Anti-aeromonas cainea egg yolk antibody as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of biology, and particularly discloses an anti-aeromonas cainea egg yolk antibody as well as a preparation method and application thereof. The invention relates to an anti-aeromonas cainea egg yolk antibody, which is prepared by immunizing laying hens by using an inactivated vaccine prepared from aeromonas cainea RDBAE-24091, collecting hyper-immune eggs, and separating and purifying the hyper-immune eggs to obtain the anti-aeromonas cainea egg yolk antibody. The method comprises the following steps: carrying out inactivation treatment on aeromonas caviridis RDBAE-24091 to prepare an inactivated vaccine, inoculating the vaccine into a laying hen body, inducing the laying hen to generate a specific immune reaction, enabling an immune system of the laying hen to generate an antibody aiming at the aeromonas caviridis to form a hyper-immune egg, carrying out separation and purification on the hyper-immune egg, removing impurities in egg liquid, and carrying out purification on the hyper-immune egg so as to obtain the laying hen feed. A high-purity and high-activity target product is obtained, and an egg yolk antibody product which aims at the aeromonas cainea and has both green safety and targeted antibacterial efficiency is provided.

Description

Technical Field

[0001] This application relates to the field of biotechnology, and in particular to an anti-Aeromonas guinea pig egg yolk antibody, its preparation method, and its application. Background Technology

[0002] Aeromonas caviae is a Gram-negative facultative anaerobic bacillus belonging to the genus Aeromonas. This bacterium is a freshwater pathogen widely distributed in lakes, rivers, aquaculture ponds, and drinking water sources. It is a zoonotic pathogen that can cause disease in various aquatic animals, primarily affecting species such as the giant freshwater prawn, whiteleg shrimp, soft-shelled turtle, red prawn, grass carp, perch, and Chinese mitten crab, resulting in significant economic losses to the aquaculture industry.

[0003] Aeromonas vaginalis infection is relatively common in freshwater fish farming, often occurring under conditions of deteriorating water quality, low dissolved oxygen, and spoiled or rotten feed. Autumn is the peak season for bacterial enteritis. Due to the large changes in the aquatic environment and the high digestive load during peak feeding periods, carnivorous fish such as grass carp are highly susceptible to bacterial enteritis, which can lead to the death of the entire pond in severe cases.

[0004] Antimicrobial resistance has become a major challenge in global public health. With the widespread and inappropriate use of antibiotics, the spread of resistance is becoming increasingly severe, posing a serious threat to global human health and healthcare systems. Currently, the control of Aeromonas pathogens in aquaculture mainly relies on antibiotics and vaccines (such as Aeromonas hydrophila vaccines), but existing methods have significant limitations: ① Decreased efficacy of antibiotics: Clinical isolates of Aeromonas vaginalis have developed resistance rates of over 90% to conventional drugs such as erythromycin and tetracycline.

[0005] ②Limited protection range of the vaccine: Aeromonas hydrophila vaccine cannot cross-protect against Aeromonas guinea pig infection (antigen similarity <70%).

[0006] Against this backdrop, the development of an egg yolk antibody product targeting Aeromonas vaginalis that combines green safety with targeted antibacterial efficacy is particularly urgent. Based on this, this application provides an anti-Aeromonas vaginalis egg yolk antibody, its preparation method, and its application. Summary of the Invention

[0007] In view of the current situation that the prevention and control of Aeromonas pathogens in aquaculture mainly relies on antibiotics and vaccines, this application provides an anti-Aeromonas guinea pig egg yolk antibody, its preparation method and application.

[0008] In the first aspect, this application provides an anti-Aeromonas guinea pig egg yolk antibody, which adopts the following technical solution: an anti-Aeromonas guinea pig egg yolk antibody is obtained by immunizing laying hens with an inactivated vaccine prepared from Aeromonas guinea pig RDBAE-24091, and collecting hyperimmune eggs for separation and purification.

[0009] By employing the above-mentioned technical solution, *Aeromonas guinea pig* RDBAE-24091 was cultured and inactivated to prepare an inactivated vaccine. This vaccine was then administered to laying hens to induce a specific immune response. The hens' immune system produced antibodies against *Aeromonas guinea pig*, which were then transferred to the eggs, forming hyperimmune eggs. The hyperimmune eggs were then separated and purified to remove impurities from the egg liquid, yielding a high-purity, high-activity target product.

