ATP6V1E2 promoter and application thereof
By adjusting the nucleotide sequence of the ATP6V1E2 promoter, the problem of poor matching between existing promoters and target genes was solved, enabling precise control and improved efficiency of gene expression.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-17
- Publication Date
- 2026-03-27
AI Technical Summary
Existing promoters, when linked to target genes, exhibit inconsistent activation effects, making it difficult to adapt to the expression needs of different genes.
Provides an ATP6V1E2 promoter comprising a specific nucleotide sequence or a variant, fragment, or derivative thereof, including a variant, fragment, or derivative of the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2, which is modified by deletion, substitution, addition, and/or insertion of nucleotides to form a promoter that matches the target gene.
This technology enables the effective binding of promoters to target genes, regulates the initiation time and degree of gene expression, and improves the accuracy and efficiency of gene expression.
Smart Images

Figure CN121737140A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of protein expression, and more specifically, to the ATP6V1E2 promoter and its applications. Background Technology
[0002] The ATP6V1E2 gene, also known as MGC9341, VMA4, or ATP6E1, is located on the short arm of chromosome 2, region 21 (2p21). It encodes a protein that is part of the V-ATPase complex. V-ATPases are responsible for the transport of protons (H+) from ATP (adenosine triphosphate) within the cell, a process crucial for maintaining cellular acid-base balance.
[0003] Gene expression regulation primarily occurs at the transcriptional level, and promoters play a crucial role in this regulation. The strength of promoter activity directly affects the level of gene expression. A promoter is a DNA sequence within a gene that can bind to RNA polymerase and other trans-factors that influence transcription, enabling precise and efficient initiation of transcription. Promoters guide the correct binding of identical templates, activate RNA polymerase, and initiate gene transcription, thereby controlling the initiation time and degree of gene expression (transcription). However, current promoters exhibit different initiation effects when linked to different target genes, necessitating the development of promoters specifically adapted to the target genes. Summary of the Invention
[0004] In view of this, in order to overcome the shortcomings of the prior art, the present invention is proposed.
[0005] The first aspect of this invention provides the ATP6V1E2 promoter, said promoter comprising any of the following nucleotide sequences: (1) A nucleotide sequence as shown in SEQ ID NO:1 or SEQ ID NO:2; (2) The nucleotide sequence of a variant, homology, fragment or derivative of the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2.
[0006] In some embodiments, the nucleotide sequence of a variant, homology, fragment, or derivative of the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2 includes a nucleotide sequence formed by deleting, substituting, adding, and / or inserting one or more nucleotides into the nucleotide sequence of SEQ ID NO:1 or SEQ ID NO:2.
[0007] In some implementations, the term "one or more" used to refer to the deletion, substitution, addition, and / or insertion of nucleotides in a nucleotide sequence includes 1 to 20.
[0008] In some implementations, the term "one or more" used to refer to the deletion, substitution, addition, and / or insertion of nucleotides in a nucleotide sequence includes 1 to 10.
[0009] In some implementations, the term "one or more" used to refer to the deletion, substitution, addition, and / or insertion of nucleotides in a nucleotide sequence includes 1 to 5.
[0010] In some implementations, the term "one or more" used to refer to the deletion, substitution, addition, and / or insertion of nucleotides in a nucleotide sequence includes 1 to 3.
[0011] In some implementations, the term "one or more" used to refer to the deletion, substitution, addition, and / or insertion of nucleotides in a nucleotide sequence includes one or two.
[0012] In some embodiments, the nucleotide sequence of a variant, homology, fragment, or derivative of the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2 includes a nucleotide sequence having at least about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity with SEQ ID NO:1 or SEQ ID NO:2.
[0013] In some embodiments, the promoter further includes a nucleotide sequence complementary to a nucleotide sequence of the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2 or a variant, homology, fragment or derivative thereof.
[0014] In some embodiments, the promoter further includes a nucleotide sequence that hybridizes with a nucleotide sequence of the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2 or a variant, homology, fragment or derivative thereof.
[0015] In some embodiments, the promoter further includes a nucleotide sequence capable of hybridizing with a nucleotide sequence complement of the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2 or a variant, homology, fragment or derivative thereof.
[0016] A second aspect of the present invention provides a DNA comprising the promoter described in the first aspect of the present invention.
[0017] In some implementations, the DNA also includes a target gene linked downstream of the promoter.
[0018] A third aspect of the present invention provides a gene expression unit comprising the DNA and terminator described in the second aspect of the present invention.
[0019] In some embodiments, the gene expression unit further includes a cis-acting element that enhances the transcriptional activity of the promoter.
[0020] In some implementations, the cis-acting element includes an enhancer, a regulatory sequence, or an inducible element.
[0021] A fourth aspect of the present invention provides a vector comprising the promoter described in the first aspect of the present invention, the DNA described in the second aspect of the present invention, or the gene expression unit described in the third aspect of the present invention.
[0022] In some embodiments, restriction enzymes can be used to recognize sequences to introduce the promoter described in the first aspect of the present invention, the DNA described in the second aspect of the present invention, or the gene expression unit described in the third aspect of the present invention into a vector. For example, the vector can be cleaved with a restriction enzyme, and a DNA fragment containing the promoter described in the first aspect of the present invention, the DNA described in the second aspect of the present invention, or the gene expression unit described in the third aspect of the present invention and having a restriction enzyme cleaving sequence at its end can be added therein. Ligation with a ligase then allows the introduction of the promoter described in the first aspect of the present invention, the DNA described in the second aspect of the present invention, or the gene expression unit described in the third aspect of the present invention into the vector.
[0023] A fifth aspect of the present invention provides a cell comprising the promoter described in the first aspect of the present invention, the DNA described in the second aspect of the present invention, the gene expression unit described in the third aspect of the present invention, or the vector described in the fourth aspect of the present invention.
