, improved stability, low immunogenicity, and enhanced translation. Nucleoside-modified mRNA useful in the present invention is further described in U.S. Patent No. 8,278,036, the entire contents of which are incorporated herein by reference.

[0194] Modified cells

[0195] This invention includes compositions comprising cells containing one or more TRIM proteins, nucleic acids encoding one or more TRIM proteins, or combinations thereof. In some embodiments, the cells are genetically modified to express the proteins and / or nucleic acids of this invention. In some embodiments, the genetically modified cells are autologous to a subject being treated with the compositions of this invention. Alternatively, the cells may be allogeneic, syngeneic, or xenogeneic to the subject. In some embodiments, the cells are capable of secreting or releasing the expressed proteins into the extracellular space (intercellular space) to deliver peptides to one or more other cells.

[0196] Genetically modified cells can be modified in vivo or in vitro using standard techniques in the art. Gene modification of cells can be performed using expression vectors or naked isolated nucleic acid constructs.

[0197] In some embodiments, cells are obtained and modified in vitro using isolated nucleic acids encoding one or more proteins described herein. In some embodiments, the cells are derived from a subject, genetically modified to express proteins and / or nucleic acids, and then administered to the subject. In some embodiments, the cells are expanded in vitro or ex vivo to generate a cell population, wherein at least a portion of the population is administered to a subject in need.

[0198] In some embodiments, cellular genes are modified to stably express proteins. In another embodiment, cellular genes are modified to transiently express proteins.

[0199] Treatment

[0200] The present invention also provides a treatment for diseases or conditions related to protein misfolding, protein aggregates, or combinations thereof.

[0201] In some embodiments, the method includes administering a composition comprising an activator of one or more TRIM proteins to a subject. In some embodiments, the subject suffers from a disease or condition associated with protein misfolding or protein aggregates. In some embodiments, the subject suffers from a disease or condition associated with misfolded proteins and / or protein aggregates of amyloid-β, α-synuclein, Tau, prions, SOD1, TDP-43, FUS, p53, p53 mutants, and polyglutamine repeat-related proteins, such as huntingtin and ataxia proteins.

[0202] In various embodiments, the diseases and conditions that can be treated by the methods described in this invention include, but are not limited to: SCA1, SCA2, SCA3, SCA6, SCA7, SCA17, Huntington's disease, dentate nucleus-rubra-pallidus hypothalamic atrophy (DRPLA), Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), transmissible spongiform encephalopathy (prion disease), Lewy body dementia (DLB), multiple system atrophy (MSA), frontotemporal lobe degeneration (FTLD), AL amyloidosis, AA amyloidosis, familial Mediterranean fever, senile systemic amyloidosis, and familial amyloidosis. Degenerative polyneuropathy, Icelandic hereditary cerebral amyloid angiopathy, hereditary cerebral hemorrhage with amyloid degeneration, pituitary prolactinoma, frontotemporal degeneration (FTLD-tau), progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), argyrophilic granulation disease (AGD), frontotemporal dementia and Parkinson's disease associated with chromosome 17 (FTDP-17), vacuoletous tau disease, Lytico-bodig disease, globular tau disease (GGT), age-related tau astrocytosis (ARTAG), Pick's disease, primary age-related tau disease (PART), tangles only Dementia (TOD), chronic traumatic encephalopathy (CTE), anti-IgLON5-associated tau protein disease, Guadeloupe Parkinson's syndrome, nodding syndrome (NS), ganglioglioma, gangliocytoma, meningioma, post-encephalitis Parkinson's syndrome, subacute sclerosing panencephalitis (SSPE), lead encephalopathy, tuberous sclerosis, pantothenic kinase-associated neurodegeneration, lipofuscinosis, Shy-Drager syndrome, striatum-substantia nigra degeneration, olivopontocerebellar atrophy, Hallervorden-Spatz syndrome, REM sleep behavior disorder (RPD), amygdala-restrictive pathways The following are considered as transgenic Alzheimer's disease (AD / ALB), frontotemporal degeneration (FTLD-TDP), multisystem protein disease (MSP), Perry's disease, facial-onset sensory and motor neuron disease (FOSMN), age-related TDP-43 brain disease with sclerosis (CARTS), limbic system-predominant age-related TDP-43 encephalopathy (LATE), sporadic inclusion body myositis (sIBM), chronic traumatic encephalopathy (CTE), primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), Guam Parkinson's dementia syndrome (G-PDC), and Guam amyotrophic lateral sclerosis (G-ALS).

[0203] When provided by the methods detailed herein, those skilled in the art will understand that the invention is not limited to the treatment of established diseases related to protein misfolding or protein aggregates. Specifically, the disease or condition need not have demonstrated an extent of harm to the subject; indeed, it is not necessary to detect the disease or condition in the subject prior to the administration of treatment. That is, obvious signs or symptoms of the disease or condition need not be present before the invention can provide benefit. Therefore, the invention includes methods for preventing diseases or conditions related to protein misfolding or protein aggregates, wherein, as previously discussed elsewhere herein, an activator composition can be administered to the subject prior to the onset of the disease or condition, thereby preventing the disease or condition.

[0204] When provided with respect to the disclosure herein, those skilled in the art will understand that prevention of diseases associated with protein misfolding or protein aggregates encompasses the administration of activators to subjects as a preventative measure against the occurrence or development of diseases associated with protein misfolding or protein aggregates. As discussed more fully elsewhere herein, methods for increasing the level or activity of genes or gene products encompass a wide range of techniques not only for increasing the level and activity of polypeptide gene products but also for increasing the expression of nucleic acids, including transcription, translation, or both.

[0205] Furthermore, as disclosed elsewhere herein, those skilled in the art will understand that, once provided by the teachings presented herein, the present invention covers methods for treating or preventing a variety of diseases associated with protein misfolding or protein aggregates, wherein regulating the level or activity of a gene or gene product treats or prevents said disease. Various methods for evaluating whether a disease is associated with protein misfolding or protein aggregates are known in the art. Moreover, the present invention covers treatments or preventions of such diseases that may be discovered in the future.

[0206] In one aspect, the method includes the use of one or more TRIM proteins to stabilize misfolded proteins. In some aspects, stabilizing functionally misfolded proteins using one or more TRIM proteins as described herein can treat or prevent diseases or conditions associated with misfolded proteins.

[0207] In another aspect, the method includes the use of one or more TRIM proteins to reduce protein aggregate levels. In some embodiments, the level of protein aggregates is reduced by degrading the protein aggregates. In some embodiments, at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, or about 90% of the protein aggregate levels prior to application of the composition are degraded. In some embodiments, the method effectively reduces protein aggregate levels by about 10% to about 90%. In some embodiments, the method effectively reduces protein aggregate levels by about 30% to about 90%. In some embodiments, the method effectively reduces protein aggregate levels by about 50% to about 90%. In some embodiments, the method effectively reduces protein aggregate levels by about 10%, about 15%, about 20%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%.

[0208] In some embodiments, the level of protein aggregates is reduced by dissolving protein aggregates. In some embodiments, the ratio of insoluble protein to soluble protein is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%. In some embodiments, the method effectively reduces the ratio of insoluble protein to soluble protein by about 10% to about 90%. In some embodiments, the method effectively reduces the ratio of insoluble protein to soluble protein by about 30% to about 90%. In some embodiments, the method effectively reduces the ratio of insoluble protein to soluble protein by about 50% to about 90%. In some embodiments, the method effectively reduces the ratio of insoluble protein to soluble protein by about 10%, about 15%, about 20%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%.

[0209] In some embodiments, protein aggregate levels decrease after at least about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, or about 2 weeks. In some embodiments, the method effectively reduces protein aggregate levels over an extended period of time. In some embodiments, protein aggregate levels decrease for at least about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, or about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 26 weeks, about 39 weeks, about 1 year, or about 2 years.

[0210] This invention covers the administration of activators of genes or gene products. To practice the methods described herein, those skilled in the art will understand, based on the disclosure provided herein, how to formulate and administer suitable activator compositions to subjects. This invention is not limited to any specific method of administration or treatment regimen.

[0211] In some embodiments, the method includes administering an effective amount of the composition to a subject in need, the composition increasing the expression or activity of one or more TRIM proteins.

[0212] For example, in some embodiments, the method includes administering an effective amount of the composition to a subject in need, the composition increasing the expression or activity of one or more TRIM proteins.

[0213] In some embodiments, the TRIM protein is selected from one or more of the following: human TRIM1, TRIM2, TRIM3, TRIM4, TRIM5, TRIM6, TRIM7, TRIM8, TRIM9, TRIM10, TRIM11, TRIM13, TRIM14, TRIM15, TRIM16, TRIM17, TRIM18, TRIM19, TRIM20, TRIM21, TRIM22, TRIM23, TRIM24, TRIM25, TRIM26, TRIM27, TRIM28, TRIM29, TRIM31, TRIM32, TRIM33, TRIM34, TRIM35, TRIM36, TRIM37, TRIM3 8. TRIM39, TRIM40, TRIM41, TRIM42, TRIM43, TRIM44, TRIM45, TRIM46, TRIM47, TRIM48, TRIM49, TRIM50, TRIM51, TRIM52, TRIM54, TRIM55, TRIM56, TRIM58, TRIM59, TRIM60, TRIM61, TRIM62, TRIM63, TRIM64, TRIM65, TRIM66, TRIM67, TRIM68, TRIM69, TRIM70, TRIM71, TRIM72, TRIM73, TRIM74, TRIM76 and TRIM77; and mouse TRIM12 and TRIM30. In some embodiments, the TRIM protein is selected from one or more of the following: human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM21, TRIM24, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM37, TRIM46, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69 and TRIM70; and mouse TRIM12 and TRIM30. In some embodiments, the TRIM protein is selected from one or more of the following: human TRIM10, TRIM11, TRIM24, TRIM36, TRIM37, TRIM40, TRIM49, TRIM55, TRIM58 and TRIM68.In some embodiments, the TRIM protein is selected from one or more of the following: human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM12, TRIM17, TRIM18, TRIM19, TRIM21, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, and TRIM70. In some embodiments, the TRIM protein is selected from one or more of the following: human TRIM10, TRIM11, and TRIM55. In some embodiments, the TRIM protein is selected from one or more of the following: human TRIM2, TRIM3, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM26, TRIM29, TRIM30, TRIM31, TRIM36, TRIM41, TRIM42, TRIM43, TRIM46, TRIM49, TRIM55, TRIM56, TRIM63, TRIM64, TRIM68, TRIM69, TRIM70, TRIM71, and TRIM73. In some embodiments, the TRIM protein is selected from one or more of the following: human TRIM10, TRIM11, TRIM36, TRIM55, and TRIM68. In some embodiments, the TRIM protein is selected from one or more of the following: human TRIM10, TRIM11, TRIM24, TRIM36, and TRIM58. In some embodiments, the TRIM protein is selected from one or more of the following: human TRIM10, TRIM11, TRIM17, TRIM36, TRIM37, TRIM40, TRIM49, and TRIM55. In some embodiments, the TRIM protein is human TRIM10. In some embodiments, the TRIM protein is human TRIM11.

[0214] Methods for preventing or treating protein misfolding and aggregation using TRIM proteins, nucleic acids encoding TRIM proteins, and combinations thereof are disclosed in International Patent Publication No.: WO 2016 / 196328 A1, the entire contents of which are incorporated herein by reference.

[0215] In some embodiments, the method includes increasing the expression or activity of one or more TRIM proteins in at least one nerve cell of the subject. For example, in some embodiments, the method includes increasing the expression or activity of one or more TRIM proteins in at least one neuron, glial cell, astrocyte, oligodendrocyte, Purkinje cell, pyramidal cell, etc.

[0216] In some embodiments, the method includes contacting a subject's neural tissue with an effective amount of a composition that enhances the expression or activity of one or more components of one or more TRIM proteins. For example, in some embodiments, the method includes contacting a subject's neurons, glial cells, astrocytes, oligodendrocytes, Purkinje cells, pyramidal cells, etc., with an effective amount of the composition that enhances the expression or activity of one or more TRIM proteins. In some embodiments, the nerve cells are affected by protein misfolding, protein aggregates, or combinations thereof.

[0217] Those skilled in the art will understand that the activators described in this invention can be applied alone or in any combination. Furthermore, the activators described in this invention can be applied alone or in any combination in a temporal sense, wherein they can be applied simultaneously, or before and / or after each other. Based on the disclosure provided herein, those skilled in the art will understand that the activator compositions of this invention can be used to prevent or treat diseases or conditions related to misfolded proteins or protein aggregates, and that the activator compositions can be used alone or in any combination with another activator to achieve preventive or therapeutic effects.

[0218] In several embodiments, any activator of the invention described herein may be administered alone or in combination with other activators of other molecules associated with diseases related to protein misfolding or protein aggregates. In several embodiments, any activator of the invention described herein may be administered alone or in combination with other therapeutic or preventative agents for the treatment or prevention of diseases related to protein misfolding or protein aggregates. Exemplary therapeutic agents that may be used in combination with the activators of the invention include, but are not limited to, anti-amyloid-β antibodies and anti-Tau antibodies.

[0219] Gene therapy

[0220] Contacting cells in a subject with a nucleic acid composition encoding a protein that enhances the expression or activity of one or more TRIM proteins can inhibit or delay the onset (onset) of one or more symptoms of a disease or condition associated with protein misfolding or protein aggregates.