[0010] Secondly, this application also provides a method for preparing anti-Aeromonas guinea pig egg yolk antibody, comprising the following steps: (1) Prepare an inactivated vaccine from Aeromonas guinea pig RDBAE-24091; (2) Use inactivated vaccines to immunize laying hens via intramuscular injection and collect highly immunized eggs; (3) Disinfect the high-immunity eggs, remove the egg white, collect the yolks, and extract the yolk antibodies using a modified water extraction method to obtain anti-Aeromonas guinea pig yolk antibodies.

[0011] By employing the above technical approach, *Aeromonas guinea pig* RDBAE-24091 was first cultured and inactivated to ensure the strain lost its pathogenicity but retained its immunogenicity. An inactivated vaccine was then administered intramuscularly, utilizing the laying hen's immune system to produce specific antibodies against *Aeromonas guinea pig*. Antibodies were enriched in the egg yolk, and the eggs were collected as hyperimmune eggs. These hyperimmune eggs underwent surface sterilization, and after breaking the shell, the egg white and yolk were separated. A modified water extraction method was used to extract yolk antibodies, yielding anti-*Aeromonas guinea pig* yolk antibodies.

[0012] Preferably, in step (1), Aeromonas guinea pig RDBAE-24091 strain is inoculated onto BHI liquid medium to prepare a preliminary bacterial suspension, which is then inactivated to prepare an inactivated vaccine.

[0013] By adopting the above technical solution, BHI liquid culture medium can meet the rapid growth requirements of Aeromonas guinea pig, ensuring that the bacterial count meets the standards and guaranteeing the immunogenicity of the subsequent vaccine. Inactivation renders Aeromonas guinea pig in the bacterial suspension non-pathogenic, but retains its antigenic structure, ensuring that it can induce specific antibodies in laying hens, ensuring thorough inactivation and vaccine effectiveness, and thus preparing an inactivated vaccine.

[0014] Preferably, in step (1), the inactivated vaccine is prepared as follows: Oil phase preparation: Take white oil for injection and aluminum stearate, place them in an oil phase preparation vessel and heat to 80°C. Then add Span-80 and heat until completely dissolved. Sterilize at 121°C for 30 minutes to obtain the oil phase. Aqueous phase preparation: Mix the inactivated and qualified bacterial suspension with the solution and stir thoroughly until completely dissolved to obtain the aqueous phase; Emulsification: Emulsify the sterilized oil phase and the prepared aqueous phase at a ratio of 2:1 (v / v) until a uniform emulsion is formed. Add the vaccine to a centrifuge tube and centrifuge. The aqueous phase separated at the bottom of the tube should not exceed 0.5 mL to obtain the inactivated vaccine.

[0015] By adopting the above technical solution, in the oil phase preparation, white oil serves as the oil phase matrix, aluminum stearate increases the viscosity of the oil phase, and Span-80 acts as an emulsifier to promote the mixing of the oil and water phases, forming a stable emulsion. In the aqueous phase preparation, the aqueous phase must be sterile, and the inactivated and tested Aeromonas guinea pig bacterial suspension components must be thoroughly dissolved to avoid particles affecting the emulsification effect.

[0016] During emulsification, the sterilized oil phase and the water phase are mixed and stirred until a homogeneous emulsion is formed, resulting in an inactivated vaccine. Oil emulsion vaccines have advantages such as sustained-release effect (prolonging antigen stimulation time and increasing antibody titer), good stability (facilitating storage and transportation), and long-term immune protection, making them suitable for long-term immunization of laying hens.

[0017] Preferably, in step (2), the immunization process is as follows: (1) First vaccination: Intramuscular injection of the prepared Aeromonas hydrophila inactivated vaccine into laying hens, 1 mL / hen; (2) Second immunization: 14 days after the first immunization, administer the prepared Aeromonas hydrophila inactivated vaccine via intramuscular injection, 1.5 mL / guinea. (3) Third vaccination: 14 days after the second vaccination, administer the prepared Aeromonas hydrophila inactivated vaccine intramuscularly, 1.5 mL / guinea. (4) To maintain immunity, after three immunizations, a booster vaccination should be given every 2-3 months based on the antibody titer, 1.5 mL / animal; (5) Start collecting hyperimmune eggs 10 days after maintenance immunization, with the egg yolk antibody agar amplification titer not less than 1:64.