[0024] A sixth aspect of the present invention provides a method for selecting cells expressing heterologous polypeptides, the method comprising transfecting cells with a nucleic acid comprising the promoter described in the first aspect of the present invention, and selecting the transfected cells under selective culture conditions.
[0025] The seventh aspect of the present invention provides the application of the promoter described in the first aspect of the present invention in peptide expression.
[0026] The eighth aspect of the present invention provides a method for expressing a polypeptide, the method comprising culturing cells transfected with nucleic acids containing the promoter and polypeptide described in the first aspect of the present invention, and collecting the polypeptide from the resulting culture.
[0027] In some implementations, the aforementioned peptides can be purified using conventional protein purification methods. Purification methods include, but are not limited to, salting out, ion exchange chromatography, hydrophobic chromatography, affinity chromatography, or gel filtration chromatography.
[0028] The ninth aspect of the present invention provides a kit comprising the promoter described in the first aspect of the present invention, the DNA described in the second aspect of the present invention, the gene expression unit described in the third aspect of the present invention, the vector described in the fourth aspect of the present invention, or the cell described in the fifth aspect of the present invention.
[0029] The advantages and beneficial effects of this invention are as follows: This invention provides the ATP6V1E2 promoter and its applications. This invention experimentally verifies that promoters with nucleotide sequences such as SEQ ID NO:1 or SEQ ID NO:2 can effectively initiate gene expression. Attached Figure Description
[0030] Figure 1 This is a peak diagram of CHIP-seq data from the H3K4me3 antibody upstream of the ATP6V1E2 gene; Figure 2 This is a peak diagram of CHIP-seq data from the H3K27ac antibody upstream of the ATP6V1E2 gene; Figure 3 It is a carrier plasmid structure; Figure 4 This is the result of P0-FL adhesive recovery; Figure 5 This is the result of P0-core adhesive recycling; Figure 6 This is the result of P0-Δ1 adhesive recovery; Figure 7 These are the results of P0-FL colony screening; Figure 8 This is the result of P0-core colony screening; Figure 9 This is the result of P0-Δ1 colony screening; Figure 10 These are the results of promoter activity detection. ***p<0.001, **p<0.01, *p<0.05, and ns showed no statistical significance. Detailed Implementation
[0031] The present invention will be further described below with reference to embodiments. The following description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any other way. Any person skilled in the art may make equivalent modifications to the disclosed technical content to create equivalent embodiments. Any simple modifications or equivalent changes made to the following embodiments based on the technical essence of the present invention without departing from the scope of the invention are all within the protection scope of the present invention.
[0032] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0033] The first aspect of this invention provides the ATP6V1E2 promoter.
[0034] Promoter: A promoter is a DNA sequence that RNA polymerase recognizes, binds to, and initiates transcription. It contains conserved sequences required for RNA polymerase-specific binding and transcription initiation; the promoter itself is not transcribed. The DNA sequence transcribed in the promoter gene or operon determines the precise initiation of transcription and is related to transcription efficiency.
[0035] In some embodiments, the promoter may also include a region necessary for controlling expression binding to proteins other than RNA polymerase.
[0036] In this invention, there are no particular limitations on the method of obtaining the promoter; it can be obtained through conventional chemical synthesis or genetic engineering methods.
[0037] In some embodiments, the promoter of the present invention can be manufactured by introducing mutations into the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2 of the present invention.
[0038] In this invention, mutation refers to a change in the nucleotide sequence, including deletion, substitution, addition, and / or insertion of nucleotide sequences.
[0039] In some implementations, the methods for introducing mutations include, but are not limited to, ultraviolet irradiation or site-specific mutation introduction.
[0040] In some implementations, the methods for introducing site-specific mutations include, but are not limited to, overlap extension PCR, ODA, and Kunkel methods.
[0041] In some implementations, mutations can also be performed using commercially available site-specific mutation introduction kits such as the Site-Directed Mutagenesis System Mutan-SuperExpress Km kit, the Transformer™ Site-Directed Mutagenesis kit, and the KOD-Plus-Mutagenesis kit.
[0042] A second aspect of the present invention provides a DNA.
[0043] Target gene: In some embodiments, the target gene is not particularly limited. The target gene is a gene encoding a target substance and / or an enzyme related to its synthesis. The target gene can be a xenogeneic gene encoding a heterogeneous expression product, a gene of the same species introduced from an external source, a gene encoding an expression product already present in the host cell, or a gene encoding any other protein, peptide, nucleic acid, etc.
[0044] In some implementation schemes, examples of target substances encoded by the target gene include enzymes, hormones, cytokines, other physiologically active peptides, transport proteins, non-coding RNA, and selective markers.
[0045] In some implementations, examples of enzymes include oxidoreductases, transferases, hydrolases, lyases, isomerases, synthases, enzymes of the glycolytic system, enzymes of the pentose phosphate cycle, enzymes of the TCA cycle, and enzymes involved in the synthesis of aromatic compounds.
[0046] In some embodiments, the target gene includes nucleic acids encoding proteins, nucleic acids encoding antisense RNA, nucleic acids encoding enzymes, and / or nucleic acids encoding selective markers.
[0047] In some implementations, the target gene is selected from nucleic acids that encode proteins.
[0048] In some implementations, the target gene is a nucleic acid encoding ATP6V1E2.
[0049] In some implementations, the target gene is derived from, but is not limited to, microorganisms (e.g., bacteria, yeast, actinomycetes, filamentous fungi, ascomycetes, or basidiomycetes), plants, insects, and animals.
[0050] In some implementations, the target gene may also include artificially synthesized genes.
[0051] A fourth aspect of the present invention provides a carrier.
[0052] Carrier: In some embodiments, plasmid vectors, phage vectors, or viral vectors, or vector fragments constituting part of said vectors, may be used as the vectors of the present invention. The vector or vector fragment may be appropriately selected depending on the host cell to be used.