[0221] In some embodiments, the nucleic acid composition of the present invention encodes one or more peptides. For example, in some embodiments, the nucleic acid composition may encode a peptide comprising an amino acid sequence of one or more TRIM proteins. In some embodiments, the nucleic acid composition encodes one or more TRIM proteins selected from the following: human TRIM1, TRIM2, TRIM3, TRIM4, TRIM5, TRIM6, TRIM7, TRIM8, TRIM9, TRIM10, TRIM11, TRIM13, TRIM14, TRIM15, TRIM16, TRIM17, TRIM18, TRIM19, TRIM20, TRIM21, TRIM22, TRIM23, TRIM24, TRIM25, TRIM26, TRIM27, TRIM28, TRIM29, TRIM30, TRIM31, TRIM32, TRIM33, TRIM34, TRIM35, TRIM36, TRIM37. TRIM38, TRIM39, TRIM40, TRIM41, TRIM42, TRIM43, TRIM44, TRIM45, TRIM46, TRIM47, TRIM48, TRIM49, TRIM50, TRIM51, TRIM52, TRIM54, TRIM55, TRIM56, TRIM58, TRIM59, TRIM60, TRIM61, TRIM62, TRIM63, TRIM64, TRIM65, TRIM66, TRIM67, TRIM68, TRIM69, TRIM70, TRIM71, TRIM72, TRIM73, TRIM74, TRIM76 and TRIM77; and mouse TRIM12 and TRIM30. In some embodiments, the nucleic acid composition encodes one or more TRIM proteins selected from the following: human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM21, TRIM24, TRIM26, TRIM29, TRIM31, TRIM34, TRIM36, TRIM37, TRIM46, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69 and TRIM70; and mouse TRIM12 and TRIM30.In some embodiments, the nucleic acid composition encodes one or more TRIM proteins selected from the following: human TRIM10, TRIM11, TRIM24, TRIM36, TRIM37, TRIM40, TRIM49, TRIM55, TRIM58, and TRIM68. In some embodiments, the nucleic acid composition encodes one or more TRIM proteins selected from the following: human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM12, TRIM17, TRIM18, TRIM19, TRIM21, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, and TRIM70. In some embodiments, the nucleic acid composition encodes one or more TRIM proteins selected from the following: human TRIM10, TRIM11, and TRIM55. In some embodiments, the nucleic acid composition encodes one or more TRIM proteins selected from the following: human TRIM2, TRIM3, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM26, TRIM29, TRIM30, TRIM31, TRIM36, TRIM41, TRIM42, TRIM43, TRIM46, TRIM49, TRIM55, TRIM56, TRIM63, TRIM64, TRIM68, TRIM69, TRIM70, TRIM71, and TRIM73. In some embodiments, the nucleic acid composition encodes one or more TRIM proteins selected from the following: human TRIM10, TRIM11, TRIM36, TRIM55, and TRIM68. In some embodiments, the nucleic acid composition encodes one or more TRIM proteins selected from the following: human TRIM10, TRIM11, TRIM24, TRIM36, and TRIM58. In some embodiments, the nucleic acid composition encodes one or more TRIM proteins selected from the following: human TRIM10, TRIM11, TRIM17, TRIM36, TRIM37, TRIM40, TRIM49, and TRIM55. In some embodiments, the nucleic acid composition encodes human TRIM10. In some embodiments, the nucleic acid composition encodes human TRIM11.

[0222] In some embodiments, the nucleic acid composition encoding one or more TRIM proteins comprises one or more sequences having one or more accession numbers as listed in Table 1.

[0223] According to the present invention, a method for delivering proteins to cells carrying normal or mutated genes associated with reduced or insufficient activity of one or more TRIM proteins is also provided. Delivering proteins to cells with mutated genes should allow the recipient cells to function normally. Nucleic acids encoding peptides can be introduced into cells in a vector, thereby retaining the nucleic acids extrachromosomally. In this case, the nucleic acids will be expressed from an extrachromosomal location within the cell. More preferably, the nucleic acids or portions thereof are introduced into the cell in a manner that integrates them into the cell's genome or recombines with endogenous mutated genes present in the cell. Gene introduction vectors for recombination, integration, and extrachromosomal maintenance are known in the art, and any suitable vector can be used. Methods for introducing DNA into cells, such as electroporation, calcium phosphate coprecipitation, and viral transduction, are known in the art, and the selection of methods is within the capabilities of those skilled in the art.

[0224] As discussed in general above, where applicable, nucleic acids can be used in gene therapy to increase the level or activity of the peptides described in this invention, even in individuals where wild-type genes are expressed at “normal” levels but the gene product is underfunctional.

[0225] "Gene therapy" includes conventional gene therapy that achieves a lasting effect through a single treatment, as well as the administration of gene therapy agents, which includes one or repeated administration of therapeutically effective DNA or mRNA. Oligonucleotides can be modified to enhance their uptake, for example, by replacing their negatively charged phosphodiester groups with uncharged groups. One or more TRIM proteins of the present invention can be delivered using gene therapy methods, for example, locally or systemically in nerve cells or tissues (e.g., via vectors that selectively target specific tissue types, such as tissue-specific adeno-associated virus vectors). In some embodiments, primary cells harvested from an individual can be transfected in vitro with nucleic acids encoding any peptide of the present invention, and then the transfected cells can be returned to the individual.

[0226] Gene therapy approaches are well known in the art. See, for example, WO96 / 07321, which discloses the use of gene therapy approaches to generate intracellular antibodies. Gene therapy approaches have also been successfully demonstrated in human patients. See, for example, Baumgartner et al., Circulation 97: 12, 1114-1123 (1998); Fatham, CG 'A genetherapy approach to treatment of autoimmune diseases', Immun. Res. 18:15-26 (2007); and U.S. Patent No. 7,378089, both of which are incorporated herein by reference. See also Bainbridge JWB et al., “Effect of gene therapy on visual function in Leber's congenital Amaurosis”. N Engl J Med 358:2231-2239, 2008; and Maguire AM et al., “Safety and efficacy of gene transfer for Leber's Congenital Amaurosis”. N Engl J Med 358:2240-8, 2008.

[0227] There are two main methods for introducing nucleic acids encoding peptides or proteins (optionally contained in a vector) into patient cells: in vivo and in vitro. For in vivo delivery, in some cases, the nucleic acid is injected directly into the patient, and sometimes at the site where the protein is most needed. For in vitro therapy, the patient cells are removed, the nucleic acid is introduced into these isolated cells, and the modified cells are applied directly to the patient or, for example, encapsulated in a porous membrane implanted in the patient (see, for example, U.S. Patent Nos. 4,892,538 and 5,283,187). A variety of techniques are available for introducing nucleic acids into living cells. The variation in this technique depends on whether the nucleic acid is transferred in vitro into cultured cells or in vivo into the cells of the intended host. Techniques suitable for the in vitro transfer of nucleic acids into mammalian cells include the use of liposomes, electroporation, microinjection, cell fusion, DEAE-glucan, calcium phosphate precipitation, etc. Commonly used vectors for in vitro gene delivery are retroviral and lentiviral vectors.

[0228] Gene therapy will be performed according to generally accepted methods, such as those described in Friedman et al., 1991, Cell 66:799-806 or Culver, 1996, Bone Marrow Transplant 3:S6-9; Culver, 1996, Mol. Med. Today 2:234-236. In some embodiments, cells from the patient are first analyzed using diagnostic methods known in the art to determine the expression or activity of one or more TRIM proteins. A viral or plasmid vector is prepared containing a copy of a gene or its functional equivalent linked to an expression control element and capable of replicating within the cell. The vector may be capable of replicating within the cell. Alternatively, the vector may be replication-deficient and replicated in helper cells for use in gene therapy. Suitable vectors are known, as disclosed in U.S. Patent No. 5,252,479 and PCT Publication Patent Application WO 93 / 07282, and U.S. Patent Nos. 5,691,198, 5,747,469, 5,436,146, and 5,753,500. The vector is then injected into the patient. If the transfected gene is not permanently introduced into the genome of each target cell, treatment may need to be repeated periodically.

[0229] Gene transfer systems known in the art can be useful in practicing the gene therapy methods of the present invention. These methods include viral and non-viral transfer methods. Some viruses have been used as gene transfer vectors or as the basis for repair gene transfer vectors, including polyvoviruses (e.g., SV40, Madzak et al., 1992, J. Gen. Virol. 73:1533-1536), adenoviruses (Berkner, 1992; Curr. Topics Microbiol. Immunol. 158:39-66), vaccinia virus (Moss, 1992, Current Opin. Biotechnol. 3:518-522; Moss, 1996, PNAS 93:11341-11348), adeno-associated virus (Russell and Hirata, 1998, Mol. Genetics 18:325-330), herpesviruses, including HSV and EBV (Fink et al., 1996, Ann. Rev. Neurosci. 19:265-287), lentiviruses (Naldini et al., ... Retroviruses from various species, including Sindbis and Semliki Forest viruses (Berglund et al., 1993, Biotechnol. 11:916-920), birds (Petropoulos et al., 1992, J. Virol. 66:3391-3397), mice (Miller, 1992, Hum. Gene Ther. 3:619-624), and humans (Shimada et al., 1991; Helseth et al., 1990; Page et al., 1990; Buchschacher and Panganiban, 1992, J. Virol. 66:2731-2739), have been used. Although adenoviruses and adeno-associated viruses are also in use, most gene therapy protocols are based on disabled murine retroviruses.

[0230] Known nonviral gene transfer methods in this art include chemical techniques such as calcium phosphate coprecipitation; mechanical techniques such as microinjection; transfer mediated by membrane fusion via liposomes; and direct DNA uptake and receptor-mediated DNA transfer (Curiel et al., 1992, Am. J. Respir. Cell. Mol. Biol 6:247-252). Virus-mediated gene transfer can be combined with direct in vitro gene transfer using liposome delivery, allowing viral vectors to be directed to tumor cells rather than into surrounding non-dividing cells. Injection of producing cells then provides a continuous source of vector particles. This technique has been approved for use in individuals with inoperable brain tumors.

[0231] In a combined biological and physical gene transfer approach, plasmid DNA of any size is combined with a polylysine-conjugated antibody specific to an adenovirus hexon protein, and the resulting complex is bound to an adenovirus vector. Cells are then infected with the three-molecule complex. The adenovirus vector allows for efficient binding, internalization, and degradation of endosomes before the conjugated DNA is destroyed. For other techniques for delivering adenovirus-based vectors, see U.S. Patent Nos. 5,691,198; 5,747,469; 5,436,146 and 5,753,500.

[0232] Liposome / DNA complexes have been shown to mediate direct in vivo gene transfer. Although gene transfer is nonspecific in standard liposome formulations, local in vivo uptake and expression have been reported in tumor deposits, for example, after direct in situ administration.

[0233] In the context of gene therapy, expression vectors refer to constructs containing sequences sufficient to express polynucleotides cloned therein. In viral expression vectors, the construct contains viral sequences sufficient to support the packaging of the construct. If the polynucleotide encodes a protein, expression will produce said protein. If the polynucleotide encodes an antisense polynucleotide or a ribozyme, expression will produce that antisense polynucleotide or ribozyme. Therefore, in this respect, expression does not require the synthesis of a protein product. In addition to the polynucleotide cloned into the expression vector, the vector also contains a promoter that functions in eukaryotic cells. The cloned polynucleotide sequence is controlled by this promoter. Suitable eukaryotic promoters include those described above. Expression vectors may also include sequences such as optional markers and other sequences as described herein.

[0234] In some embodiments, the method includes the use of gene transfer techniques that directly target isolated nucleic acids to neural tissue. For example, receptor-mediated gene transfer is accomplished via conjugation of a polylysine-containing nucleic acid molecule (typically in the form of a covalently closed supercoiled plasmid) to a protein ligand. The ligand is selected based on the presence of the corresponding ligand receptor on the cell surface of the target cell / tissue type. If desired, these ligand-DNA conjugates can be injected directly into the bloodstream and directed to the target tissue where receptor binding and DNA-protein complex internalization occur. To overcome the problem of intracellular DNA destruction, co-infection with adenoviruses can be included to disrupt endosome function.

[0235] Therefore, the treatment and prevention methods described in this invention cover the use of pharmaceutical compositions comprising the activators or combinations thereof described herein in practicing the methods described in this invention. Pharmaceutical compositions used in practicing this invention can be administered at doses ranging from ng / kg / day to 100 mg / kg / day. In some embodiments, the invention contemplates administration at doses resulting in concentrations of the compounds described in this invention in mammals ranging from 1 μM to 10 μM.

[0236] Typically, the method described in this invention can be applied to mammals, preferably in human doses ranging from 0.5 μg to about 50 mg per kilogram of mammalian body weight, although the exact dose to be administered will vary based on a variety of factors, including but not limited to mammalian species and the type of disease condition to be treated, mammalian age, and route of administration. Preferably, the dose of the compound will vary between about 1 μg and about 10 mg per kilogram of mammalian body weight. More preferably, the dose will vary between about 3 μg and about 1 mg per kilogram of mammalian body weight.

[0237] The compound can be administered to mammals several times a day, or it can be administered less frequently, such as once a day, once a week, once every two weeks, once a month, or even less frequently, such as once every few months, or even once a year or less. The frequency of the dosage will be obvious to a person skilled in the art and will depend on a variety of factors, such as, but not limited to, the type and severity of the disease to be treated, the type and age of the mammal, etc.

[0238] In some embodiments, the invention includes a method comprising applying a combination of activators described herein. In some embodiments, the method has an additive effect, wherein the overall effect of applying the combination of activators is approximately equal to the sum of the effects of applying each individual activator. In other embodiments, the method has a synergistic effect, wherein the overall effect of applying the combination of activators is greater than the sum of the effects of applying each individual activator.

[0239] The method involves applying a combination of activators in any suitable ratio. For example, in some embodiments, the method involves applying two separate activators in a 1:1 ratio. In another embodiment, the method involves applying three separate activators in a 1:1:1 ratio. However, the method is not limited to any particular ratio. Rather, it covers any ratio that has proven effective.

[0240] The nucleic acids disclosed herein can be administered in combination with a carrier or lipid to enhance cellular uptake. For example, the oligonucleotides can be administered in combination with cationic lipids. Examples of cationic lipids include, but are not limited to, lipofectin, DOTMA, DOPE, and DOTAP. The disclosure of WO0071096 describes various formulations, such as DOTAP: a cholesterol or cholesterol derivative formulation, which can be effectively used in gene therapy, and is specifically incorporated herein by reference. Other disclosures also discuss various lipid or liposome formulations, including nanoparticles and methods of administration; these patents include, but are not limited to, U.S. Patent Publications 20030203865, 20020150626, 20030032615, and 20040048787, which are specifically incorporated by reference to the extent that they disclose formulations for the administration and delivery of nucleic acids, and other related aspects. Methods for forming particles are also disclosed in U.S. Patent Nos. 5,844,107, 5,877,302, 6,008,336, 6,077,835, 5,972,901, 6,200,801 and 5,972,900, the aspects of which are incorporated herein by reference.

[0241] Nucleic acids can also be administered in combination with cationic amines, such as poly(L-lysine). Nucleic acids can also be conjugated to chemical moieties, such as transferrin and cholesterol. Furthermore, oligonucleotides can be targeted to specific organelles by attaching specific chemical groups to them.

[0242] Expression vectors can be delivered to a subject's cells for the treatment or prevention of diseases or conditions. Nucleic acid molecules are delivered to the subject's cells in a form in which they can be absorbed and expressed favorably, thereby achieving therapeutically effective levels.