[0018] By employing the above technical solution, the first immunization aims to initiate the initial recognition of Aeromonas vaginalis antigen by the laying hen's immune system, inducing the production of initial antibodies. The second immunization triggers a secondary immune response, rapidly increasing and maintaining a high antibody titer. The third immunization further enhances antibody titer, prolonging the duration of high antibody levels and laying the foundation for subsequent maintenance immunization. Maintenance immunization involves periodically supplementing the antigen to maintain the memory effect of the laying hen's immune system and prevent excessive decline in antibody titer. During the collection of highly immunized eggs, titer must be continuously monitored. If it falls below 1:64, collection must be suspended to assess whether a booster immunization is necessary. This ensures that the final extracted egg yolk antibody product has a high titer and strong neutralizing activity, guaranteeing its effectiveness as a biological product.

[0019] Preferably, in step (3), the modified water extraction method is used to extract egg yolk antibodies: first, water is added to prepare a disodium hydrogen phosphate solution, then the egg yolk is mixed with the disodium hydrogen phosphate solution and stirred evenly, the remaining volume of disodium hydrogen phosphate solution is added and stirred; after stirring, a settling agent is added, and after stirring evenly, citric acid solution is slowly added to adjust the pH to 6.0±0.05, and the mixture is allowed to stand at 4℃ for 10 hours. After standing, the supernatant is taken out, centrifuged, the precipitate is discarded, and the water-soluble solution is taken for later use; then, caprylic acid is used to remove lipids, the supernatant is taken, concentrated, and freeze-dried to obtain the antibody.

[0020] By employing the above technical solution, egg yolk is diluted with disodium hydrogen phosphate buffer to reduce viscosity, creating conditions for subsequent antibody dissolution and impurity separation. Pre-mixing with a portion of the solution before adding the remaining solution effectively prevents localized coagulation or clumping of the egg yolk due to sudden dilution with large amounts of water, ensuring the antibody fully dissolves in the aqueous phase. Adding a flocculant, through space occupancy or charge neutralization, efficiently promotes the flocculation of insoluble substances such as lipoproteins and other proteins, forming larger precipitate particles that are easier to remove in subsequent steps. Caprylic acid, under acidic pH conditions, selectively precipitates the vast majority of non-IgY proteins while effectively removing residual lipids and pigments. Concentration increases antibody concentration, while inactivation and sterilization ensure product biosafety, producing high-purity, high-activity, and high-safety egg yolk antibodies that meet subsequent application standards.

[0021] Preferably, the settling agent is obtained by dissolving PVP and trehalose at concentrations of 3.33 g / L and 4.16 g / L, respectively, in purified water at a volume equal to that of the original egg yolk.

[0022] By employing the above technical solution, the long molecular chains of PVP can simultaneously adsorb multiple lipoprotein particles and other protein particles, bridging them to form a larger, loose flocculent network structure. This accelerates sedimentation and more thoroughly removes a large amount of lipids, lipoproteins, and other insoluble impurities from the egg yolk, significantly improving the clarity of the subsequent supernatant and the purity of the product. Trehalose molecules maximize the protection of the biological activity of the IgY antibody, ensuring that the final egg yolk antibody is not only highly pure but also has high titer and complete function. While PVP efficiently precipitates impurities, trehalose ensures that the target IgY antibody remains intact in this relatively harsh physicochemical environment, thus achieving high activity retention with high recovery rate.

[0023] Preferred method: Caprylic acid defatting process: add caprylic acid to a final concentration of 0.15%, stir at room temperature for 30 min, let stand at 4℃ for 4-6 h, centrifuge at 5000 rpm for 20 min, and take the supernatant.

[0024] By employing the above technical solution, caprylic acid, a short-chain fatty acid, binds to impurities in proteins, disrupting their hydration membranes and exposing their hydrophobic regions, thereby causing aggregation and precipitation. Room temperature provides suitable reaction kinetics. At low temperatures (4°C), the hydrophobic interactions of proteins are enhanced, which facilitates further aggregation and growth of the precipitate, forming larger and more compact clumps. The supernatant is then collected; it contains highly purified IgY antibody, while the vast majority of impurities, lipids, and particulate matter have been removed into the precipitate, greatly improving product purity, appearance, and stability.