[0053] In some implementation schemes, there are no particular restrictions on the source of the host cell.
[0054] In some implementations, Gram-positive or Gram-negative bacteria can be used as host cells.
[0055] In some implementations, Gram-positive bacteria include, but are not limited to, Bacillus subtilis, Bacillus stearothermophilus, Bacillus licheniformis, Bacillus brevis, or unnamed Bacillus species.
[0056] In some implementations, Gram-negative bacteria include, but are not limited to, Escherichia coli.
[0057] In some implementations, the Escherichia coli strains include, but are not limited to, HB101, C600, JM109, DH5α, DH10B, XL-1BlueMRF', or TOP10F.
[0058] In some implementations, if a Bacillus species is used as the host, the plasmid vector may include, but is not limited to, pHY, pUB110, or pE194.
[0059] In some implementations, if a Bacillus species is used as the host, the phage vector may include, but is not limited to, 105 or SPβ.
[0060] In some implementations, if Escherichia coli is used as the host, the plasmid vector may include, but is not limited to, pUC18, pUC19, pBluescript, pET, or pGL3.
[0061] In some implementations, if Escherichia coli is used as the host, the phage vector may be, but is not limited to, λ phage vectors (e.g., λgt10, λgt11).
[0062] In some implementations, the expression vector can be introduced into host cells using spontaneous competent cells, calcium phosphate, electroporation, DEAE-dextran, or liposomes.
[0063] In some implementations, the host cell is selected from Escherichia coli.
[0064] In some implementations, the *Escherichia coli* is selected from DH5α.
[0065] In some embodiments, the vector is selected from plasmid vectors.
[0066] In some embodiments, the plasmid vector is selected from pGL3.
[0067] The fifth aspect of the present invention provides a cell.
[0068] In some implementations, the cells include eukaryotic cells and prokaryotic cells.
[0069] In some implementations, the eukaryotic cells include mammalian cells, insect cells, plant cells, and yeast cells.
[0070] In some embodiments, the mammalian cells include, but are not limited to, CHO cells, HEK cells, BHK cells, or Sp2 / O cells.
[0071] In some embodiments, the mammalian cells are selected from CHO cells and HEK cells.
[0072] In some implementations, the HEK cells include, but are not limited to, 293T cells and 293F cells.
[0073] In some embodiments, the HEK cells are selected from 293T cells.
[0074] In some implementations, prokaryotic cells include, but are not limited to, Gram-positive or Gram-negative bacteria.
[0075] In some implementations, Gram-positive bacteria include, but are not limited to, Bacillus subtilis, Bacillus stearothermophilus, Bacillus licheniformis, Bacillus brevis, or unnamed Bacillus species.
[0076] In some implementations, Gram-negative bacteria include, but are not limited to, Escherichia coli.
[0077] In some implementations, the Escherichia coli strains include, but are not limited to, HB101, C600, JM109, DH5α, DH10B, XL-1BlueMRF', or TOP10F.
[0078] In some embodiments, the Escherichia coli strain is selected from DH5α.
[0079] In some implementations, the vector or vector fragment may be appropriately selected depending on the cells to be used.
[0080] In some implementations, the carrier or carrier fragment may be appropriately selected in the manner described in the fourth aspect of the invention.
[0081] In some embodiments, the host cell is selected from Escherichia coli, the Escherichia coli is selected from DH5α, and the vector is selected from plasmid vectors.
[0082] The sixth aspect of the present invention provides a method for selecting cells that express heterologous polypeptides.
[0083] In this invention, a "polypeptide" is a polymer of amino acid residues linked by peptide bonds, which may be naturally occurring or synthetic. Polypeptides with fewer than about 20 amino acid residues may be called "peptides". Polypeptides containing two or more amino acid chains or amino acid chains with a length of 100 or more amino acids may be called "proteins". Polypeptides or proteins may also contain non-peptide components, such as glycosides or metal ions.
[0084] In some implementations, the nucleic acid comprises: a) The first expression cassette encoding a heterologous polypeptide nucleic acid; b) A second expression cassette comprising the promoter and the second nucleic acid as described in the first aspect of the present invention.
[0085] In some implementations, the second nucleic acid described in b) may also be absent, i.e., the nucleic acid comprises a nucleic acid encoding a heterologous polypeptide and the promoter described in the first aspect of the present invention.
[0086] In this invention, "heterologous polypeptide nucleic acid" or "heterologous polypeptide" refers to a nucleic acid molecule or polypeptide or group of nucleic acid molecules or polypeptides that is not naturally present in a given host cell. In this invention, "heterologous" includes any of the following: nucleic acids not derived from host cells (i.e., exogenous nucleic acids); or a combination of host cell-derived nucleic acids and exogenous nucleic acids.
[0087] In some implementations, the promoter described in the first aspect of the invention is effectively linked to a second nucleic acid.
[0088] In this invention, "expression cassette" refers to nucleic acid containing the elements required for the expression and secretion of structural genes present in at least the host cell. "Structural gene" refers to a gene region that does not contain a signal sequence, i.e., a coding region.
[0089] In this invention, "effective ligation" refers to the juxtaposition of two or more components. The DNA sequences of effective ligation may be adjacent or non-adjacent. The promoter of effective ligation is usually located upstream of the coding sequence, but the promoter may not be adjacent to the coding sequence.
[0090] In some implementations, the second nucleic acid encodes a selective marker.