[0243] The methods for delivering nucleic acid molecules to cells according to this disclosure include the use of delivery systems such as liposomes, polymers, microspheres, gene therapy vectors, and naked DNA vectors.

[0244] The term "vector" is used to refer to a vector nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell in which it can replicate. The nucleic acid sequence can be "exogenous," meaning it is foreign to the cell into which the vector will be introduced, or the sequence is homologous to a sequence in the cell but located at a position not typically present in the host cell's nucleic acid. Vectors include plasmids, granules, viruses (bacteriophages, animal viruses, and plant viruses), and artificial chromosomes (e.g., BACs and YACs). Those skilled in the art will be fully capable of constructing vectors using standard recombination techniques described in Sambrook et al., 2012 and Ausubel et al., 2003, both of which are incorporated herein by reference. Transducer viral vectors (e.g., retroviruses, adenoviruses, lentiviruses, and adeno-associated viruses) can be used for somatic cell gene therapy, especially due to their efficient infection and stable integration and expression (see, for example, Cayouette et al., Human Gene Therapy 8:423-430, 1997; Kido et al., Current Eye Research 15:833-844, 1996; Bloomer et al., Journal of Virology 71:6641-6649, 1997; Naldini et al., Science 272:263-267, 1996; and Miyoshi et al., Proc. Natl. Acad. Sci. USA 94:10319, 1997). For example, nucleotide sequences can be cloned into retroviral vectors and expression can be driven by their endogenous promoters, retroviral long terminal repeat sequences, or promoters specific to the target cell type of interest.Other viral vectors that can be used include, for example, vaccinia virus, bovine papillomavirus, or herpesviruses such as E. coli (see also, for example, the vectors of Miller, Human Gene Therapy 15-14, 1990; Friedman, Science 244: 1275-1281, 1989; Eglitis et al., BioTechniques 6:608-614, 1988; Tolstoshev et al., Current Opinion in Biotechnology 1:55-61, 1990; Sharp, The Lancet 337: 1277-1278, 1991; Cornetta et al., Nucleic Acid Research and Molecular Biology 36:311-322, 1987; Anderson, Science 226:401-409, 1984; Moen, Blood Cells). 17:407-416, 1991; Miller et al., Biotechnology 7:980-990, 1989; Le Gal LaSalle et al., Science 259:988-990, 1993; and Johnson, Chest 107:77S-83S, 1995. Retroviral vectors have been developed very well and are used in clinical settings (Rosenberg et al., N. Engl. J. Med 323:370, 1990; Anderson et al., U.S. Patent No. 5,399,346).

[0245] Other suitable methods believed to be used for nucleic acid delivery to achieve expression of the compositions of this disclosure include, in fact, any method that can introduce nucleic acids (e.g., DNA, including viral and non-viral vectors) into organelles, cells, tissues or organisms, as described herein or known to those skilled in the art.

[0246] Gene therapy can be used to administer the nucleic acid or peptide inhibitors of this invention to subjects. Gene therapy is based on inserting therapeutic genes into cells via ex vivo or in vivo techniques. Suitable vectors and methods for gene therapy in vitro or in vivo have been described and are known in the art thereto; see, for example, Giordano, Nature Medicine 2 (1996), 534-539; Schaper, Circ. Res 79 (1996), 911-919; Anderson, Science 256 (1992), 808-813; Isner, Lancet 348 (1996), 370-374; Muhlhauser, Circ. Res 77 (1995), 1077-1086; Wang, Nature Medicine 2 (1996), 714-716; WO94 / 29469; WO97 / 00957 or Schaper, Current Opinion in Biotechnology 7 (1996), 635-640 and the references cited therein. The polynucleotide encoding the polypeptide of the present invention can be designed for direct insertion into cells or insertion via liposomes or viral vectors (e.g., adenovirus or retrovirus vectors). Preferably, the cells are germline cells, embryonic cells, or oocytes or cells derived therefrom; more preferably, the cells are core cells. Suitable gene distribution systems that can be used according to the present invention may include liposomes, receptor-mediated distribution systems, naked DNA, and viral vectors such as herpesviruses, retroviruses, adenoviruses, and adeno-associated viruses. The distribution of nucleic acids for gene therapy to specific sites in vivo can also be achieved using a biolistic distribution system, as described in Williams (Proc. Natl. Acad. Sci. USA, 88 (1991), 2726-2729). Standard methods for transfecting cells with recombinant DNA are well known to those skilled in the art of molecular biology; see, for example, WO94 / 29469; also see the above-mentioned literature. Gene therapy can be performed by directly administering the recombinant DNA molecules or vectors of the present invention to patients, or by transfecting cells in vitro with the polynucleotides or vectors of the present invention and administering the transfected cells to patients.

[0247] Gene transfer can also be achieved using nonviral methods involving in vitro transfection. These methods include the use of calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Liposomes may also be potentially beneficial for delivering DNA into cells. Expression for polynucleotide therapy can be directed by any suitable promoter (e.g., human cytomegalovirus (CMV), simian virus 40 (SV40), or metallothionein promoter) and regulated by any suitable mammalian regulatory element. For example, enhancers known to preferentially direct gene expression in specific cell types can be used to direct nucleic acid expression if desired. The enhancers used can include, without limitation, those identified as tissue- or cell-specific enhancers. For any specific subject, the specific dosage regimen should be adjusted over time according to individual needs and the professional judgment of the person administering or supervising the administration of the composition.

[0248] Pharmaceutical compositions and formulations

[0249] This invention also covers the application of the pharmaceutical compositions of the invention or salts thereof in practicing the methods described herein. Such pharmaceutical compositions may consist of at least one activator composition of the invention or a salt thereof in a form suitable for administration to a subject, or the pharmaceutical composition may comprise at least one activator composition of the invention or a salt thereof and one or more pharmaceutically available carriers, one or more other components, or some combination thereof. The compounds or conjugates of the invention may be present in the pharmaceutical composition in the form of physiologically usable salts, such as in combination with physiologically usable cations or anions, as well as is well known in the art.

[0250] In some embodiments, the pharmaceutical composition used to practice the methods described herein may be administered to deliver a dose of 1 ng / kg / day to 100 mg / kg / day. In another embodiment, the pharmaceutical composition used to practice the invention may be administered to deliver a dose of 1 ng / kg / day to 500 mg / kg / day.

[0251] In the pharmaceutical compositions of the present invention, the relative amounts of the active ingredient, the carrier for the drug, and any other components will vary based on the identity, body type, and condition of the subject being treated, and also based on the route of administration of the composition. For example, the composition may comprise between 0.1% and 100% (w / w) of the active ingredient.

[0252] Pharmaceutical compositions useful in the methods described in this invention can be suitably developed for oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, oral, ocular, or other routes of administration. Compositions useful in the methods described in this invention can be applied directly to the skin, vagina, or any other tissue of a mammal. Other formulations considered include liposomal formulations, re-encapsulated red blood cells containing the active ingredient, and immunologically based formulations. The route of administration will be obvious to those skilled in the art and will depend on a variety of factors, including the type and severity of the disease to be treated, the type and age of the veterinary or human subject to be treated, etc.

[0253] Formulations of the pharmaceutical compositions described herein can be prepared by any method known or subsequently developed in the field of pharmaceutical science. Generally, these methods involve the step of conjugating the active ingredient with a carrier or one or more other auxiliary ingredients, and then, if necessary or desired, shaping or packaging the product into the desired single-dose or multi-dose units.

[0254] As used herein, a “unit dose” is a single (discrete) amount of a pharmaceutical composition containing a predetermined amount of an active ingredient. The amount of the active ingredient is typically equal to the dose of the active ingredient to be administered to a subject, or a convenient fraction of that dose, such as half or one-third of the dose. Unit doses can be used for a single daily dose or for one of multiple daily doses (e.g., about 1 to 4 or more times per day). When multiple daily doses are used, the unit dose form may be the same or different for each dose.

[0255] Although the description of the pharmaceutical compositions provided herein primarily pertains to pharmaceutical compositions suitable for ethical administration to humans, those skilled in the art will understand that these compositions are generally suitable for administration to a wide variety of animals. It is well understood that modifications can be made to pharmaceutical compositions suitable for human administration to make them suitable for administration to a wide range of animals, and that such modifications can be designed and implemented by a conventional veterinary pharmacologist simply through routine experiments, if any. Subjects considering administration of the pharmaceutical compositions described herein include, but are not limited to, humans and other primates and mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, and dogs.

[0256] In some embodiments, the compositions of the present invention are formulated using one or more pharmaceutically available excipients or carriers. In some embodiments, the pharmaceutical compositions of the present invention comprise a therapeutically effective amount of the compound or conjugate of the present invention and a pharmaceutically available carrier. Useful pharmaceutically available carriers include, but are not limited to, glycerol, water, saline, ethanol, and other pharmaceutically available salt solutions such as phosphates and organic acid salts. Examples of these and other pharmaceutically available carriers are described in Remington's Pharmaceutical Sciences (1991, Mack Publication Co., New Jersey).

[0257] The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils. For the dispersion system, appropriate flowability can be maintained, for example, by using a coating such as lecithin, by maintaining the desired particle size, and by using a surfactant. Prevention of microbial activity can be achieved using various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In most cases, the composition will preferably include an isotonic agent, such as sugar, sodium chloride, or polyols such as mannitol and sorbitol. Prolonged absorption of the injectable composition can be achieved by including an absorption-delaying agent in the composition, such as aluminum monostearate or gelatin. In some embodiments, the carrier used for the drug is not DMSO alone.

[0258] These formulations can be mixed with conventional excipients, i.e., organic or inorganic carrier substances known in the art suitable for oral, vaginal, parenteral, nasal, intravenous, subcutaneous, enteral, or any other suitable form of administration. The pharmaceutical formulations can be sterilized and, if desired, mixed with adjuvants, such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure buffers, colorants, flavoring agents, and / or aromatic substances. They can also be mixed with other active agents, such as other analgesic agents, when desired.

[0259] As used herein, “other ingredients” include, but are not limited to, one or more of the following: excipients; surfactants; dispersants; inert diluents; granulators and disintegrants; binders; lubricants; sweeteners; flavorings; colorants; preservatives; physiologically degradable components, such as gelatin; aqueous media and solvents; oily media and solvents; suspending agents; dispersants or wetting agents; emulsifiers; demulcents; buffers; salts; thickeners; fillers; emulsifiers; antioxidants; antibiotics; antifungals; stabilizers; and pharmaceutically usable polymers or hydrophobic materials. Other “other ingredients” that may be included in the pharmaceutical compositions of the present invention are known in the art and described, for example, in Genaro, ed. (1985, Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA), which is incorporated herein by reference.

[0260] The compositions of this invention may contain about 0.005% to 2.0% by weight of a preservative. In the event of exposure to environmental contaminants, the preservative serves to prevent spoilage. Examples of preservatives useful according to the invention include, but are not limited to, those selected from benzyl alcohol, sorbic acid, parabens, imidulazilide ureas, and combinations thereof. A particularly preferred preservative is a combination of about 0.5% to 2.0% benzyl alcohol and 0.05% to 0.5% sorbic acid.

[0261] The composition preferably includes an antioxidant and a chelating agent to inhibit the degradation of the compound. For some compounds, preferred antioxidants are BHT, BHA, α-tocopherol, and ascorbic acid in a preferred range of about 0.01% to 0.3%, and more preferably, BHT in a range of 0.03% to 0.1% by weight of the total weight of the composition. Preferably, the chelating agent is present in an amount of 0.01% to 0.5% by weight of the total weight of the composition. Particularly preferred chelating agents include ethylenediaminetetraacetate (e.g., disodium ethylenediaminetetraacetate) and citric acid in a range of about 0.01% to 0.20% by weight of the total weight of the composition, and more preferably, in a range of 0.02% to 0.10% by weight. The chelating agent is useful for chelating metal ions in the composition that may be detrimental to the shelf life of the formulation. Although BHT and disodium EDTA are particularly preferred antioxidants and chelators for some compounds, other suitable and equivalent antioxidants and chelators can therefore be substituted, as will be known to those skilled in the art.

[0262] Liquid suspensions can be prepared using conventional methods to achieve suspensions of active ingredients in aqueous or oily media. Aqueous media include, for example, water and isotonic saline. Oily media include, for example, almond oil, oily esters, ethanol, vegetable oils such as peanut oil, olive oil, sesame oil, or coconut oil, fractionated vegetable oils, and mineral oils such as liquid paraffin. Liquid suspensions may also contain one or more other components, including but not limited to suspending agents, dispersants or wetting agents, emulsifiers, analgesics, preservatives, buffers, salts, flavoring agents, coloring agents, and sweeteners. Oily suspensions may also contain thickeners. Known suspending agents include, but are not limited to, sorbitol syrup, hydrogenated edible lipids, sodium alginate, polyvinylpyrrolidone, astragalus gum, gum arabic, and cellulose derivatives such as sodium carboxymethyl cellulose, methylcellulose, and hydroxypropyl methylcellulose. Known dispersants or wetting agents include, but are not limited to, naturally occurring phospholipids such as lecithin, condensation products of alkyl esters with fatty acids, with long-chain fatty alcohols, with esters derived from fatty acids and hexitols, or with esters derived from fatty acids and hexitol anhydrides (e.g., polyethylene oxide stearate, heptadecaethyleneoxycetanol, polyethylene oxide monooleate sorbitol, and polyethylene oxide monooleate dehydrated sorbitol, respectively). Known emulsifiers include, but are not limited to, lecithin and gum arabic. Known preservatives include, but are not limited to, methylparaben, ethylparaben, or n-propylparaben, ascorbic acid, and sorbic acid. Known sweeteners include, for example, glycerin, propylene glycol, sorbitol, sucrose, and saccharin. Known thickeners for oily suspensions include, for example, beeswax, solid paraffin (hard paraffin), and cetyl alcohol.

[0263] Liquid solutions of the active ingredient can be prepared in aqueous or oily solvents in essentially the same manner as liquid suspensions, the main difference being that the active ingredient is dissolved rather than suspended in the solvent. As used herein, an "oily" liquid is a liquid containing carbon-containing liquid molecules and exhibiting polarity less than that of water. Liquid solutions of the pharmaceutical compositions of the present invention may contain each of the components described for liquid suspensions, and it should be understood that suspending agents will not necessarily assist in the dissolution of the active ingredient in the solvent. Aqueous solvents include, for example, water and isotonic saline. Oily solvents include, for example, almond oil, oily esters, ethanol, vegetable oils such as peanut oil, olive oil, sesame oil, or coconut oil, fractionated vegetable oils, and mineral oils such as liquid paraffin.