[0025] Preferably, the concentration process is as follows: the egg yolk liquid treated with caprylic acid is filtered through a cylindrical filter with pore sizes of 5μm and 1μm, and then concentrated by ultrafiltration through a hollow fiber ultrafiltration column with a molecular weight cutoff of 100kD.

[0026] By adopting the above technical solutions, filtration can effectively prevent the subsequent expensive hollow fiber ultrafiltration column from being blocked or contaminated, greatly extending its service life; 100kD hollow fiber ultrafiltration column concentration can remove small molecule impurities while concentrating antibodies, without the need for additional purification steps, simplifying the process flow, with high antibody recovery rate, and gentle and non-damaging.

[0027] Thirdly, this application also provides the application of the above-mentioned anti-Aeromonas guinea pig egg yolk antibody in the prevention or treatment of fish farming.

[0028] In summary, this application has the following beneficial effects: 1. In this application, Aeromonas guinea pig RDBAE-24091 is cultured and inactivated to induce the hens' immune system to produce antibodies against Aeromonas guinea pig, which are then transferred to the eggs to form hyperimmune eggs. The hyperimmune eggs are then separated and purified to remove impurities from the egg liquid, thereby obtaining the target product with high purity and high activity.

[0029] 2. In this application, the high-immunity eggs need to be surface disinfected first. After breaking the eggshell, the egg white and yolk are separated. The yolk antibody is extracted using a modified water extraction method. After extraction, anti-Aeromonas guinea pig yolk antibody is obtained.

[0030] 3. In this application, the inactivation process renders Aeromonas guinea pig in the bacterial suspension non-pathogenic, but retains its antigenic structure, ensuring that it can induce specific antibodies in laying hens, ensuring thorough inactivation and vaccine effectiveness, and preparing an inactivated vaccine. Attached Figure Description

[0031] Figure 1 This is an electrophoretic image of Aeromonas guinea pig (RDBAE-24091) 16S. Lane 1: Marker, Lane 2: Aeromonas guinea pig sample. Detailed Implementation

[0032] The present application will be further described in detail below with reference to the embodiments.

[0033] The raw materials used in the examples and comparative examples are all commercially available. Example

[0034] Example 1 1. Isolation and identification of Aeromonas guinea pig RDBAE-24091 Aeromonas caviae RDBAE-24091, accession number CGMCC No.36401, is deposited at the China General Microbiological Culture Collection Center on October 27, 2025.

[0035] Hepatopancreatic tissue samples exhibiting typical symptoms (cloudy and atrophied) were aseptically collected from a giant freshwater prawn farm in Zhaoqing, Guangdong. The samples were inoculated onto BHI agar using the streak plating method and incubated at 28°C for 18 hours. Dominant single colonies were then picked and re-streaked. After purification for 3-5 generations until morphologically uniform colonies were obtained, single colonies were picked and streaked onto BHI agar. Colonies were then picked again and subjected to 16S... rRNA gene sequencing technology was used for identification. The bacterial species was identified by amplification using universal 16S rDNA primers (primer sequences 27F: AGAGTTTGATCCTGGCTCAG, 1492R: TACGGCTACCTTGTTACGACTT, with a product size of 1500bp). After sequencing alignment, the bacterial species was identified as Aeromonas guinea pig (sequence name seq-1), and one strain was named RDBAE-24091. After identification, the bacterial culture was scraped and placed in 30% glycerol broth and stored in a refrigerator at -80°C.

[0036] BHI solid culture medium composition: 4.0 g / L bovine brain extract, 4.0 g / L bovine heart extract, 5.0 g / L peptone, 16.0 g / L casein peptone, 5.0 g / L sodium chloride, 2.0 g / L glucose, 2.5 g / L disodium hydrogen phosphate, and 13.5 g / L agar, pH 7.4 ± 0.2.

[0037] BHI agar medium composition: same as above.

[0038] The 30% glycerol broth consists of 30% (v / v) sterile glycerol + 70% (v / v) sterile BHI liquid medium.