[0091] In this invention, "selective marker" refers to a marker that allows for the specific selection or non-selection of nucleic acids from cells carrying a particular nucleic acid in the presence of a corresponding "selector". The selective marker allows for the selection of cells transformed with the selective marker in the presence of the corresponding selector. Selective markers can be positive, negative, or bifunctional. Positive selective markers allow for the selection of cells carrying the marker, while negative selective markers allow for the specific exclusion of cells carrying the marker. Selective markers include, but are not limited to, aminoglycoside phosphotransferases, such as hygromycin phosphotransferase, neomycin phosphotransferase, dihydrofolate reductase, thymidine kinase, glutamine synthase, asparagine synthase, tryptophan synthase, histidine dehydrogenase, or genes providing resistance to puromycin, bleomycin, fulvicin, or chloramphenicol, or include fluorescent proteins or luciferases.
[0092] In some embodiments, the fluorescent protein includes green fluorescent protein, red fluorescent protein, yellow fluorescent protein, and orange fluorescent protein.
[0093] In some embodiments, the selective labeling is selected from luciferase.
[0094] In some implementations, the selection method includes flow cytometry, ELISA, immunoprecipitation, immunoaffinity column chromatography, magnetic bead immunoaffinity sorting, microscopy-based separation methods, or immunobinding-based methods.
[0095] In some implementations, the cells include eukaryotic cells and prokaryotic cells.
[0096] In some implementations, the eukaryotic cells include mammalian cells, insect cells, plant cells, and yeast cells.
[0097] In some embodiments, the mammalian cells include CHO cells, HEK cells, BHK cells, or Sp2 / O cells.
[0098] In some embodiments, the mammalian cells are selected from CHO cells and HEK cells.
[0099] In some implementations, the HEK cells include 293T cells and 293F cells.
[0100] In some embodiments, the HEK cells are selected from 293T cells.
[0101] The ninth aspect of the present invention provides a reagent kit.
[0102] In this invention, the kit also includes other substances required for the promoter to initiate transcription or translation.
[0103] In some implementations, the kit includes at least one reactant for transcription or translation, dNTPs, buffer solutions, ribonucleotides, and amino acids.
[0104] In some embodiments, the kit also includes cell culture medium.
[0105] In some implementations, the kit also includes instructions.
[0106] Example 1: CHIP-seq Experiment 1. Experimental Methods (1) When HEK293T cells grow to 70%-90%, remove the culture medium, add an appropriate amount of trypsin to digest the cells, add culture medium containing serum to resuspend the cells, and transfer them to 15ml EP tubes.
[0107] (2) Centrifuge at 500×g at room temperature for 3 min, discard the supernatant, recover the cells, and resuspend the cells in 10ml of PBS at room temperature.
[0108] (3) Add 280 μl of 37% formaldehyde and gently invert the container 10 times. Crosslink at room temperature for 10 min (at 2.5 min, 5 min and 7.5 min respectively, gently invert the container 10 times).
[0109] (4) Add 560 μl of 2.5 M glycine and mix well. Stop cross-linking at room temperature for 5 min.
[0110] (5) Centrifuge at 1000×g for 5 min, discard the supernatant, recover the cells, and resuspend the cells in 5 ml of pre-cooled PBS.
[0111] (6) Centrifuge at 1000×g at 4℃ for 5 min, discard the supernatant and recover the cells.
[0112] (7) After the cross-linked sample was ground with liquid nitrogen, 1 ml of cell lysis buffer (Cell lysis buffer: 10 mM Tris, 10 mM NaCl, 0.2% NP-40 [pH 8.0], 1X protease inhibitors) was added, and the cell nuclei were extracted by centrifugation at 4°C.
[0113] (8) Add 200 μl of 1% SDS solution containing protease inhibitors. Resuspend the cell nuclei by pipetting and incubate on ice for 10 min.
[0114] (9) DNA is broken by ultrasound (8 pulses, 60 seconds on 120 seconds off), breaking the DNA into 200-1500bp.
[0115] (10) Centrifuge at 4℃ and 13000rpm for 10min, transfer the supernatant to a new 2ml centrifuge tube and discard the precipitate.
[0116] (11) Dilute the supernatant after sonication to 10X ChIP diluent (20 mM Tris, 150 mM NaCl, 2 mM EDTA, 0.01% SDS, 1% Triton X-100, 1X protease inhibitors). Add 1.8 ml of ChIP diluent to 200 μl of supernatant, and bring the final volume to 2 ml.
[0117] (12) To remove nonspecificity, add 75 μl of Salmon Sperm DNA / Protein A Agarose-50% Slurry and incubate at 4°C for 60 min.
[0118] (13) Centrifuge at 1000 rpm for 3 min to precipitate Salmon Sperm DNA / Protein A Agarose-50% Slurry and collect the supernatant.
[0119] (14) Add 10 μg of antibody to the supernatant and mix at 4°C overnight.
[0120] (15) Add 60 μl of Salmon Sperm DNA / Protein A Agarose-50% Slurry to precipitate the antibody / antigen complex and rotate at 4°C for 60 min.
[0121] (16) Centrifuge at 4℃ and 1000rpm for 3min to collect the sediment, remove the supernatant, and start the elution process.
[0122] (17) Low-salt immune complex eluent (20 mM Tris, 150 mM NaCl, 2 mM EDTA, 0.1% SDS, 1% Triton X-100 [pH 8.1]), rotate for 5 min, centrifuge at 1000 rpm for 3 min to collect the precipitate.
[0123] (18) High-salt immune complex eluent (20 mM Tris, 500 mM NaCl, 2 mM EDTA, 0.1% SDS, 1% Triton X-100 [pH 8.1]), rotate for 5 min, centrifuge at 1000 rpm for 3 min to collect the precipitate.
[0124] (19) Eluent for Licl immune complexes (10 mM Tris, 0.25 M LiCl, 1 mM EDTA, 1% NP-40 [pH 8.1]), rotate for 5 min, centrifuge at 1000 rpm for 3 min to collect the precipitate.
[0125] (20) TE Buffer, rotate for 5 min, centrifuge at 1000 rpm for 3 min to collect the precipitate, repeat twice.