[0264] Powder and granule formulations of the pharmaceutical preparations of the present invention can be prepared using known methods. These formulations can be administered directly to a subject, used for example to form tablets, fill capsules, or to prepare aqueous or oily suspensions or solutions by adding an aqueous or oily medium thereto. Each of these formulations may also contain one or more dispersants or wetting agents, suspending agents, and preservatives. Other excipients, such as fillers, sweeteners, flavoring agents, or coloring agents, may also be included in these formulations.

[0265] The pharmaceutical compositions of the present invention can also be prepared, packaged, or sold in the form of oil-in-water emulsions or water-in-oil emulsions. The oil phase can be a vegetable oil, such as olive oil or peanut oil, a mineral oil, such as liquid paraffin, or a combination thereof. These compositions may also contain one or more emulsifiers, such as naturally occurring gums, such as gum arabic or tragacanth, naturally occurring phospholipids, such as soybean or lecithin phospholipids, esters or metaesters derived from combinations of fatty acids and hexyl anhydrides, such as sorbitan monooleate, and condensation products of these metaesters with ethylene oxide, such as polyethylene oxide sorbitan monooleate. These emulsions may also contain other ingredients, including, for example, sweeteners or flavoring agents.

[0266] Methods for impregnating or coating materials with chemical compositions are known in the art and include, but are not limited to, methods for depositing or incorporating chemical compositions onto a surface, methods for incorporating chemical compositions into the material structure during material synthesis (i.e., using physiologically degradable materials), and methods for absorbing aqueous or oily solutions or suspensions into absorbent materials with or without subsequent drying.

[0267] The administration regimen can affect the composition of the effective dose. The therapeutic agent can be administered to the subject before or after disease diagnosis. Furthermore, several fractionated doses can be administered daily or sequentially, as well as alternating doses, or the dose can be administered continuously by infusion or bolus injection. Additionally, the dose of the therapeutic agent can be increased or decreased proportionally as indicated by the urgency of the treatment or prevention situation.

[0268] The compositions of the present invention can be administered to subjects, preferably mammals, more preferably humans, using known procedures at doses and durations effective for the prevention or treatment of disease. The effective amount of the therapeutic compound necessary to achieve a therapeutic effect can be varied by factors such as the activity of the specific compound used; the time of administration; the rate of excretion of the compound; the duration of treatment; other drugs, compounds, or materials used in combination with the compound; the state of the disease or condition of the subject to be treated; age, sex, weight, condition, general health status, and prior medical history; and similar factors well known in the medical field. Dosing regimens can be adjusted to provide an optimal therapeutic response. For example, several fractional doses can be administered daily, or the dose can be proportionally reduced as indicated by the urgency of the treatment situation. A non-limiting example of the effective dose range of the therapeutic compounds of the present invention is about 1 to 5,000 mg / kg body weight / day. Those skilled in the art will be able to investigate the relevant factors and determine the effective amount of the therapeutic compound without excessive experimentation.

[0269] The compound may be administered to the subject several times a day, or it may be administered less frequently, such as once daily, once weekly, once every two weeks, once monthly, or even less frequently, such as once every few months, or even once a year or less. It should be understood that, in non-limiting instances, the amount of the compound administered at the daily dose may be administered daily, every other day, every two days, every three days, every four days, or every five days. For example, by administering every other day, a 5 mg daily dose may be started on Monday, with the first subsequent 5 mg daily dose administered on Wednesday, the second subsequent 5 mg daily dose administered on Friday, and so on. The frequency of the doses will be apparent to a person skilled in the art and will depend on a variety of factors, such as, but not limited to, the type and severity of the disease to be treated, the species and age of the animal, etc.

[0270] The actual dose level of the active ingredient in the pharmaceutical composition of the present invention can be changed to obtain an amount of active ingredient that is effective for achieving the desired therapeutic response in a particular subject, composition, and form of administration, while being non-toxic to the subject.

[0271] A physician or veterinarian with conventional skills in the art can readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, a physician or veterinarian can start with a dose of the compound of the invention used in the pharmaceutical composition at a level less than required to achieve the desired therapeutic effect, and gradually increase the dose until the desired effect is achieved.

[0272] In specific embodiments, it is particularly advantageous to formulate the compound in dosage units to facilitate dosage administration and uniformity. As used herein, dosage unit form refers to a physically dispersed (discrete) unit suitable as a unit dose for a subject to be treated; each unit contains a predetermined amount of therapeutic compound calculated to produce the desired therapeutic effect in conjunction with the desired pharmaceutical medium. The dosage unit form of the present invention is determined by and directly based on (a) the unique characteristics of the therapeutic compound and the specific therapeutic effect to be achieved, and (b) the inherent limitations in the art of mixing / formulating such therapeutic compounds for the treatment of a subject's disease.

[0273] In some embodiments, the compositions of the present invention are administered to subjects at doses ranging from 1 to 5 times or more per day. In another embodiment, the compositions of the present invention are administered to subjects at dose ranges including, but not limited to, once daily, once every two days, once every three days, once weekly, and once every two weeks. It will be apparent to those skilled in the art that the frequency of administration of the various combinations of the compositions of the present invention will vary among subjects based on a variety of factors, including but not limited to age, the disease or condition to be treated, sex, overall health status, and other factors. Therefore, the present invention should not be considered as limited to any specific dosage regimen, and the exact dose and composition to be administered to any subject will be determined by the attending physician, taking into account all other factors relevant to the subject.

[0274] The compounds of the present invention used for application can be in the following ranges: about 1 mg to about 10,000 mg, about 20 mg to about 9,500 mg, about 40 mg to about 9,000 mg, about 75 mg to about 8,500 mg, about 150 mg to about 7,500 mg, about 200 mg to about 7,000 mg, about 3050 mg to about 6,000 mg, about 500 mg to about 5,000 mg, about 750 mg to about 4,000 mg, about 1 mg to about 3000 mg. ,000 mg, about 10 mg to about 2,500 mg, about 20 mg to about 2,000 mg, about 25 mg to about 1,500 mg, about 50 mg to about 1,000 mg, about 75 mg to about 900 mg, about 100 mg to about 800 mg, about 250 mg to about 750 mg, about 300 mg to about 600 mg, about 400 mg to about 500 mg, and any and all of the whole or part of the following increases (increments).

[0275] In some embodiments, the dosage of the compound of the present invention is from about 1 mg to about 2,500 mg. In some embodiments, the dosage of the compound of the present invention used in the compositions described herein is less than about 10,000 mg, or less than about 8,000 mg, or less than about 6,000 mg, or less than about 5,000 mg, or less than about 3,000 mg, or less than about 2,000 mg, or less than about 1,000 mg, or less than about 500 mg, or less than about 200 mg, or less than about 50 mg. Similarly, in some embodiments, the dosage of the second compound (i.e., a medicament for treating the same disease as that treated by the composition described herein or for another disease) is less than about 1,000 mg, or less than about 800 mg, or less than about 600 mg, or less than about 500 mg, or less than about 400 mg, or less than about 300 mg, or less than about 200 mg, or less than about 100 mg, or less than about 50 mg, or less than about 40 mg, or less than about 30 mg, or less than about 25 mg, or less than about 20 mg, or less than about 15 mg, or less than about 10 mg, or less than about 5 mg, or less than about 2 mg, or less than about 1 mg, or less than about 0.5 mg, and any and all of these dosages, in whole or in part, are increased.

[0276] In some embodiments, the present invention relates to packaged pharmaceutical compositions comprising a container holding a therapeutically effective amount of the compound or conjugate of the present invention, alone or in combination with a second pharmaceutical agent; and instructions for use of said compound or conjugate to treat, prevent or reduce one or more symptoms of a disease in a subject.

[0277] The term "container" includes any receptacle used to contain the pharmaceutical composition. For example, in some embodiments, the container is packaging containing the pharmaceutical composition. In other embodiments, the container is not packaging containing the pharmaceutical composition; that is, the container is a container, such as a box or vial containing a packaged or unpackaged pharmaceutical composition and instructions for use of the pharmaceutical composition. Furthermore, packaging techniques are well known in the art. It should be understood that instructions for use of the pharmaceutical composition may be included on packaging containing the pharmaceutical composition, and thereby establish an enhanced functional relationship between the instructions and the packaged product. However, it should be understood that the instructions may contain information regarding the ability of the compound to perform its intended function (e.g., to treat or prevent a disease in a subject or to deliver an imaging or diagnostic agent to a subject).

[0278] The routes of administration for any of the compositions described in this invention include oral, nasal, rectal, parenteral, sublingual, transdermal, transmucosal (e.g., sublingual, lingual, buccal, urethral, ​​vaginal (e.g., vaginal and perivallary), nasal (internal) and (transrectal), intravesical, intrapulmonary, intracerebral, epidural, intraventricular, intraduodenal, intragastric, intrathecal, subcutaneous, intramuscular, intradermal, intraarterial, intravenous, intrabronchial, inhalation, and topical application. In some embodiments, the composition may be administered to the cerebrospinal fluid of a subject.

[0279] Suitable compositions and dosage forms include, for example, tablets, capsules, caplets, pills, gel caps, lozenges, dispersants, suspensions, solutions, syrups, granules, beads, transdermal patches, gels, powders, granules (pills), pastes (emulsions), sugar lozenges, creams, pastes, plasters, lotions, discs, suppositories, liquid sprays for nasal or oral administration, dry powder or nebulized formulations for inhalation, and compositions and formulations for intravesical administration. It should be understood that the formulations and compositions useful in this invention are not limited to the specific formulations and compositions described herein.

[0280] Diagnostic methods

[0281] This invention provides a method for diagnosing a subject suffering from a disease or condition related to protein misfolding or protein aggregates, or at risk of developing said disease or condition. For example, in some embodiments, the method includes using the expression or activity level of one or more TRIM proteins as a diagnostic biomarker. In some embodiments, the method includes detecting the presence of gene mutations in nucleic acids encoding one or more TRIM proteins.

[0282] In some embodiments, the method is used to diagnose a subject as having a disease or condition related to protein misfolding or protein aggregates. In some embodiments, the method is used to diagnose a subject as being at risk of developing a disease or condition related to protein misfolding or protein aggregates.

[0283] In some embodiments, the method is used to evaluate the effectiveness of a therapy for neurodegenerative diseases or conditions associated with protein misfolding or protein aggregates.

[0284] In some embodiments, the method includes collecting biological samples from a subject. Exemplary samples include, but are not limited to, blood, urine, feces, sweat, bile, serum, plasma, and tissue biopsies. For example, in some embodiments, the sample includes at least one cell from neural tissue. In some embodiments, the sample includes neurons, astrocytes, oligodendrocytes, Purkinje cells, pyramidal cells, etc.

[0285] Methods for detecting reduced expression or activity of one or more TRIM proteins include any method for studying genes or their products at the nucleic acid or protein level. These methods are well known in the art and include, but are not limited to, nucleic acid hybridization techniques, nucleic acid reverse transcription and nucleic acid amplification methods, Western blotting, RNA blotting, DNA blotting, ELISA, immunoprecipitation, immunofluorescence, flow cytometry, and immunocytochemistry. In a particular embodiment, antibodies, such as those against specific proteins, are used to detect disrupted gene transcription at the protein level. These antibodies can be used with a variety of methods, such as Western blotting, ELISA, immunoprecipitation, flow cytometry, or immunocytochemistry.

[0286] Methods for producing recombinant proteins

[0287] In some embodiments, the present invention provides a method for using one or more TRIM proteins in the production of the recombinant protein of interest. It is acknowledged in the art that recombinant proteins can spontaneously misfold and aggregate, thereby reducing their functionality and usability. Therefore, one or more TRIM proteins can be used to depolymerize protein aggregates of the recombinant protein of interest, thereby allowing the production and collection of the functional recombinant protein of interest. In some embodiments, one or more TRIM proteins are selected from one or more of the following: human TRIM1, TRIM2, TRIM3, TRIM4, TRIM5, TRIM6, TRIM7, TRIM8, TRIM9, TRIM10, TRIM11, TRIM13, TRIM14, TRIM15, TRIM16, TRIM17, TRIM18, TRIM19, TRIM20, TRIM21, TRIM22, TRIM23, TRIM24, TRIM25, TRIM26, TRIM27, TRIM28, TRIM29, TRIM30, TRIM31, TRIM32, TRIM33, TRIM34, TRIM35, TRIM36, and TRIM37. TRIM38, TRIM39, TRIM40, TRIM41, TRIM42, TRIM43, TRIM44, TRIM45, TRIM46, TRIM47, TRIM48, TRIM49, TRIM50, TRIM51, TRIM52, TRIM54, TRIM55, TRIM56, TRIM58, TRIM59, TRIM60, TRIM61, TRIM62, TRIM63, TRIM64, TRIM65, TRIM66, TRIM67, TRIM68, TRIM69, TRIM70, TRIM71, TRIM72, TRIM73, TRIM74, TRIM76 and TRIM77; and mouse TRIM12 and TRIM30. In some embodiments, one or more TRIM proteins are selected from one or more of the following: human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM21, TRIM24, TRIM26, TRIM29, TRIM31, TRIM34, TRIM36, TRIM37, TRIM46, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69 and TRIM70; and mouse TRIM12 and TRIM30.In some embodiments, one or more TRIM proteins are selected from one or more of the following: human TRIM10, TRIM11, TRIM24, TRIM36, TRIM37, TRIM40, TRIM49, TRIM55, TRIM58, and TRIM68. In some embodiments, one or more TRIM proteins are selected from one or more of the following: human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM12, TRIM17, TRIM18, TRIM19, TRIM21, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, and TRIM70. In some embodiments, one or more TRIM proteins are selected from one or more of the following: human TRIM10, TRIM11, and TRIM55. In some embodiments, one or more TRIM proteins are selected from one or more of the following: human TRIM2, TRIM3, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM26, TRIM29, TRIM30, TRIM31, TRIM36, TRIM41, TRIM42, TRIM43, TRIM46, TRIM49, TRIM55, TRIM56, TRIM63, TRIM64, TRIM68, TRIM69, TRIM70, TRIM71, and TRIM73. In some embodiments, one or more TRIM proteins are selected from one or more of the following: human TRIM10, TRIM11, TRIM36, TRIM55, and TRIM68. In some embodiments, one or more TRIM proteins are selected from one or more of the following: human TRIM10, TRIM11, TRIM24, TRIM36, and TRIM58. In some embodiments, one or more TRIM proteins are selected from one or more of the following: TRIM10, TRIM11, TRIM17, TRIM36, TRIM37, TRIM40, TRIM49, and TRIM55. In some embodiments, the TRIM protein is human TRIM10. In some embodiments, the TRIM protein is human TRIM11.