[0039] Example 2: Preparation of Aeromonas guinea pig RDBAE-24091 inactivated vaccine Strain culture: Aeromonas guinea pig strain RDBAE-24091 was inoculated into BHI liquid medium and cultured at 37°C with shaking at 160 rpm for 18–24 h. The culture was centrifuged at 4°C and 8000 rpm for 10 min to collect bacterial cells, which were then washed and resuspended with sterile physiological saline to prepare a preliminary bacterial suspension. The concentration of the bacterial suspension was determined using the plate count method, and then precisely adjusted to a final concentration of 1 × 10⁻⁶ using sterile physiological saline. 8 CFU / mL available for use.

[0040] BHI liquid culture medium composition: 4.0 g / L bovine brain extract, 4.0 g / L bovine heart extract, 5.0 g / L peptone, 16.0 g / L casein peptone, 5.0 g / L sodium chloride, 2.0 g / L glucose, 2.5 g / L disodium hydrogen phosphate, pH 7.4 ± 0.2.

[0041] Inactivation: 1. Add formaldehyde solution to the bacterial suspension to a final concentration of 0.2% (v / v). After thorough mixing, inactivate the bacteria by shaking in a constant temperature shaker at 37°C for 48 hours. The resulting inactivated bacterial solution is used as the antigen. 2. A dual culture medium system (liquid + solid) was used: 1 mL of the inactivated bacterial suspension sample was inoculated into 10 mL of BHI liquid medium; another 100 μL of the inactivated bacterial suspension sample was evenly spread on the surface of BHI agar medium. The samples were incubated at 37℃ for 3 days. No colony growth was observed, indicating that the inactivation was successful.

[0042] Inactivated vaccine preparation: Oil phase preparation: Take 94 parts (w / w) of white oil for injection and 2 parts (w / w) of aluminum stearate, place them in an oil phase preparation vessel and heat to 80°C. Then add 6 parts (w / w) of Span-80 and heat until completely dissolved. Sterilize at 121°C for 30 minutes to obtain the oil phase. Aqueous phase preparation: Mix 96 parts (v / v) of inactivated and qualified bacterial suspension with 4 parts (v / v) of Tween-80 and stir thoroughly until completely dissolved to form the aqueous phase.

[0043] Emulsification: The sterilized oil phase and the prepared aqueous phase were emulsified at a ratio of 2:1 (v / v). First, the oil phase was placed in a high-speed shear mixer, and the motor was turned on to slowly rotate and stir at 2000 rpm. Simultaneously, the aqueous phase was slowly and uniformly added at 10000 rpm for 5 minutes, continuing the shearing and emulsification process until a homogeneous emulsion was formed. 10 mL of vaccine was added to a centrifuge tube and centrifuged at 3000 rpm for 15 minutes. No more than 0.5 mL of aqueous phase should separate out at the bottom of the tube.

[0044] Dispensing: Aseptically dispense quantitatively, seal bottle opening, and store at 2-8℃.

[0045] Example 3: Preparation of Antibody against Aeromonas vaginalis Egg Yolk Immunization program for laying hens: Immunization of laying hens with inactivated Aeromonas vaginalis vaccine: First immunization: Each chicken was injected intramuscularly with 1 mL of inactivated Aeromonas vaginalis vaccine in the breast. Second immunization: The second vaccination is given on the 14th day after the first immunization. Each chicken is injected intramuscularly with 1.5 mL of inactivated Aeromonas vulgaris vaccine in the breast. Three immunizations: The third vaccination is given 14 days after the second immunization. Each chicken is injected intramuscularly with 1.5 mL of inactivated Aeromonas vulgaris vaccine in the breast. Maintenance of immunity: After three immunizations, a booster dose of 1.5 mL is given every two months based on antibody titer.

[0046] Collection of hyperimmune eggs: Ten days after the completion of three immunizations of laying hens, samples were taken every 5 days to determine the antibody titer of Aeromonas vaginalis in hyperimmune eggs. When the egg titer was not lower than 1:64 by the agar diffusion method, the hyperimmune eggs were collected.

[0047] Egg yolk antibody preparation process: Eggshell disinfection: Immerse the high-immunity eggs in a 0.1% benzalkonium chloride solution for 15 minutes, remove and air dry, then fumigate with formaldehyde for 30 minutes. For high-immunity eggs with heavily contaminated shells, rinse them separately with disinfectant before soaking for disinfection.

[0048] Egg yolk separation: Beat the eggs by hand or machine to thoroughly remove the egg white, germinal disc and chalaza, and collect the yolk.