[0126] (21) The protein A / antibody / histone / DNA complex is now obtained. Prepare a fresh elution buffer (1% SDS, 0.1M NaHCO3). Add 250 μl of elution buffer to the precipitate, mix well, and rotate at room temperature for 15 min. Centrifuge at 1000 rpm for 3 min, transfer the supernatant to a new centrifuge tube, and repeat the above process. The final supernatant volume is approximately 500 μl.
[0127] (22) Add 20 μl of 5M sodium chloride to de-crosslink and incubate overnight at 65°C.
[0128] (23) Add 10 µl of 0.5 M EDTA, 20 µl of 1 M Tris-HCl, pH 6.5 and 2 µl of 10 mg / mL Proteinase K to the liquid. Rotate at 55 °C for 4 hours.
[0129] (24) Add an equal volume of phenol / chloroform to extract DNA, centrifuge at 14000g for 10min, collect the supernatant, and do not aspirate the filamentous protein.
[0130] (25) Add 2.5 times pure ethanol and 1 / 10 volume of sodium acetate to precipitate DNA. Centrifuge at 14000g for 10min, collect the precipitate, wash with 80% alcohol, and air dry.
[0131] (26) Dissolve in 50 μl of TE buffer.
[0132] (27) Sequencing was performed using an Illumina NovaSeq 6000 gene sequencer.
[0133] 2. Experimental Results (1) The sequencing results are analyzed as follows: the site information is marked with reference to GRCh38.p14.
[0134] a. Bioinformatics analysis results of CHIP-seq detection data show that ( Figure 1 Under hypoxic conditions, wild-type 293T cells showed significant enrichment of H3K4me3 epigenetic modification signals upstream of the ATP6V1E2 gene. Functional annotation results showed that this region is the promoter region (P0-FL) of the ATP6V1E2 gene, with a specific chromosomal location of chr2:46541565-46542413.
[0135] P0-FL:chr2:46541565-46542413 P0-core: chr2:46542026-46542413 P0-Δ1: chr2:46541565-46542025.
[0136] b. Bioinformatics analysis results of CHIP-seq detection data show that ( Figure 2 Under hypoxic and normoxic conditions, wild-type 293T cells showed significant enrichment of H3K27ac epigenetic modification signals upstream of the ATP6V1E2 gene. Functional annotation results showed that this region is the promoter region (P0) of the ATP6V1E2 gene, with a specific chromosomal location of chr2:46541565-46542413.
[0137] Example 2: Activity Verification Experimental Procedure: I. Experimental Methods 1. Constructing a recombinant plasmid for the luciferase reporter gene: a. Gene sequences were fused and cloned into the vector pGL3-Basic using primer synthesis and PCR methods to synthesize the ATP6V1E2-P0-F, P0-core, and P0-Δ1 sequences (Beijing Qingke Biotechnology Co., Ltd.).
[0138] The specific sequence position information is as follows: P0-FL:chr2:46541566-46542413 SEQ ID NO:1: gtctcagttttcttccctacaacctaagggtgatggtccagttgacctccgcgctgcctctcaatgctgcatttttctaacgctgtgaatcGATGAAAGGAAGCGATTACCTCTAGTCAGCAAGTTGAGGGGAGGGGTGCGGTGTCAGCGCAGAGTGCACCCCCGCCCCAATGCCCAGTGTTCAATGCTGCATTCTTGGCCAGTGAACAGGACCTGGCCAGATGGGTGTGTTCCGGCATCGCCAGGCAGAGGGGCAGGGGTTGCCGCCTCGAGCACAGGCCAAGTTTCAGAGCACTAGTGTGTATCAGTTCTCCGGGATTACAACGGAATACCTTTGAGGAACATTGGGGACCGAAAGGCGACCTCGGAGAATGTGGCCTCCAGGGGGAGCCCAGGTACATTTGCCGGGTCCGGAGCCGACGGGGTATCCTTTTTCTGGCTGGTGTGTGTGTGGAGGGGCGTGCTTCAGTGGTTCAACACGCTGTATCTCCCTTAGTTACCGGTTTCATAGTAAATGATTAAAGCTCGTGCTACGGAAGGCGTGGGGTGGTGGTGGTGGGGGGGACCACGCAATAAGCCAGGGTTCCTGCTTTCCAGCTCAAGGACCGCCACCACCCCACGCGCCTTAAAtttttttttttttttttttACCCTTTTGGTCTCTCCTCCTTGATTTCTAGTTCCGTTGTGCACTTAGAGGCCGAGAGGATGGCTCTGGCCTTCCGGGTGGAGGTGAAATATGCATGTATAATTTGGCATGACTATTGCGTCATCGTGGAGGTCGTCGTGGTTCCCCGAGAGGCCTCCACGTCTTCTCCCAGCATCGGGGCCTTTGGACGCTTCCGGGC P0-core :chr2:46542027-46542413 SEQ ID NO:2: TGCTTCAGTGGTTCAACACGCTGTATCTCCCTTAGTTACCGGTTTCATAGTAAATGATTAAAGCTCGTGCTACGGAAGGCGTGGGGTGGTGGTGGTGGGGGGGACCACGCAATAAGCCAGGGTTCCTGCTTTCCAGCTCAAGGACCGCCACCACCCCACGCGCCTTAAAtttttttttttttttttttACCCTTTTGGTCTCTCCTCCTTGATTTCTAGTTCCGTTGTGCACTTAGAGGCCGAGAGGATGGCTCTGGCCTTCCGGGTGGAGGTGAAATATGCATGTATAATTTGGCATGACTATTGCGTCATCGTGGAGGTCGTCGTGGTTCCCCGAGAGGCCTCCACGTCTTCTCCCAGCATCGGGGCCTTTGGACGCTTCCGGGC P0-Δ1: chr2:46541566-46542025 SEQ ID NO:3: gtctcagttttcttccctacaacctaagggtgatggtccagttgacctccgcgctgcctctcaatgctgcatttttctaacgctgtgaatcGATGAAAGGAAGCGATTACCTCTAGTCAGCAAGTTGAGGGGAGGGGTGCGGTGTCAGCGCAGAGTGCACCCCCGCCCCAATGCCCAGTGTTCAATGCTGCATTCTTGGCCAGTGAACAGGACCTGGCCAGATGGGTGTGTTCCGGCATCGCCAGGCAGAGGGGCAGGGGTTGCCGCCTCGAGCACAGGCCAAGTTTCAGAGCACTAGTGTGTATCAGTTCTCCGGGATTACAACGGAATACCTTTGAGGAACATTGGGGACCGAAAGGCGACCTCGGAGAATGTGGCCTCCAGGGGGAGCCCAGGTACATTTGCCGGGTCCGGAGCCGACGGGGTATCCTTTTTCTGGCTGGTGTGTGTGTGGAGGGGC 1.1 Primer synthesis Synthesize the following 18 primers according to the P0-FL sequence: SEQ ID NO:4:NJ0288256-1_1 GGTGCCAGAACATTTCTCTATCGATAGGTACCGTCTCAGTTTTCTTCCCTACAACCTAAGGGTGATG SEQ ID NO:5:NJ0288256-1_2 TTCACAGCGTTAGAAAAATGCAGCATTGAGAGGCAGCGCGGAGGTCAACTGGACCATCACCCTTAGGTT SEQ ID NO:6:NJ0288256-1_3 TTCTAACGCTGTGAATCGATGAAAGGAAGCGATTACCTCTAGTCAGCAAGTTGAGGGGA SEQ ID NO:7:NJ0288256-1_4 ACACTGGGCATTGGGGCGGGGGTGCACTCTGCGCTGACACCGCACCCCTCCCCTCAACTTGCT SEQ ID NO:8:NJ0288256-1_5 CCCAATGCCCAGTGTTCAATGCTGCATTCTTGGCCAGTGAACAGGACCTGGCCAGATGGGTGTGTTCC SEQ ID NO:9:NJ0288256-1_6 ACTTGGCCTGTGCTCGAGGCGGCAACCCCTGCCCCTCTGCCTGGCGATGCCGGAACACACCCATCT SEQ ID NO:10:NJ0288256-1_7 GAGCACAGGCCAAGTTTCAGAGCACTAGTGTGTATCAGTTCTCCGGGATTACAACGGAATA SEQ ID NO:11:NJ0288256-1_8 AGGCCACATTCTCCGAGGTCGCCTTTCGGTCCCCAATGTTCCTCAAAGGTATTCCGTTGTAATCC SEQ ID NO:12:NJ0288256-1_9 CGGAGAATGTGGCCTCCAGGGGGAGCCCAGGTACATTTGCCGGGTCCGGAGCCGACGGGGTATCCTTTTT SEQ ID NO:13:NJ0288256-1_10 GTTGAACCACTGAAGCACGCCCCTCCACACACACACCAGCCAGAAAAAGGATACCCCGT SEQ ID NO:14:NJ0288256-1_11 CTTCAGTGGTTCAACACGCTGTATCTCCCTTAGTTACCGGTTTCATAGTAAATGATTAAAGCTCGTGCTA SEQ ID NO:15:NJ0288256-1_12 TTATTGCGTGGTCCCCCCCACCACCACCACCCCACGCCTTCCGTAGCACGAGCTTTAAT SEQ ID NO:16:NJ0288256-1_13 GGGACCACGCAATAAGCCAGGGTTCCTGCTTTCCAGCTCAAGGACCGCCAC SEQ ID NO:17:NJ0288256-1_14 GGAGAGACCAAAAGGGTAAAAAAAAAAAAAAAAAAATTTAAGGCGCGTGGGGTGGTGGCGGTCCTTGAG SEQ ID NO:18:NJ0288256-1_15 CCTTTTGGTCTCTCCTCCTTGATTTCTAGTTCCGTTGTGCACTTAGAGGCCGAGAGGATGGCTCTGG SEQ ID NO:19:NJ0288256-1_16 TGACGCAATAGTCATGCCAAATTATACATGCATATTTCACCTCCACCCGGAAGGCCAGAGCCATCCTCT SEQ ID NO:20:NJ0288256-1_17 ATGACTATTGCGTCATCGTGGAGGTCGTCGTGGTTCCCCGAGAGGCCTCCACGTCTTCTCCCAGCATCGG SEQ ID NO:21: NJ0288256-1_18 TTTACCAACAGTACCGGAATGCCAAGCTTGCCCGGAAGCGTCCAAAGGCCCCGATGCTGGGAGAAG。
[0139] Synthesize the following 10 primers according to the P0-Δ1 sequence: SEQ ID NO:22: NJ0288256-3_1 GGTGCCAGAACATTTCTCTATCGATAGGTACCGTCTCAGTTTTCTTCCCTACAACCTAAGGGTGATG SEQ ID NO:23: NJ0288256-3_2 TTCACAGCGTTAGAAAAATGCAGCATTGAGAGGCAGCGCGGAGGTCAACTGGACCATCACCCTTAGGTT SEQ ID NO:24: NJ0288256-3_3 TTCTAACGCTGTGAATCGATGAAAGGAAGCGATTACCTCTAGTCAGCAAGTTGAG SEQ ID NO:25: NJ0288256-3_4 ACACTGGGCATTGGGGCGGGGGTGCACTCTGCGCTGACACCGCACCCCTCCCCTCAACTTGCTGACT SEQ ID NO:26: NJ0288256-3_5 CCCAATGCCCAGTGTTCAATGCTGCATTCTTGGCCAGTGAACAGGACCTGGCCAGATGGGTGTGTTCCG SEQ ID NO:27: NJ0288256-3_6 ACTTGGCCTGTGCTCGAGGCGGCAACCCCTGCCCCTCTGCCTGGCGATGCCGGAACACACCCATCT SEQ ID NO:28: NJ0288256-3_7 GAGCACAGGCCAAGTTTCAGAGCACTAGTGTGTATCAGTTCTCCGGGATTACAACGGAATA SEQ ID NO:29:NJ0288256-3_8 GGCCACATTCTCCGAGGTCGCCTTTCGGTCCCCAATGTTCCTCAAAGGTATTCCGTTGTAATCC SEQ ID NO:30:NJ0288256-3_9 TCGGAGAATGTGGCCTCCAGGGGGAGCCCAGGTACATTTGCCGGGTCCGGAGCCGACGGGGTATCCTTTT SEQ ID NO:31:NJ0288256-3_10 TTTACCAACAGTACCGGAATGCCAAGCTTGCCCCTCCACACACACACCAGCCAGAAAAAGGATACCCCGT。