[0288] In some embodiments, the present invention provides a method for increasing the yield of a recombinant protein of interest using one or more TRIM proteins disclosed herein. It is recognized in the art that when overexpressed in cell-based expression systems, proteins can misfold and aggregate at high concentrations, leading to premature cell death. Therefore, proteins that can prevent or resolve protein misfolding, such as the TRIM proteins disclosed herein, can be used to prevent misfolding and cell death while allowing for increased yields of functional recombinant proteins.

[0289] In some embodiments, the method includes administering to cells one or more TRIM proteins, nucleic acid molecules encoding one or more TRIM proteins, or combinations thereof. In some embodiments, cells are modified to express the recombinant protein of interest. The cells may belong to any expression system, including but not limited to yeast expression systems, bacterial expression systems, insect expression systems, or mammalian expression systems.

[0290] Cell maintenance methods

[0291] In some embodiments, the present invention includes a cell maintenance method for use in cell therapy. It has been recognized that cells used in cell therapy, such as cells engineered to overexpress therapeutic proteins, can suffer from protein misfolding and aggregation, leading to premature cell death. Therefore, the TRIM proteins of this disclosure can be used to prevent or resolve protein misfolding and aggregation to maintain cell health and are available for use. In some embodiments, the method includes administering one or more TRIM proteins, nucleic acid molecules encoding one or more TRIM proteins, or combinations thereof, to the cells.

[0292] Experimental Examples

[0293] The invention has been described in further detail with reference to the following experimental embodiments. These embodiments are provided for illustrative purposes only, unless otherwise stated, and are not intended to be limiting. Therefore, the invention should not in any way be construed as limited to the following embodiments, but should be considered to cover any and all changes that become apparent as a result of the teachings provided herein.

[0294] Without further description, it is believed that those skilled in the art can prepare and use the methods claimed in this invention and practice using the above description and the following illustrative examples. Therefore, the following working examples should not be considered in any way as limiting the remainder of the disclosure of this invention.

[0295] Example 1: TRIM11 protects against tau protein diseases and is downregulated in Alzheimer's disease.

[0296] Intracellular neurofibrillary tangles (NFTs) composed of hyperphosphorylated tau are a common pathological marker of more than twenty heterogeneous dementias and motor disorders (collectively known as tau protein diseases) (VM Lee, M. Goedert, JQ Trojanowski, Annu Rev Neurosci 24, 1121-1159 (2001); MG Spillantini, M. Goedert, Lancet Neurol 12, 609-622 (2013); J. Gotz, G. Halliday, RM Nisbet, Annu Rev Pathol 14, 239-261 (2019)). Among these, frontotemporal degeneration with tau pathology (FTLD-tau)—which includes various diseases such as progressive supranuclear palsy (PSP), corticobasal degeneration, and Picker's disease (PiD)—is a primary tau protein disease that does not show other major pathological abnormalities. Alzheimer's disease (AD), the most common cause of dementia, is a secondary tau proteinopathy characterized by the presence of extracellular amyloid-β (Aβ) plaques (CL Masters et al., Nat Rev Dis Primers 1, 15056 (2015); DS Knopman et al., Nat Rev Dis Primers 7, 33 (2021)). In familial subtypes of primary tau proteinopathy, the tau-encoding gene... MAPTMutations have occurred (M. Hutton et al., Nature 393, 702-705 (1998); MG Spillantini et al., Proc NatlAcad Sci USA 95, 7737-7741 (1998); C. Dumanchin et al., Hum Mol Genet 7, 1825-1829 (1998)). In primary tau proteinopathy and AD, NFT burden is associated with cognitive decline and neurodegeneration (PV Arriagada, JH Growdon, ET Hedley-Whyte, BT Hyman, Neurology 42, 631-639 (1992); H. Ling et al., Neuropathol Appl Neurobiol 40, 149-163 (2014); N. Kouri et al., Brain 134, 3264-3275 (2011)). Furthermore, Aβ-induced neurotoxicity requires tau (ED. Roberson et al., Science 316, 750-754 (2007)). Therefore, misfolding and aggregation of tau protein may be a major pathogenic factor (event) in AD and other tau protein disorders.

[0297] To maintain proteins in their functionally soluble form, all organisms in the biological world have evolved protein quality control (PQC) systems (WE Balch, RI Morimoto, A. Dillin, JW Kelly, Science 319, 916-919 (2008); S. Wolff, JS Weissman, A. Dillin, Cell 157, 52-64 (2014); D. Balchin, M. Hayer-Hartl, FU Hartl, Science 353, aac4354). (2016). These systems include degradation pathways that recover defective proteins and excess normal proteins, molecular chaperones that prevent protein misfolding and aggregation, and depolymerases that dissolve pre-existing protein deposits. In tau proteinopathy, tau protein transforms from soluble monomers into fibrillary aggregates in an age-dependent manner, suggesting a weakening ability of the PQC system, which normally protects against tau protein aggregation. Nevertheless, the identity and nature of this PQC system remain undetermined. This lack of knowledge hinders the development of effective therapies.

[0298] Triple motif (TRIM) proteins are defined by the TRIM / RBCC region, which consists of a RING domain, one or two B boxes, and a coiled-coil motif. Figure 9 These proteins are found only in metazoans, and their numbers have increased rapidly during evolution, including more than 70 members in humans (S. Hatakeyama, Nat RevCancer 11, 792-804 (2011); K. Ozato, DM Shin, TH Chang, HC Morse, 3rd, Nat Rev Immunol 8, 849-860 (2008)). Emerging evidence suggests that some TRIM proteins can participate in multiple aspects of PQC (L. Guo et al., Mol Cell 55, 15–30 (2014); L. Chen et al., Cell Rep 18, 3143–3154 (2017); L. Chen, G. Zhu, EM Johns, X. Yang, Nat Commun 9, 1223 (2018); G. Zhu et al., Cell Rep 33, 108418 (2020)), although other TRIMs can exacerbate protein aggregation (MW Rousseaux et al., Elife 5, (2016)). Furthermore, TRIM21 (a cytoplasmic antibody receptor) mediates the degradation of antibody-coated viruses that happen to enter the cytoplasm or of endogenous proteins that deliver specific antibodies to the cells (DLMallery et al., Antibodies mediate intracellular immunity through tripartitemotif-containing 21 (TRIM21). Proc Natl Acad Sci USA 107, 19985-19990 (2010); A. Kondo et al., Nature 523, 431-436 (2015); D. Clift et al., Cell 171, 1692-1706 e1618 (2017); WA McEwan et al., Proc Natl Acad Sci USA 114, 574-579 (2017)). In this paper, we investigated the role of the TRIM system in the pathogenesis of tau protein diseases, its mechanism of action, and its efficacy in disease treatment.

[0299] The materials and methods used in the experiment are described below.

[0300] Antibody

[0301] Purchase antibodies against the following proteins or epitopes from the designated sources: TRIM10 (pAb, Abcam, Cat#ab151306), TRIM11 (pAb, Millipore, Cat# ABC926; pAb, Abcam, Cat# ab111694), TRIM55 (MURF2) (mAb, Abnova, Cat# H00084675-M02), GFP (mAb, Santa Cruz, Cat# sc-9996; pAb, GeneTex, Cat# GTX113617), HA (mAb, C29F4, Cell Signaling, Cat# 3724), GAPDH (Santa Cruz, Cat# sc-32233), β-actin (Sigma-Aldrich, Cat# A5441), FLAG (mAb, Cell signaling, Cat# 14793);mAb, M2, Sigma-Aldrich, Cat# F1804), Hsp90 (Cell Signaling, Cat# 4874), tau phosphate (Ser202 / Thr205) (mAb AT8, Thermo Fisher Scientific, Cat# MN1020), tau phosphate (Thr231) (mAb AT180, Thermo Fisher Scientific, Cat# MN1040), tau phosphate (Ser262) (pAb, Invitrogen, Cat# OPA1-03142), tau phosphate (Ser396) (pAb, Thermo Fisher Scientific, Cat# 44-752G), tau (mAb tau5, Thermo Fisher Scientific, Cat# AHB0042), tau (pAb T22, Millipore, Cat# ABN454), p62 (SQSTM1) (pAb, MBL, Cat# PM045), 6xHis (pAb, Cell Signaling, Cat# 2365), mCherry (mAb, Santa Cruz, Cat# sc-390909), c-Myc (pAb, Santa Cruz, Cat# sc-40), LC3B (D11, XP, mAb, Cell Signaling, Cat# 3868), SUMO2 / 3 (pAb, Abcetpa, Cat# AP1224a), and FLAG M2 agarose beads (Sigma-Aldrich, Cat# A1205). PSD95 (mAb, Cell Signaling, Cat# 36233S). PSD95 (mAb, Cell Signaling, Cat# 3409S). Synaptophysin (mAb, Cell Signaling, Cat# 36406S). NeuN (mAb, Millipore, Cat# MAB377). MAP2 (pAb, Origene Technologies, Cat# TA309162). Antiphospho-tau mAb PHF-1 (Ser396 / Ser404) and MC1 were kindly provided by Dr. Peter Davies.

[0302] reagents

[0303] Mg 2+-ATP (Cat# A9187), FLAG peptide (Cat# F3290), ammonium chloride (Cat# 09718), Benzonase (Cat# E1014), isopropyl-1-thio-D-galactopyranoside (IPTG) (Cat# I6758), complete protease inhibitor mixture (Cat# 11697498001), reduced L-glutathione (Cat# G4251), actinomycin (Cat# 66819), thiosulfate T (Cat# T3516), imidazole (Cat# I5513), heparin (Cat# H3393), human Aβ42 peptide, Duolink® In SituRed starter kit (Cat# DUO92101), and polybrene (Cat# TR-1003) were purchased from Sigma-Aldrich. Glutathione Superflow Agarose (Cat# 25236), large-capacity cDNA reverse transcription kit (Cat# 4368814), puromycin dihydrochloride (Cat# A1113803), Lipofectamine 2000 (Cat# 6031), Lipofectamine RNAiMAX (Cat# 13778150), SYBR GreenMaster Mix (Cat# A25742), and SuperSignal™ Western Blot Substrate Bundle (Cat# A45916) were purchased from Thermo Fisher Scientific. SUMO E1 (Cat# E-315), SUMO E2 (UbcH9) (Cat# E2-465), and 6xHis-SUMO2 (Cat# UL-75) were purchased from Boston Biochem.Ni-NTA agarose (Cat# 30230) was purchased from QIAGEN; TRIzol reagent (Cat# 15596) and Hochst 33342 (Cat# H3570) were from Invitrogen; 4',6-diamidinyl-2-phenylindole (DAPI) (Cat# H-1200) was from Vector Laboratories; MG132 (Cat# S2619) was from Selleck Chemicals; polyethyleneimine (PEI, Polyethylenimine) (linear, MW 25000, Cat# 23966-1) was from Polysciences; Phosphatase inhibitor PhosSTOP™ (Cat# 04906845001) was from Roche; DPX sealing agent (Cat# 13510) was from Electron Microscopy Science; and Bradford Protein Assay Kit (Cat# 13510) was also available. 5000205) is from Bio-Rad Labs and ABC (Avidin-Biotin Complex) Kit (Cat# PK6100) is from Vector Laboratories.

[0304] plasmid

[0305] To enable expression in mammalian cells, cDNAs of 75 TRIMs were synthesized, including 73 human TRIMs and mouse TRIM12 and TRIM30 (Table 1), and cloned into pCDH-EF1-FHC (Addgene, #64874), where each TRIM was fused to a FLAG tag and a HA tag at the C-terminus (Gene Universal, Newark, DE). Flag-tau and Flag-tau P301L were cloned into pcDNA3.1. tau-VN173 and TRIM11-VN173 were cloned into pBiFC-VN173 (Addgene plasmid #22010), and tau-VC155 and TRIM11-VC155 were cloned into pBiFC-VC155 (AddGene plasmid #22011) (a gift from Dr. Chang-Deng Hu). Tau-GFP, tau P301L-GFP, and tau AT8 (S199E, S202E, T205E)-GFP were prepared in pEGFP-N1 by fusing EGFP to the C-terminus of the tau protein. pRK5-EGFP-tau and pRK5-EGFP-tau P301L were donated by Dr. Karen Ashe (AddGene plasmids #46904 and #46908, respectively), in which EGFP was fused to the N-terminus of the tau protein. GFP-TRIM11 (in pEGFP-C1), Flag-TRIM11, and Flag-TRIM11 were also prepared. 2EA (in pcDNA3.1) (G. Zhu et al., Cell Rep 33, 108418 (2020)), mCherry and mCherry-TRIM11 (in pTRPE) (L. Chen et al., Cell Rep 18, 3143–3154 (2017)), as previously described.

[0306] To express these compounds in bacteria, GST-tau, GST-tau P301L, and GST-tau AT8 were prepared in pGEX-1ZT, a derivative of pGEX-1λT with additional cloning sites. GFP-tau and GFP-tau P301L were cloned into pET-28(+). GST-TRIM11 was cloned into pGEX-1ZT (Zhu, G. et al., 2020, Cell Reports, 33:108418).

[0307] siRNA, sgRNA and antisense oligomers

[0308] The siRNAs targeting mouse TRIM10 (Cat# sc-76733), mouse TRIM11 (Cat# sc-76735), mouse TRIM36 (Cat# sc-154647), mouse TRIM55 (Cat# sc-149718), and human TRIM11 (Cat# sc-76734) were purchased from Santa Cruz. The negative control siRNA, 5'-GGUUAAUCGCGUAUAAUACGCGUAU-3' (SEQ ID NO:1), was prepared by IDT.