[0049] A modified water extraction method was used to extract antibodies from egg yolk: First, a 0.035 mol / L disodium hydrogen phosphate solution was prepared by adding 6 times the volume of water to the original egg yolk. Then, the egg yolk and the 0.035 mol / L disodium hydrogen phosphate solution were mixed at a 1:1 (v / v) ratio and stirred until homogeneous. The remaining volume of the 0.035 mol / L disodium hydrogen phosphate solution was added, and the mixture was stirred at 1000 rpm for 60 minutes. At this point, the pH of the mixture was approximately 7.5, and the color was milky yellow, turbid, and homogeneous.

[0050] After stirring, add settling agents (PVP and trehalose at 3.33 g / L and 4.16 g / L respectively, and add purified water of the same volume as the original egg yolk). After stirring evenly, slowly add citric acid solution to adjust the pH to 6.0 ± 0.05. Let it stand at 4℃ for 10 h. After standing, aspirate the supernatant and centrifuge at 10,000 rpm for 20 min. Discard the precipitate and keep the water-soluble solution for later use.

[0051] Caprylic acid defatting: Add caprylic acid to a final concentration of 0.15%, stir for 30 min at room temperature, let stand at 4℃ for 4-6 h, centrifuge at 5000 rpm for 20 min, and collect the supernatant.

[0052] Concentration: The egg yolk liquid treated with caprylic acid was sequentially filtered through tubular filter cartridges with pore sizes of 5 μm and 1 μm. The filtrate was then concentrated by ultrafiltration using a hollow fiber ultrafiltration column with a molecular weight cutoff of 100 kD to obtain a concentrated egg yolk antibody solution.

[0053] Freeze-drying: Sucrose and mannitol were added sequentially to the egg yolk antibody solution to final concentrations of 2% (w / v) and 3% (w / v), respectively, and mixed thoroughly. The mixture was pre-frozen at -80°C for 4 hours, and then freeze-dried under a vacuum of 20 Pa for 24 hours to obtain freeze-dried powder of anti-Aeromonas guinea pig egg yolk antibody.

[0054] Antibody titer determination: The agar amplification titer of the lyophilized powder of anti-Aeromonas guinea pig egg yolk antibody should not be less than 1:16.

[0055] Performance testing 1. Virulence determination of Aeromonas guinea pig RDBAE-24091 Healthy giant freshwater prawns weighing 8.03±0.22g after one week of temporary rearing were subjected to virulence testing for Aeromonas guinea pig RDBAE-24091. The giant freshwater prawns were randomly divided into 5 groups of 20 prawns each and cultured in 200L aquariums.

[0056] Strain strain RDBAE-24091 was inoculated into BHI liquid medium and incubated at 37°C for 24 hours. The bacterial concentration was adjusted to 1×10⁻⁶ using the plate count method. 8CFU / mL was prepared for later use. Four concentration gradients were then set up using 10-fold serial dilutions, with the experimental groups set at 1×10⁻⁶ CFU / mL. 3 CFU / mL, 1×10 4 CFU / mL, 1×10 5 CFU / mL and 1×10 6 Four different concentrations of CFU / mL were administered via intramuscular injection in the third abdominal segment of the guinea pig, with an injection volume of 100 μL per piglet. The control group received the same volume of PBS. Mortality was observed and recorded for 7 consecutive days post-injection challenge. The median lethal dose (LD50) of Aeromonas vaginalis was calculated using the modified Koch method. 50 =1.58×10 4 It has a high CFU / mL concentration and is highly pathogenic.

[0057] Table 1 Toxicity Tests 2. The preventive and therapeutic effects of egg yolk antibodies against Aeromonas vaginalis infection in giant freshwater prawns. Healthy giant freshwater prawns weighing 8.03±0.22g after one week of temporary rearing were randomly divided into 7 groups, with 30 prawns in each group. The specific experimental protocol is shown in Table 2. The prawns were observed continuously for 7 days, and their growth was observed and the number of dead prawns in each treatment group was recorded daily.