[0140] Synthesize the following 10 primers according to the P0-core sequence: SEQ ID NO:32:NJ0288256-2_1 GGTGCCAGAACATTTCTCTATCGATAGGTACCTGCTTCAGTGGTTCAACACGCTGTATCTCCCTTAGTTA SEQ ID NO:33:NJ0288256-2_2 TAGCACGAGCTTTAATCATTTACTATGAAACCGGTAACTAAGGGAGATAC SEQ ID NO:34:NJ0288256-2_3 TTAAAGCTCGTGCTACGGAAGGCGTGGGGTGGTGGTGGTGGGGGGGACCACGCAATAA SEQ ID NO:35:NJ0288256-2_4 GTGGCGGTCCTTGAGCTGGAAAGCAGGAACCCTGGCTTATTGCGTGGTCCC SEQ ID NO:36:NJ0288256-2_5 CTCAAGGACCGCCACCACCCCACGCGCCTTAAATTTTTTTTTTTTTTTTTTTACCCTTTTGGTCTCTCCT SEQ ID NO:37:NJ0288256-2_6 GGCCTCTAAGTGCACAACGGAACTAGAAATCAAGGAGGAGAGACCAAAAG SEQ ID NO:38:NJ0288256-2_7 GTGCACTTAGAGGCCGAGAGGATGGCTCTGGCCTTCCGGGTGGAGGTGAAATATGCATGT SEQ ID NO:39:NJ0288256-2_8 ACCTCCACGATGACGCAATAGTCATGCCAAATTATACATGCATATTTCAC SEQ ID NO:40:NJ0288256-2_9 CGTCATCGTGGAGGTCGTCGTGGTTCCCCGAGAGGCCTCCACGTCTTCTCCCAGCATC SEQ ID NO:41:NJ0288256-2_10 TTTACCAACAGTACCGGAATGCCAAGCTTGCCCGGAAGCGTCCAAAGGCCCCGATGCTGGGAGAAGA.
[0141] plasmid structure such as Figure 3 As shown.
[0142] 1.2 PCR to obtain the target sequence for cloning Full-length PCR, one round: reaction system is shown in Table 1, reaction conditions are shown in Table 2.
[0143] Table 1 Reaction System
[0144] Table 2 Reaction conditions
[0145] Full-length PCR, second round: reaction system is shown in Table 3, reaction conditions are shown in Table 4.
[0146] Table 3 Reaction System
[0147] Table 4 Reaction conditions
[0148] P0-core PCR, first round: reaction system is shown in Table 5, reaction conditions are shown in Table 6.
[0149] Table 5 Reaction System
[0150] Table 6 Reaction conditions
[0151] P0-core PCR second round: The reaction system is shown in Table 7, and the reaction conditions are shown in Table 8.
[0152] Table 7 Reaction System
[0153] Table 8 Reaction Conditions
[0154] P0-Δ1PCR Round 1: The reaction system is shown in Table 9, and the reaction conditions are shown in Table 10.
[0155] Table 9 Reaction System
[0156] Table 10 Reaction Conditions
[0157] P0-Δ1PCR second round: The reaction system is shown in Table 11, and the reaction conditions are shown in Table 12.
[0158] Table 11 Reaction System
[0159] Table 12 Reaction Conditions
[0160] The PCR products from the above steps were recovered by gel extraction, and the gel extraction results are as follows: Figure 4 , Figure 5 , Figure 6 As shown.
[0161] 1.3 Recombination and Ligation Experiment During PCR, the pGL3-Basic plasmid was treated with MLUI-KPNI and then recovered via gel extraction.
[0162] The recombination reaction system is shown in Table 13: Table 13 Recombination Reaction System
[0163] Incubate in a 50℃ water bath for 25 minutes, then let it stand for 2-3 minutes to allow the temperature to drop before performing transformation and bacterial culture plating experiments. Incubate overnight at 37℃.
[0164] 1.4 Colony Screening Experiment a. Pick a single colony from the overnight plate; b. Perform colony PCR using primers 20240417-TY002-H04 / 20240416-TY001-A09; c. Identify positive clones by electrophoresis; d. Randomly select 4 positive bacteria and incubate them overnight in a 4ml single tube at 37°C on a shaker.
[0165] SEQ ID NO.42: 20240417-TY002-H04AAGGTACGGGAGGTACTTGGAGC SEQ ID NO.43: 20240416-TY001-A09CACCTCGATATGTGCATCTG Colony screening results are shown in Figure 7 , Figure 8 , Figure 9 .
[0166] 1.5 Detection of P0 promoter activity a. HEK293T cells were cultured in DMEM (Gibco, C11995500BT) containing 10% FBS (Gibco, 10091148) and 1% GlutaMAX (Gibco, 35050061). The cells were seeded into 24-well plates one day before transfection, with 8 x 10^5 cells per well.