[0309] The sgRNAs targeting human TRIM10, TRIM11, TRIM26, TRIM36, and TRIM55 were synthesized by Integrated DNA Technologies (Coralville, IA, USA). The target sequences are: TRIM10, 5'-GGCAGTTGACTTCATCTGCC-3' (SEQ ID NO:2); TRIM11, 5'-GAGCCAGCGGCAGAACGTGC-3' (SEQ ID NO:3); TRIM26, 5'-GCCGCTCAATGTTCTCCACC-3' (SEQ ID NO:4); TRIM36, 5'-TACCATTAAGAATATCGAAA-3' (SEQ ID NO:5); TRIM55: 5'-AACCCGTATTTGCCCACAAG (SEQ ID NO:6).

[0310] The antisense oligomers (ASOs) used in this study were designed and synthesized by AUM LifeTech (Philadelphia, PA, USA). The sequences are: TRIM11-1, 5'-ATAAACAGCAGCGACCCATCC-3' (SEQ ID NO:7); TRIM11-2, 5'-ACTTAGTGCTTTGGTGAGAGC-3' (SEQ ID NO:8); TRIM11-3, 5'-ACTGTAGAATGAGAGATGGCC-3' (SEQ ID NO:9); TRIM11-4, 5'-TAGAATGAGAGATGGCCAGCT-3' (SEQ ID NO:10); TRIM11-5, 5'-ATTTGTTTCCGTAGGTGCTCC-3' (SEQ ID NO:11); scrambled control (SCR CTRL), 5'-CCTTCCCTGAAGGTTCCTCC-3' (SEQ ID NO:12). SCR CTRL-Far Red was tagged with a far-infrared fluorescent dye with a maximum excitation wavelength of 646 nm and a maximum emission wavelength of 669 nm (+ / -5).

[0311] Cell culture

[0312] HEK293T and N2A cells were purchased from ATCC, and SH-SY5Y cells were purchased from Sigma. HEK293 cells-YFP expressing RD (LM) were generated according to the published protocol (DWSanders et al., Neuron 82, 1271-1288 (2014)). These cells expressed tau repeat domains (RD; full-length tau 4R2N isoforms aa 244 to 372) with pro-aggregation mutants P301L and V337M. QBI293 / tau P301L-GFP cells were generated as previously described (JL Guo et al., JBiol Chem 291, 13175-13193 (2016)). HEK293T, HEK293 / RD(LM)-YFP, and QBI293 / tauP301L-GFP cells were cultured in DMEM medium, SH-SY5Y cells were cultured in DMEM / F12 (1:1), and N2A cells were cultured in EMEM medium. All media contained penicillin / streptomycin and 10% FBS. Cells were maintained at 37°C in a humidified incubator containing 5% CO2.

[0313] Primary neurons were prepared from the hippocampus or cerebral cortex of wild-type or PS19 mouse pups (P1). The tissues were removed and placed in ice-cold Hank's balanced salt solution containing 10 mM HEPES. The cells were cut into strips and digested with papain (1 mg / mL) at 37°C for 30 min. Digestion was terminated by adding DMEM containing 10% heat-inactivated fetal bovine serum. After grinding, the cells were harvested by centrifugation at 1,000 × g and resuspended in basal neuronal medium containing 2% B27, 1% penicillin / streptomycin, and 2 mM GlutaMAX.

[0314] TRIM knockout (KO) cells

[0315] To knock out TRIM10, TRIM11, TRIM26, TRIM36, or TRIM55 in HEK293T cells, the control plentiCRISPRv2 vector or plentiCRISPRv2 encoding TRIM10, TRIM11, TRIM26, TRIM36, or TRIM55 sgRNA was co-transfected with PEI at a ratio of 4:1:3. The culture medium was replaced 12 h later. Viral particles were collected 60 h post-transfection, centrifuged at 1,200 rpm for 5 min, filtered through a 0.45 μm sterile filter (Millipore), and passed through a Lenti-X filter. TM The concentrate was carried out overnight at 4°C at a 3:1 ratio using a concentrator (Takara Bio, Cat# 631312), followed by concentration at 4500× at 4°C. g Centrifuge for 1 hour. Then, infect HEK293T cells with concentrated virus particles in medium containing 8 μg / ml polybrene. Select lentivirus-transduced cells with 2 μg / ml puromycin for 7 days.

[0316] mice

[0317] Tau P301S (PS19) or B6;C3-Tg (Prnp-MAPT) P301S) PS19Vle / J) heterozygous female breeding mice (breed #: 008169) and 3×Tg-AD or B6;129-Tg (APPSwe,tauP301L) 1Lfa Psen1 tm1MpmHomozygous male *Mmjax* (MMRRC breed #: 034830-JAX) mice were purchased from Jackson Laboratories. The PS19 population was maintained through heterozygous breeding with wild-type C57BL / 6J mice, and heterozygous PS19 transgenic mice were used in this study. A 3×Tg-AD population was maintained through heterozygous mating, and homozygous mice were included in this study. Genotyping was confirmed using PCR. Mice were housed in groups of 3–5 with free access to food and water at a constant temperature of 23°C and a 12-hour light / dark cycle.

[0318] cDNA / siRNA transfection and lentiviral transduction

[0319] cDNA plasmids were transfected into cultured cells using Lipofectamine 2000 (Invitrogen) or polyethyleneimine, and siRNA was transfected using Lipofectamine RNAiMAX. When using both siRNA and cDNA, cells were first transfected with siRNA for 24 h, followed by transfection with cDNA plasmids for another 24 h. Stable QBI293 / tau P301L-GFP cells expressing mCherry or mCherry-TRIM11 were generated via lentiviral transduction using a third-generation lentiviral packaging system. HEK293T cells were transfected with the mCherry or mCherry-TRIM11 plasmid along with helper plasmids Gag, Rev, and VSVG. Lentiviral vectors were obtained by centrifuging the medium at 10,000 rpm for 18–20 h and used for transduction of QBI293 / tau P301L-GFP cells (JL Guo et al., J Biol Chem 291, 13175–13193 (2016)). Three days after viral transduction, mCherry-positive cells were selected using fluorescence activated cell sorting (FACS) and grown in DMEM medium. These cells were further selected using two rounds of FACS and used in this study.

[0320] Screening of TRIM proteins on tau

[0321] HEK293T cells cultured for 24 h and reaching ~80-90% confluence were transfected into 6-well plates using polyethyleneimine with 0.5 μg pRK5-GFP-tau P301L and 2 μg the specified pCDH-EF1-FHC-TRIM-FLAG-HA plasmid. The medium was changed after 12 h. Cells were harvested 48 h post-transfection and lysed on ice for 30 min using 150 μl of ice-cold lysis buffer (50 mM Tris, pH 8.8, 100 mM NaCl, 5 mM MgCl2, 0.5% NP-40, 1 mM DTT, 250 IU / ml benzonase, 1 mM PMSF and 1× complete protease inhibitor mixture). The lysate was centrifuged at 13,000 rpm for 15 min at 4 °C. The NP-40-soluble supernatant was designated as the SN fraction. The NP-40-insoluble precipitate particles were washed once with 500 μl of pre-chilled PBS and resuspended on ice in 50 μl of ice-cold precipitate particle buffer (20 mM Tris, pH 8.0, 15 mM MgCl2, 1 mM DTT, 250 IU / ml benzonase, 1 mM PMSF and 1× complete protease inhibitor mixture) for 30 min. Then, 25 μl of 3× boiling buffer (6% SDS, 20 mM Tris, pH 8.0, 150 mM DTT) was added. The sample was heated at 95 °C for 5–10 min. Proteins aggregated in the precipitate particles that could be dissolved by SDS were designated as SDS-soluble precipitate particle fractions (PE).

[0322] Both the SN and PE fractions were boiled in SDS sample buffer (final concentration: 62.5 mM Tris, pH 6.8, 2% SDS, 10% glycerol, 100 mM DTT, 0.01% bromophenol blue), analyzed by SDS-PAGE, and then transferred to a nitrocellulose membrane. After blocking with 5% skim milk in Tris-buffered saline (TBST) containing Tween, the membrane was incubated with anti-GFP, anti-HA, and anti-HSP90 antibodies, followed by incubation with an HRP-conjugated secondary antibody. Signals were detected using Western Blot Substrates and Substrate Kits on an ECL detection system (Bio-Rad Chemidoc Touch Imaging System Chemiluminescence / Fluorescence Detection). Sample loading and exposure times for immunoblotting were controlled to allow detection of all bands of the immunoblot within a linear range.

[0323] Real-time quantitative PCR (RT-qPCR)

[0324] Total RNA was extracted using TRIzol according to the manufacturer's instructions. 1 μg of RNA was reverse transcribed using a large-volume cDNA reverse transcription kit. Gene expression was determined by SYBR Green-based RT-PCR using an ABI ViiA 7 PCR system (Applied Biosystems, Foster City, CA, USA). The expression of each gene was normalized to [value missing]. GAPDH . The following primers (5' to 3') were used: tau-F: GAGGCGGGAAGGTGCAGATAATTAATAA (SEQ ID NO:13), tau-R: CTGGTTTATGATGGATGTTGCC (SEQ ID NO:14); TRIM10-F: CTGCCCCATCTGTCAGGGTA (SEQ ID NO:15), TRIM10-R, GGTATCTCACAGTAGCGGGTAA (SEQ ID NO:14) NO:16); TRIM11-F: TACTGGGAGGTGGAGGTTGGG (SEQ ID NO:17), TRIM11-R: GGATCTCGGGAAAGATGAATAGCA (SEQ ID NO:18); TRIM26-F: TGCACTACTACTGTGAGGACG (SEQ ID NO:19), TRIM26-R: TCCTTAGGGTACTCAGGTGGT (SEQ ID NO:19) NO:20); TRIM36-F: GAGCTGTTTACCCACCCATTG (SEQ ID NO:21), TRIM36-R: CTGATCCCACATCGTTGAATGA (SEQ ID NO:22); TRIM55-F: TTGTCAGCACAACCTGTGTAG (SEQ ID NO:23), TRIM55-R: CCCATGTCTATCCAAAACCACTT (SEQ ID NO: 24); GAPDH-F: GCTAAGGCTGTGGGCAAGG (SEQ ID NO: 25), GAPDH-R: GGAGGAGTGGGTGTCGCTG (SEQ ID NO: 26).

[0325] Proteins extracted from human brain samples

[0326] From 23 cases of AD confirmed by neuropathology and 14 control individuals with no history of dementia or other neurological disorders ( Figure 2APostmortem human brain tissue was obtained (see Table 2). Proteins were extracted from these human brain tissues as previously described (GS Gibbons et al., MolNeurodegener 15, 64 (2020)). Briefly, gray matter from the frontal cortex was homogenized in a high-salt buffer containing sodium dodecyl sarcosyl (10 mM Tris-HCl pH 7.4, 800 mM NaCl, 1 mM EDTA, 2 mM DTT, a mixture of protease inhibitors, 1 mM PMSF, PhosSTOP™, 0.1% sodium dodecyl sarcosyl and 10% sucrose) at 9 volumes of buffer per gram of tissue. After incubation on ice for 30 min, the lysates were centrifuged at 10,000 g for 10 min at 4 °C. The supernatant was collected, and protein concentrations were measured using a Bradford assay (Bio-Rad Labs). The protein was boiled in SDS sample buffer and then analyzed by SDS-PAGE.

[0327] Immunohistochemical (IHC) and immunofluorescence (IF) analysis of human brain tissue

[0328] Human brain tissue was fixed in paraformaldehyde, embedded in paraffin, and cut into 6 μm thick sections. The sections were dewaxed in xylene and rehydrated in ethanol (100-50%). For IHC staining, rabbit anti-TRIM11 antibody was diluted 1:500 in 3% goat serum in PBS, and after antigen retrieval at 4°C, it was applied to the rehydrated tissue sections overnight. After washing five times with PBS, the sections were incubated with a biotin-conjugated secondary antibody to ligate avidin using an ABC kit for 1 hour, followed by staining with DAB solution. For IF staining, rabbit anti-TRIM11 antibody, mouse anti-tau AT8 antibody, or mouse anti-NeuN antibody was diluted 1:500 in 3% goat serum in PBS and applied overnight at 4°C. After washing five times with PBS, the labeled proteins were visualized by incubation with Alexa Fluor 488-conjugated and Alexa Fluor 555-conjugated secondary antibodies. The sections were then dehydrated, cleaned in xylene, and mounted on a glass slide using DPX mounting medium (ElectronMicroscopy Science). The samples were then visualized using a revolve fluorescence microscope (EchoLaboratories).

[0329] Protein purification

[0330] GST, GST-TRIM11, GST-tau, 6×His-GFP-tau, and 6×His-GFP-tauP301L were purified from bacteria. BL21 DE3 cells (Thermo Fisher Scientific, Cat# C600003) containing the corresponding plasmids were grown at 37°C until stage A. 600nm =0.6-0.8, and protein expression was induced for 20 h at 19-20℃ with 0.5 mM IPTG. Cells were collected and resuspended in buffer containing 50 mM Tris-HCl, pH 7.4, 500 mM NaCl, 200 mM KCl, and 10% glycerol (for GST protein) or buffer containing 50 mM NaH2PO4 and 300 mM NaCl (for 6×His-tau). Each buffer was supplemented with a complete protease inhibitor mixture, 1 mM benzyl sulfonyl fluoride, 1 mM DTT, and 1 mg / ml lysozyme. Cells were lysed by sonication. Cell lysates were centrifuged at 13,000 rpm and 4℃ for 30 min.

[0331] To purify GST protein, the supernatant was applied to a column packed with glutathione beads (QIAGEN, Cat#34694) and incubated at 4°C for 2 h. The column was thoroughly washed with washing buffer (50 mM Tris-Cl, pH 7.5 and 150 mM NaCl). The bound protein was eluted with elution buffer (50 mM Tris-Cl, pH 7.5, 150 mM NaCl and 20 mM glutathione). Fractions were collected, 0.5 mL per fraction, and concentrated and desalted using a centrifuge filter (Millipore, Cat#: UFC800308) to remove GST or GST fusions. To purify 6×His-GFP-tau and 6×His-GFP-tau P301L, the supernatant was incubated with Ni-NTA agarose (QIAGEN) at 4°C for 2 h. Wash the beads thoroughly with washing buffer (50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, pH 8.0). Elute the fusion protein with elution buffer (50 mM NaH2PO4, 300 mM NaCl, 400 mM imidazole, pH 8.0), concentrate and desalt using a centrifugal filter.