[0058] Table 2 Animal Experiment Protocol After seven consecutive days of observation, the results were statistically analyzed. The survival rate of both the blank control group (Group A) and the negative control group (Group B, antibody-injected only) was 100%, indicating that the egg yolk antibody itself was not toxic to giant freshwater prawns. The survival rate of the positive control group (Group C, infection only) was 0%, and the necropsy of the dead giant freshwater prawns showed typical symptoms of bacterial septicemia caused by Aeromonas vaginalis, including severe erosion and discoloration of the hepatopancreas, accompanied by whitish muscle and turbid, non-clotting hemolymph. The survival rates of the treatment group (Group D, specific IgY) and the treatment group (Group E, non-specific IgY) were 96.7% and 10%, respectively. The survival rates of the prevention group (Group F, specific IgY) and the treatment group (Group G, non-specific IgY) were 93.3% and 6.7%, respectively.

[0059] The results showed that treatment or prevention with this specific egg yolk antibody significantly improved the survival rate of giant freshwater prawns against Aeromonas guinea pig attack, reaching as high as 96.7% and 93.3%, respectively. This egg yolk antibody can effectively prevent and treat the disease caused by Aeromonas guinea pig in giant freshwater prawns.

[0060] 3. Growth performance of giant freshwater prawns after feeding on freeze-dried powder containing anti-Aeromonas guinea pig egg yolk antibody Experimental Groups Five hundred and sixty healthy juvenile giant freshwater prawns weighing (1.03±0.01) g were randomly divided into four groups: one control group and three experimental groups, with four replicates in each group. The control group was fed a basal diet, while the three experimental groups had different weight percentages of the product of this invention (i.e., freeze-dried powder of anti-Aeromonas vulgaris egg yolk antibody) added to their basal diet, namely 0.3%, 0.6%, and 1.2%, respectively. The experiment lasted for 60 days, with feeding twice daily at regular intervals. Uneaten feed was promptly collected and weighed to calculate the actual feed intake.

[0061] growth indicators At the beginning and end of the breeding process, the giant freshwater prawns in the aquarium were counted and weighed one by one, and the weight gain rate, specific growth rate, feed conversion ratio and survival rate were calculated.

[0062] Weight gain rate (WGR, %) / % = 100 × (W t -W0) / W0; Specific growth rate (SGR, % / d) = 100 × (lnW) t -lnW0) / t Feed conversion ratio (FCR) = F / (W) t -W0); Survival rate (SR, %) = T 活 / T 总 ×100; In the formula: W0 is the initial body weight, g; W t t represents final body weight (g); t represents the number of experimental days (d). F represents feed intake (feed amount - uneaten feed), in grams; T represents... 活 T represents the number of surviving tails at the end. 总 This is the initial total last digit.

[0063] Table 3. Effects of freeze-dried specific egg yolk antibody powder on growth performance of giant freshwater prawns. As shown in Table 3, adding different doses of freeze-dried anti-Aeromonas guinea pig egg yolk antibody powder to the feed has a significant effect on the growth performance of giant freshwater prawns. Specifically, it significantly promotes growth and improves feed utilization: Compared with the control group, the experimental groups with 0.6% and 1.2% of the product of this invention showed significantly increased weight gain rate (WGR) and specific growth rate (SGR) of giant freshwater prawns (P<0.05), while the feed conversion ratio (FCR) was significantly reduced (P<0.05). This may be because the egg yolk antibody (IgY) directly binds to and neutralizes Aeromonas guinea pig and its toxins in the intestine, thereby blocking its initial colonization and invasion process, improving the immune status and intestinal health of the prawns, thus reducing the energy consumption for immune stress, allowing more nutrients to be used for growth, and improving feed conversion efficiency. (2) High safety in application: Within the dosage range of 0.3% to 1.2%, the survival rate (SR) of giant freshwater prawns in each experimental group was not significantly different from that in the control group (P>0.05), indicating that the egg yolk antibody preparation of the present invention effectively promotes growth without adversely affecting the survival of the cultured organisms.

[0064] This specific embodiment is merely an explanation of this application and is not intended to limit it. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.

Claims

1. An antibody against Aeromonas vaginalis egg yolk, characterized in that, An inactivated vaccine prepared from Aeromonas guinea pig RDBAE-24091 was used to immunize laying hens, and the hyperimmune eggs were collected, isolated, and purified.