[0332] As previously mentioned, Flag-TRIM11 and Flag-TRIM12 were purified from HEK293T cells. 2EA(76, 77). Briefly, HEK293T cells transfected with Flag-TRIM11 plasmid were lysed by sonication in IP lysis buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.5% Triton X-100, 0.5% NP-40, and 10% glycerol). The supernatant was incubated with an anti-Flag M2 affinity gel at 4°C for 4 h to overnight. The gel was washed sequentially with lysis buffer containing 0, 0.25, 0.5, 1, 0.5, 0.25, and 0 MCl, followed by washing with Tris buffer or sodium phosphate buffer. The recombinant protein was eluted with 3×FLAG peptide at 4°C for 1 h, concentrated by centrifugation, filtered, and desalted.

[0333] As previously described (W. Li, VM Lee, Biochemistry 45, 15692-15701 (2006)), Tau-441 was purified. Tau-441 P301L (cat. # T-1014-1) was purchased from rPeptide (Watkinsville, GA).

[0334] Actinomycete ketone tracking assay

[0335] HEK293T cells were cultured in 12-well plates for 24 h and then transfected with the specified plasmid. To analyze the half-life of GFP-tau or GFP-tau P301L, 24 h post-transfection, actinomycin (CHX) (50 μg / ml) was used. -1 Cells were treated for different durations. After treatment, cells were harvested and the SN and PE fractions were extracted as described above.

[0336] BiFC Measurement

[0337] HEK 293T cells were seeded into 6-well plates containing DMEM medium supplemented with 10% fetal bovine serum (FBS) for 24 h, allowing the cells to reach 80-90% confluence at transfection. Cells were co-transfected with the specified plasmid. After 12 h, the cells were replaced with fresh medium and cultured for another 12 h. Fluorescence was observed on a Revolve Microscope DEMO (Echo Laboratories).

[0338] Immunoprecipitation

[0339] Immunoprecipitation assays were performed as previously described (G. Zhu et al., Cell Rep 33, 108418 (2020)). Briefly, HEK293 cells transfected with the specified expression plasmid were lysed on ice for 30 min in lysis buffer (50 mM Tris, pH 7.4, 200 mM NaCl, 0.2% Triton, 1 mM DTT, 1 mM PMSF, and a 1× complete protease inhibitor mixture). Cell lysates were centrifuged, the supernatant was collected, and incubated overnight at 4°C with the specified primary antibody. Protein A / G-agarose beads were incubated with the immune complex for 4 h. After thorough washing, the immunoprecipitate was resuspended in SDS sample buffer and boiled for 5 min. Immunoprecipitates and whole-cell lysates were separated by SDS-PAGE and Western blotting.

[0340] Colocation determination

[0341] To determine the co-localization of endogenous TRIM11 and tau in SH-SY5Y, N2A, and cultured neurons, cells were fixed for 10 min at room temperature in PBS containing 4% paraformaldehyde and 4% sucrose. Cells were then permeabilized with 0.5% Triton X-100 for 5 min and blocked with 10% NGS in PBS for 30 min. They were then incubated overnight at 4°C with rabbit anti-TRIM11 antibody, mouse anti-tau antibody (for all cells), and chicken anti-MAP2 antibody (for neurons only). After washing three times with PBS, the labeled proteins were visualized by incubation at room temperature for 1 h with secondary antibodies conjugated with Alexa Fluor 488 (goat anti-rabbit), Alexa Fluor 555 (goat anti-mouse), and Alexa Fluor 405 (goat anti-chicken) (for MAP2 staining). After washing three times with PBS, coverslips were fixed onto slides, and fluorescence images were captured using a confocal microscope. To quantify the colocalization of endogenous TRIM11 and tau, SH-SY5Y, N2A cells, or dendrites of neurons of the same length were randomly selected, and colocalization was quantified using the Image J plugin JACOP.

[0342] Adjacent connectivity determination (PLA)

[0343] To determine the PLA fluorescence of endogenous TRIM11 and tau in SH-SY5Y, N2A, and primary cultured neurons, the Duolink® In Situ Red Starter kit from Sigma-Aldrich was used. Cells were fixed in PBS containing 4% paraformaldehyde for 10 min at room temperature. After fixation, cells were washed with PBS, permeabilized with 0.5% Triton X-100 for 5 min, and blocked with Duolink® blocking solution at 37°C for 60 min. Cells were then incubated overnight at 4°C with rabbit anti-TRIM11 antibody and mouse anti-tau antibody. Secondary antibodies conjugated with oligonucleotides were added to the reaction and incubated at 37°C for 1 h. Ligation and amplification were performed by incubation at 37°C with ligation solution for 30 min, followed by incubation at 37°C with amplification buffer containing polymerase for 100 min. Slides were mounted with mounting medium containing DAPI, and fluorescence images were captured by confocal microscopy. As a negative control, ortho-ligation assays were performed in the absence of a primary antibody.

[0344] SUMOylation assay

[0345] For SUMOylation assays in cells, HEK 293T cells were transfected with the specified plasmid for 48 h and treated with the proteasome inhibitor MG132 (10 mM) for 6 h. Cells were lysed in lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.5% Triton, 1 mM DTT, 1 mM PMSF, and a 1× complete protease inhibitor mixture) supplemented with 2% SDS and 50 mM DTT. Cell lysates were boiled at 95 °C for 10 min and diluted 10-fold in SDS-free lysis buffer. A portion of the cell lysates was retained. The remaining cell lysates were incubated overnight at 4 °C with anti-GFP antibody and then incubated with Protein A / G agarose beads for an additional 2 h (denaturing immunoprecipitation, d-IP). The d-IP samples were thoroughly washed and analyzed by Western blotting with the specified antibody along with the cell lysates.

[0346] In a solution containing purified GST-tau or GST-tau P301L (600 ng / 400 nM each), SUMO E1 (125 nM), SUMOE2 (1 μM), Flag-TRIM11 (300 nM), His-SUMO2 (25 μM), and 10 mM Mg 2+In vitro SUMOylation assays were performed for 1.5 h at 37 °C in 20 μL of ATP reaction buffer (50 mM Tris, pH 7.5, and 2.5 mM DTT). The reaction mixture was terminated by adding 20 μL of IP lysis buffer containing 2% SDS and 50 mM DTT and heating at 95 °C for 10 min. A portion of the heat-denatured reaction mixture was retained. The remaining portion was diluted to 1.5 mL of SDS-free IP lysis buffer. GST-tau or GST-tau P301L was immunoprecipitated using anti-GST beads (anti-GSTd-IP). After thorough washing, the d-IP sample and reaction mixture were analyzed by Western blotting using the specified antibody.

[0347] Prevention and depolymerization of tau fibrils

[0348] As a precaution, purified tau-441 (10 μM) was induced to form tau aggregates for 24 h at 37 °C in the presence of a specified concentration of GST or GST-TRIM11 in reaction buffer (20 mM Tris-HCl, pH 7.4, 100 mM NaCl, 1 mM EDTA, and 1 mM M DTT) via heparin (30 μM) or via pre-formed tau fibrils (PFF, 0.2 μM). Tau fibrillation was analyzed by ThT binding as previously described (DS Harischandra et al., Sci Signal 12, (2019)). Tau aggregation was also detected by sedimentation assay. After centrifugation at 13,000 rpm for 30 min at 4 °C, the precipitate particles were analyzed by Western blotting to detect SDS-soluble (PE) amorphous aggregates, and relatively large SDS-resistant (SR) fibril aggregates were detected by dot blot analysis (L. Guo et al., Mol Cell 55, 15-30 (2014); G. Zhu et al., Cell Rep 33, 108418 (2020); L. Huang et al., DAXX represents a new type of protein-foldingenabler. Nature 597, 132-137 (2021)). To depolymerize, pre-formed tau filaments (1 μM) were incubated with or without a specified concentration of Flag-TRIM11 or GST-TRIM11 in a reaction solution (50 mM HEPES, pH 7.5, 50 mM KCl, 5 mM MgCl2, and 1 mM DTT) at 37 °C for 24-48 h. The reaction mixture was analyzed by ThT binding and sedimentation assays as described above.

[0349] Negative staining electron microscopy examination

[0350] Using a Pelco Easyglow instrument, 5 μL of sample was applied to a thin carbon grid after glow discharge for 2 min. 5 μL of freshly prepared 2% uranyl acetate staining solution was applied and incubated with the sample on the grid for 2 min. Excess sample and staining agent were blotted away with Whatman filter paper. The staining process was repeated, and the grid was dried until imaging was achieved. TEM micrographs were acquired at 100 keV using a Tecnai T12 TEM microscope. Images were recorded on a Gatan Oneview 4K×4K camera. Each image was acquired by exposing the sample for 4 seconds, and a total of 100 dose-graded images were collected and incorporated into a single micrograph. Data were acquired at magnifications of 30K–40K with underfocus from -1.5 to 2 μm.

[0351] Prevention of PFF-induced endogenous tau accumulation

[0352] As described (DW Sanders et al., Neuron 82, 1271-1288 (2014)), fibrillary transduction of HEK293T cells was performed. Briefly, tau PFF was incubated with Lipofectamine-2000 in OptiMEM for 20 min, and then added to the cells at a final concentration of 400 nM. After 18 hours, the cells were washed and the medium was replaced with fresh medium. For fibrillary transduction of primary neurons as previously described (JL Guo, VM Lee, FEBS Lett 587, 717-723 (2013)), cells were grown for 4 days and tested with AAV or ASO for 3 days. Tau PFF was diluted in PBS and sonicated with 60 pulses, and then added to neurons at a concentration of 1.5 μg per well. Two weeks after PFF transduction, the transduced neurons were harvested for immunocytochemistry. For long-term ASO-mediated TRIM11 knockdown, neurons were transduced again with ASO on day 14.

[0353] Production of rAAV9-TRIM11 and rAAV9-GFP vectors

[0354] Human TRIM11 (with a C-terminal HA tag) and GFP were cloned into the plasmid pENN.AAV9.CB7.CI.WPRE.rBG, where their expression is driven by CB7, a chicken β-actin promoter with a cytomegalovirus enhancer element. TRIM11 and GFP plasmid DNA were prepared using an endotoxin-free mega-prep kit (Qiagen) and identified (characterized) by structural and sequence analysis.

[0355] AAV / ASO transduction and analysis of cultured primary neurons

[0356] Primary neurons were grown for 4 days prior to AAV vector treatment. rAAV9-GFP was diluted to 5 × 10⁻⁶ in the basal neuronal culture medium used for neuronal transduction. 10 GC / ml, and dilute rAAV9-TRIM11 to 1.9×10⁻⁶. 11 GC / ml. To knock down TRIM11 in neurons, ASO was added to the culture medium at a final concentration of 10 μM, and the knockdown effect was analyzed by Western blotting after 3 days. For long-term TRIM11 knockdown in neurons, ASO was added at two time points, and cellular uptake was monitored using fluorescently labeled oligomers.

[0357] Hippocampal and cortical neurons were washed with PBS and fixed for 10 min at room temperature in PBS containing 4% paraformaldehyde and 4% sucrose. After fixation, cells were washed with PBS, permeabilized with 0.5% Triton X-100 for 5 min, and blocked with PBS solution containing 10% NGS for 30 min. Cells were then incubated overnight at 4°C with primary antibodies against phosphate-tau (AT8 and MC1; 1:2000), GFP (1:2000) and HA (1:500), synaptophysin (1:500), PSD95 (1:300), NFL (1:500), and / or MAP2 (1:2000). After primary antibody incubation, cells were washed and incubated for 90 min in the dark with a secondary antibody conjugated to Alexa Fluor 488-, Alexa Fluor 555-, or Alexa Fluor 405- (Invitrogen, 1:1000). Hoechst 44432 (Invitrogen, 1:10000) was used as the nuclear staining agent. Coverslips were then fixed onto slides and slides, and fluorescence images were captured using a confocal laser scanning microscope. AT8, MC1, and NFL signals were normalized based on cell number. PSD95 and synaptophysin signals were normalized based on dendrite length. MAP2 staining was used for dendrite length quantification. For this purpose, individual neurons were randomly selected, and the total dendrite length of each neuron was tracked and measured using the Image J plugin Neuron J. To measure cell viability, neurons treated with control or TRIM11 ASO, or transduced with AAV9-GFP or AAV9-TRIM11 and treated with myc-K18 / P301L PFF for 2 weeks, were analyzed using cell counting KIT-8 (Dojindo Laboratories, CK04) according to the manufacturer's instructions.

[0358] Stereotactic injection

[0359] PS19 or 3×Tg-AD-AD mice of either sex were anesthetized with a ketamine / toluidine mixture (100 mg / kg ketamine, 10 mg / kg toluidine, ip) and fixed in a stereotactic frame (Angle II, Leica Biosystems). Injections were performed at predetermined coordinates using a 10 μL Hamilton syringe. Mice were injected into the hippocampus (anterior fontanelle, AP -2.5 mm; ML, +2.0 mm; and DV, -1.8 mm) or lateral ventricle (anterior fontanelle, AP -2.5 mm; ML, +2.0 mm; and DV, -1.8 mm) with the following: (1) rAAV9-TRIM11 or rAAV9-GFP (5 × 10⁻¹¹ 10 μL / kg ... 13 (2) rAAV9-TRIM11 or rAAV9-GFP+K18 tau PFF (2 μg / μl, 2.5 μl). Specifically, 10-week-old PS19 mice were injected into the hippocampus with rAAV9-GFP or rAAV9-TRIM11, and 4-week-old PS19 mice were injected into the hippocampus with tau PFF and rAAV9-GFP or rAAV9-TRIM11. 12-month-old 3×Tg-AD-AD mice were injected into the hippocampus with rAAV9-GFP or rAAV9-TRIM11, and 9-month-old 3×Tg-AD-AD mice were injected into the lateral ventricle with rAAV9-GFP or rAAV9-TRIM11. All animals were given analgesia (10 mg / kg bupivacaine) during surgery and were monitored during surgery and 3 days post-surgery.

[0360] Western blot analysis of mouse brain

[0361] At 12 weeks of age, PS19 mice injected with tau PFF and rAAV9-GFP or rAAV9-TRIM11 were euthanized by carbon dioxide asphyxiation. The hippocampus of the injected PS19 mice was carefully dissected and stored at -80°C until use. The remaining mouse models followed the same procedure at the following time points: PS19 mice injected with rAAV9 at 10 months of age; 3×Tg-AD-AD mice injected with rAAV9 in the hippocampus at 13 months of age; and 3×Tg-AD mice injected with rAAV9 in the lateral ventricle at 13.5 months of age.