2. The method for preparing an anti-Aeromonas vaginalis egg yolk antibody according to claim 1, characterized in that, Includes the following steps: (1) Prepare an inactivated vaccine from Aeromonas guinea pig RDBAE-24091; (2) Use inactivated vaccines to immunize laying hens via intramuscular injection and collect highly immunized eggs; (3) Disinfect the high-immunity eggs, remove the egg white, collect the yolks, and extract the yolk antibodies using a modified water extraction method to obtain anti-Aeromonas guinea pig yolk antibodies.

3. The method for preparing an anti-Aeromonas vaginalis egg yolk antibody according to claim 2, characterized in that, In step (1), Aeromonas guinea pig strain RDBAE-24091 is inoculated onto BHI liquid medium to prepare a preliminary bacterial suspension, which is then inactivated to prepare an inactivated vaccine.

4. The method for preparing an anti-Aeromonas vaginalis egg yolk antibody according to claim 3, characterized in that, In step (1), the inactivated vaccine is prepared: Oil phase preparation: Take white oil for injection and aluminum stearate, place them in an oil phase preparation vessel and heat to 80°C, then add Span-80 and heat until completely dissolved. Autoclave at 121°C for 30 minutes to obtain the oil phase. Aqueous phase preparation: Mix the inactivated and qualified bacterial suspension with the solution and stir thoroughly until completely dissolved to obtain the aqueous phase; Emulsification: Emulsify the sterilized oil phase and the prepared aqueous phase at a ratio of 2:1 (v / v) until a uniform emulsion is formed. Add the vaccine to a centrifuge tube and centrifuge. The aqueous phase separated at the bottom of the tube should not exceed 0.5 mL to obtain the inactivated vaccine.

5. The method for preparing an anti-Aeromonas vaginalis egg yolk antibody according to claim 2, characterized in that, In step (2), the immunization process is as follows: (1) First vaccination: Intramuscular injection of the prepared Aeromonas hydrophila inactivated vaccine into laying hens, 1 mL / hen; (2) Second immunization: 14 days after the first immunization, administer the prepared Aeromonas hydrophila inactivated vaccine via intramuscular injection, 1.5 mL / guinea. (3) Third vaccination: 14 days after the second vaccination, administer the prepared Aeromonas hydrophila inactivated vaccine intramuscularly, 1.5 mL / guinea. (4) To maintain immunity, after three immunizations, a booster vaccination should be given every 2-3 months based on the antibody titer, 1.5 mL / animal; (5) Start collecting hyperimmune eggs 10 days after maintenance immunization, with the yolk antibody agar titer not less than 1:

64.

6. The method for preparing an anti-Aeromonas vaginalis egg yolk antibody according to claim 2, characterized in that, In step (3), the modified water extraction method is used to extract egg yolk antibodies: first, water is added to prepare a disodium hydrogen phosphate solution, then the egg yolk is mixed with the disodium hydrogen phosphate solution and stirred evenly, the remaining volume of disodium hydrogen phosphate solution is added and stirred; After stirring, add a settling agent, stir evenly, slowly add citric acid solution to adjust the pH to 6.0±0.05, let stand at 4℃ for 10 hours, after standing, take the supernatant, centrifuge, discard the precipitate, and take the water-soluble solution for later use; then remove the fat with caprylic acid, take the supernatant, concentrate, freeze dry, and obtain the final product.

7. The method for preparing an anti-Aeromonas vaginalis egg yolk antibody according to claim 6, characterized in that, The settling agent is obtained by dissolving PVP and trehalose at concentrations of 3.33 g / L and 4.16 g / L, respectively, in purified water at a volume equal to that of the original egg yolk.

8. The method for preparing an anti-Aeromonas vaginalis egg yolk antibody according to claim 6, characterized in that, Caprylic acid defatting process: Add caprylic acid to a final concentration of 0.15%, stir for 30 min at room temperature, let stand at 4℃ for 4-6 h, centrifuge at 5000 rpm for 20 min, and take the supernatant.

9. The method for preparing an anti-Aeromonas vaginalis egg yolk antibody according to claim 6, characterized in that, concentration Process: The egg yolk liquid treated with caprylic acid was filtered through a cylindrical filter with pore sizes of 5μm and 1μm, and then concentrated by ultrafiltration through a hollow fiber ultrafiltration column with a molecular weight cutoff of 100kD.

10. The application of the anti-Aeromonas vulgaris egg yolk antibody as described in claim 1 in the prevention or treatment of fish farming.

Images