[0362] The hippocampus was lysed on ice for 30 min in lysis buffer (50 mM Tris, pH 8.8, 100 mM NaCl, 5 mM MgCl2, 0.5% NP-40, 1 mM DTT, 250 IU / ml benzonase, 1 mM PMSF, and a 1× complete protease inhibitor mixture). The lysate was centrifuged at 13,000 rpm and 4 °C for 15 min. The NP-40-soluble supernatant was collected as the SN fraction. After washing with PBS, the NP-40-insoluble precipitate particles were resuspended on ice in precipitation particle buffer (20 mM Tris, pH 8.0, 15 mM MgCl2, 1 mM DTT, 250 IU / ml benzonase, 1 mM PMSF, and a 1× complete protease inhibitor mixture) for 30 min. The protein aggregates in the precipitate particles were boiled in a buffer containing 2% SDS. Clarified samples containing equal amounts of protein were separated on a 10% SDS-polyacrylamide gel and analyzed by Western blotting.

[0363] Immunohistochemical analysis of mouse brain

[0364] Mice were perfused with PBS and 4% paraformaldehyde (PFA) hearts, then the brains were removed, post-fixed in PFA for 48 h, thoroughly washed in PBS, and then embedded in paraffin blocks. 7 μm thick sections were excised from these blocks for histological analysis. Slides were baked at 60 °C for 30 min, then dewaxed with xylene (two washes × 5 min) and rehydrated via an ethanol gradient (1 min 100% EtOH, 1 min 95% EtOH, 1 min 70% EtOH, and 1 min 50% EtOH). Antigen retrieval was performed as previously described (H. Kai et al., JHistochem Cytochem 60, 761-769 (2012)). Specifically, brain tissue sections were incubated in 10 mM EDTA (pH 3.0, pH 6.0, and pH 10.0) and 0.1 M sodium citrate (pH 3.0, pH 7.2, and pH 10.0) at 90 °C for 5 min each. The sections were then digested with 1.0 μg / ml proteinase K and 100.0 μg / ml trypsin in 1.0 mM CaCl2 / 50 mM Tris buffer (pH 7.6) at 37 °C for 30 min. The sections were then incubated in FA at room temperature for 5 min. After antigen retrieval, the sections were washed with tap water for at least 5 min, then with PBS, and permeabilized for 1 h at room temperature with blocking buffer (a solution of 10% goat serum, 2% BSA, 0.1% Triton X-100, and 0.05% Tween 20 in PBS). The sections were incubated overnight at 4°C with anti-AT8 antibody (1:200, Thermo Fisher Scientific, MN1020) and stained with DAB (3,3'-diaminobenzidine) as previously described (R. Gordon et al., Nat Commun 7, 12932 (2016)). The sections were counterstained with hematoxylin, then dehydrated, cleaned in xylene, and mounted on slides using DPX mounting medium (Electron Microscopy Science). The samples were developed using an inverted fluorescence microscope (Revolve, EchoLaboratories), and photomicrographs of the sections were captured.

[0365] Quantitative AT8, GFAP, and Iba1 staining was performed using ImageJ. The hippocampus was outlined and separated, and colors were separated using Color Deconvolution-H&E DAB. Thresholds were automatically set, and staining intensity was measured. For AT8 staining, the average staining intensity was calculated for the GFP- or TRIM11-injected groups (6 mice per group), expressed as relative intensity. For GFAP and Iba1 staining, the percentage of stained area in the hippocampus was calculated.

[0366] Object recognition test

[0367] First, acclimatize the mice to an empty open maze (see above) for 5 minutes. After 24 hours, place the mice in the center of the room with two identical objects 5 cm away from the walls, allowing the mice to explore these objects for 10 minutes. After 12 hours, place the mice in the center of the room with the same two identical objects, allowing the mice to explore for 10 minutes. After 6 hours, place the mice in the center of the room with one familiar object and one new object, allowing the mice to explore for 10 minutes. Record and track the mice using a camera connected to automated tracking software (ANY-maze, SD Instruments). The discriminatory index is calculated by subtracting the time spent exploring the familiar object from the time spent exploring the new object, and then dividing this difference by the sum of the times spent exploring the familiar object and the time spent exploring the new object. The preference index is calculated by dividing the time spent exploring new objects by the sum of the time spent exploring new objects and the time spent exploring familiar objects, and then multiplying the quotient by 100 to get a percentage (LM Lueptow, J Vis Exp, (2017)).

[0368] Y-Maze Test

[0369] To measure hippocampus-dependent memory, spontaneous alternation behavior (ANY-maze, SD instruments) in mice was tested in a Y-maze. Mice were placed in the center of a 3-arm Y-maze and tracked for a period of 5 minutes. Spontaneous alternation behavior was scored based on the following formula, which is the ratio of the number of alternations (entering an arm different from the previous two selections) to the total number of alternation opportunities: Spontaneous Alternation % = Number of Spontaneous Alternation / (Total Arm Entry - 2) × 100.

[0370] Wire suspension test

[0371] To measure grip strength, mice were placed on a wire mesh and allowed to acclimatize for 30 seconds before the mesh was flipped. The wire was suspended 15 cm above an empty, clean cage, and the fall waiting time was measured. The maximum exploration time was 3 minutes. The average fall waiting time across three tests conducted within one day was analyzed.

[0372] Open field test

[0373] Exploratory movement behavior was analyzed using a multi-unit open field maze (SD Instruments). The maze consisted of four activity chambers, each measuring 50 cm (length) × 50 cm (width) × 38 cm (height), made of white, high-density, non-porous plastic. At the start of the test, mice were placed in the center of each chamber. After a 2-minute acclimatization period, the total distance traveled, total movement time, total stationary time, and time spent in each designated quadrant of the chamber were monitored using a camera connected to automated tracking software (ANY-maze, SD Instruments) for a total of 10 minutes.

[0374] software

[0375] GraphPad Prism 7, ImageJ, ZEN lite: Carl Microscopy.

[0376] Statistical analysis

[0377] Data are expressed as mean ± standard deviation (SD) or mean ± standard error of mean (SEM). Unless otherwise specified, a two-tailed Student's t-test is used to assess the statistical significance of the means between the two groups. P <0.05; P <0.01; P <0.001). Use Prism GraphPad 7 to generate the graph and perform statistical analysis.

[0378] Each experiment must be performed at least three times or use at least three biological replicates.

[0379] The results of this experiment will now be described.

[0380] Effect of TRIM protein on tau aggregation

[0381] To determine the effect of TRIM proteins on tau aggregation, two approaches were combined: (1) a systematic analysis of the ability of all known human TRIMs to remove tau aggregation in cultured cells, and (2) a comparison of the expression of TRIMs that showed an effective effect in post-mortem tissues of AD and control individuals. For the systematic analysis, 75 TRIMs were cloned into mammalian expression vectors (Table 1). Each TRIM was introduced into HEK293T cells along wit...

Claims

1. A composition for treating or preventing diseases or conditions associated with aggregations selected from one or more of the following: tau, α-synuclein (α-Syn), superoxide dismutase 1 (SOD1), TAR DNA-binding protein 43 (TDP-43), sarcoma fusion / liposarcoma translocation protein (FUS / TLS), ataxia protein 1, huntingtin (Htt), Aβ42, and heterogeneous ribonucleoprotein A1 (hnRNPA1), said composition comprising an activator of the level or activity of one or more triple motif (TRIM) proteins. The one or more TRIM proteins mentioned therein are selected from one or more of the following: human TRIM10, TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM11, TRIM17, TRIM18, TRIM19, TRIM21, TRIM24, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM37, TRIM39, TRIM40, TRIM41, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM56, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, TRIM70, TRIM71, TRIM73, and TRIM77.

2. The composition according to claim 1, wherein the activator is selected from one or more of the following: compounds, proteins, peptides, peptide-like substances, antibodies, ribozymes, small molecule compounds, nucleic acids, carriers, antisense nucleic acids, siRNA, shRNA, and guide RNA.

3. The composition according to claim 1, wherein the disease or symptom is related to the accumulation of tau; and The one or more TRIM proteins mentioned above are selected from TRIM10, TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM11, TRIM12, TRIM17, TRIM18, TRIM19, TRIM21, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69 and TRIM70.

4. The composition of claim 1, wherein the disease or symptom is associated with the aggregation of α-Syn; and The one or more TRIM proteins mentioned above are selected from TRIM10, TRIM2, TRIM3, TRIM17, TRIM18, TRIM19, TRIM26, TRIM29, TRIM30, TRIM31, TRIM36, TRIM41, TRIM42, TRIM43, TRIM46, TRIM49, TRIM55, TRIM56, TRIM63, TRIM64, TRIM68, TRIM69, TRIM70, TRIM71 and TRIM73.

5. The composition of claim 1, wherein the disease or symptom is related to the aggregation of SOD1; and The one or more TRIM proteins mentioned above are selected from TRIM10, TRIM11, TRIM24, TRIM36 and TRIM58.

6. The composition of claim 1, wherein the disease or symptom is associated with the accumulation of TDP-43; and The one or more TRIM proteins mentioned above are selected from TRIM10, TRIM11, TRIM17, TRIM36, TRIM37, TRIM40, TRIM49 and TRIM55.

7. The composition of claim 1, wherein the disease or symptom is associated with the aggregation of FUS / TLS, ataxia protein 1, Htt, Aβ42, and hnRNPA1; and The one or more TRIM proteins mentioned therein are TRIM10.

8. The composition according to any one of claims 3-7, wherein the activator of the TRIM protein is a peptide comprising the amino acid sequence of the TRIM protein or a functional variant thereof.

9. The composition according to any one of claims 3-7, wherein the activator of the TRIM protein is a nucleic acid encoding the TRIM protein or a functional variant thereof.

10. The composition according to any one of claims 3-7, wherein the activator of the TRIM protein is a vector comprising a nucleic acid encoding the TRIM protein or a functional variant thereof.

11. The composition according to claim 10, wherein the vector is a virus.

12. The composition of claim 11, wherein the virus is an adeno-associated virus.

13. A method for treating or preventing a neurodegenerative disease or condition associated with the aggregation of one or more proteins selected from the group consisting of tau, α-Syn, SOD1, TDP-43, FUS / TLS, ataxia protein 1, Htt, Aβ42, and hnRNPA1, the method comprising administering to the subject the composition of any one of claims 1-12.

14. The method of claim 13, wherein the neurodegenerative disease or condition related to tau is selected from Alzheimer's disease, frontotemporal degeneration (FTLD-tau), progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), argyrophilic granulation disease (AGD), frontotemporal dementia and Parkinson's disease associated with chromosome 17 (FTDP-17), vacuolar tau proteinopathy, Lytico-Bodig disease, globular tau proteinopathy (GGT), age-related tau astrocytosis (ARTAG), Pick's disease. Diseases including amyotrophic lateral sclerosis (ALS), primary age-related tau protein disease (PART), tangles-only dementia (TOD), chronic traumatic encephalopathy (CTE), anti-IgLON5-associated tau protein disease, Guadeloupe Parkinson's syndrome, multisystemic protein disease (MSP), nodding syndrome (NS), ganglioglioma, gangliocytoma, meningioma, post-encephalitis Parkinson's syndrome, subacute sclerosing panencephalitis (SSPE), lead encephalopathy, tuberous sclerosis, pantothenic kinase-associated neurodegeneration, and lipofuscinosis; and The activator of the one or more TRIM proteins is one or more activators selected from TRIM10, TRIM11 and TRIM55.

15. The method of claim 14, wherein application of the composition is effective against one or more selected from: a) Reduce tau aggregates by at least approximately 60%; b) Reduce the ratio of insoluble tau to soluble tau by at least about 50%; and c) After 6 to 8 days of application of the composition, tau aggregates are reduced by approximately 90%.

16. The method of claim 13, wherein the neurodegenerative disease or condition associated with α-Syn is selected from Parkinson's disease (PD), Lewy body dementia (DLB), multiple system atrophy (MSA), Shy-Drager syndrome, striatal substantia nigra degeneration, olivopontocerebellar atrophy, Hallervorden-Spatz syndrome, REM sleep behavior disorder (RPD), and Alzheimer's disease with amygdala-restricted Lewy bodies (AD / ALB); and One or more TRIM protein activators are selected from one or more of TRIM10, TRIM36, TRIM55 and TRIM68.

17. The method of claim 13, wherein the neurodegenerative disease or condition associated with SOD1 is selected from amyotrophic lateral sclerosis (ALS) and Parkinson's disease (PD); and One or more TRIM protein activators are selected from one or more of TRIM10, TRIM11, TRIM24, TRIM36 and TRIM58.

18. The method of claim 13, wherein the neurodegenerative disease or condition associated with TDP-43 is selected from frontotemporal dementia (FTD), frontotemporal degeneration (FTLD-TDP), multisystem protein disease (MSP), Perry's disease, facial-onset sensory and motor neuron disease (FOSMN), Alzheimer's disease (AD), age-related TDP-43 brain with sclerosis (CARTS), limbic system-predominant age-related TDP-43 encephalopathy (LATE), sporadic inclusion body myositis (sIBM), chronic traumatic encephalopathy (CTE), primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), Guam Parkinson's dementia syndrome (G-PDC), Guam amyotrophic lateral sclerosis (G-ALS); Parkinson's disease (PD) and Huntington's disease (HD); and One or more TRIM protein activators are selected from one or more of TRIM10, TRIM11, TRIM17, TRIM36, TRIM37, TRIM40, TRIM49 and TRIM55.

19. The method according to any one of claims 13-18, wherein the composition is administered to the subject in the subject's cerebrospinal fluid (CSF).

20. The method of claim 19, wherein the composition is administered via intraventricular injection (ICV).

21. The method according to any one of claims 13-20, wherein the composition is administered to the subject prior to the onset of symptoms of the disease or condition.

22. The method according to any one of claims 13-20, wherein the composition is administered to the subject after the onset of symptoms of the disease or condition.

23. The method according to any one of claims 13-22, wherein the method further comprises administering one or more other therapeutic agents.

Citation Information

Patent Citations

  • Rubberizing of filamentary material

    CA243520A

  • Lipid-protein-sugar particles for delivery of nucleic acids

    US20020150626A1

  • Lipid-mediated polynucleotide administration to deliver a biologically active peptide and to induce a cellular immune response

    US20030032615A1

  • Lipid-comprising drug delivery complexes and methods for their production

    US20030203865A1

  • Lyophilizable and enhanced compacted nucleic acids

    US20040048787A1