[0167] b. On the second day, cell confluence reached 70%. The negative control PGL3-basic vector plasmid, the positive control PGL3-promoter vector plasmid, and the recombinant plasmids PGL3-P0-FL, PGL3-P0-Δ1, and PGL3-P0-core were transfected into the cells, with the internal control PRL-TK plasmid added to each well. Transfection method: The plasmid and Lipofectamine 2000 (Invitrogen, 11668019) were diluted separately using opti-MEM (Gibco, 31985062) medium at a ratio of 1 μg: 2.5 μl. After the Lipofectamine 2000 diluted with opti-MEM was incubated at room temperature for 5 minutes, DNA dilution buffer was added, and the mixture was gently mixed to obtain the transfection solution.
[0168] c. After the transfection solution has been left at room temperature for 20 minutes, add the cultured cells and culture the cells in a 37°C, 5% CO2 cell culture incubator for 6 hours. Then replace the culture medium with complete culture medium and continue culturing.
[0169] d. 24 hours after transfection, add 80 μL of 1X passive lysis buffer (Promega, E194A) to each well and lyse the cells at room temperature for 30 minutes. e. Add 50 μL of cell lysis buffer to a 96-well white plate (Corning, 3917), and perform the assay using the Dual-Glo® Luciferase Assay System (Promega, E2920) and a multi-functional microplate reader (MD, M5) following the procedure shown in the diagram below.
[0170] One-way ANOVA multiple comparisons (ns, not significant, **p<0.01, ****p<0.0001, ***p<0.001).
[0171] 2. Experimental Results Test results as follows Figure 10 As shown, the meanings of each group are as follows: pGL3-Basic+PRL-TK: pGL3-Basic plasmid without promoter + internal control plasmid PRL-TK; pGL3-promoter+PRL-TK: pGL3 plasmid containing SV40 promoter but without ATP6V1E2 promoter + internal control plasmid PRL-TK; P0-PL promoter+PRL-TK: pGL3 plasmid containing ATP6V1E2 P0-PL promoter + internal control plasmid PRL-TK; P0-core promoter+PRL-TK: pGL3 plasmid containing ATP6V1E2 P0-core promoter + internal control plasmid PRL-TK; P0-Δ1 promoter+PRL-TK: pGL3 plasmid containing ATP6V1E2 P0-Δ1 promoter + internal control plasmid PRL-TK.
[0172] Compared with the negative control (pGL3-Basic), the positive control (pGL3-Promoter), P0-PL, and P0-core all significantly initiated luciferase expression, with significantly higher transcriptional efficiency than P0-Δ1. Combined with the CHIP-seq analysis results, this indicates that P0-core can serve as the core promoter of ATP6V1E2, initiating its expression.
[0173] The above description of the embodiments is only for understanding the method and core ideas of the present invention. It should be noted that those skilled in the art can make various improvements and modifications to the present invention without departing from the principles of the invention, and these improvements and modifications will also fall within the protection scope of the claims of the present invention.
Claims
1. The ATP6V1E2 promoter, characterized in that, The promoter comprises any of the following nucleotide sequences: (1) A nucleotide sequence as shown in SEQ ID NO:1 or SEQ ID NO:2; (2) The nucleotide sequence of a variant, homology, fragment or derivative of the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2; Preferably, the nucleotide sequence of the variant, homology, fragment or derivative of the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2 includes a nucleotide sequence formed by deleting, substituting, adding and / or inserting one or more nucleotides into the nucleotide sequence of SEQ ID NO:1 or SEQ ID NO:2; Preferably, the nucleotide sequence of a variant, homology, fragment, or derivative of the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2 includes a nucleotide sequence having at least about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity with SEQ ID NO:
2.
2. A DNA, characterized in that, The DNA includes the promoter as described in claim 1; Preferably, the DNA further includes a target gene linked downstream of the promoter; Preferably, the target gene includes nucleic acids encoding proteins, nucleic acids encoding antisense RNA, nucleic acids encoding ribozymes, and / or nucleic acids encoding selective markers; Preferably, the target gene is selected from nucleic acids that encode proteins; Preferably, the target gene is a nucleic acid encoding ATP6V1E2.
3. A gene expression unit, characterized in that, The gene expression unit includes the DNA and terminator as described in claim 2.
4. A carrier, characterized in that, The vector comprises the promoter of claim 1, the DNA of claim 2, or the gene expression unit of claim 3; Preferably, the vector includes a plasmid vector; Preferably, the plasmid vector includes pHY, pUB110, pE194, pUC18, pUC19, pBluescript, pET, or pGL3; Preferably, the plasmid vector is selected from pGL3.
5. A cell, characterized in that, The cell comprises the promoter of claim 1, the DNA of claim 2, the gene expression unit of claim 3, or the vector of claim 4; Preferably, the cells comprise eukaryotic cells; Preferably, the eukaryotic cells include mammalian cells; Preferably, the mammalian cells include CHO cells, HEK cells, BHK cells, or Sp2 / O cells; Preferably, the mammalian cells are selected from CHO cells and HEK cells; Preferably, the HEK cells include 293T cells and 293F cells; Preferably, the HEK cells are selected from 293T cells.
6. A method for selecting cells that express exogenous polypeptides, characterized in that, The method includes transfecting cells with a nucleic acid containing the promoter of claim 1, and selecting the transfected cells under selective culture conditions; Preferably, the cells comprise eukaryotic cells; Preferably, the eukaryotic cells include mammalian cells; Preferably, the mammalian cells include CHO cells, HEK cells, BHK cells, or Sp2 / O cells; Preferably, the mammalian cells are selected from CHO cells and HEK cells; Preferably, the HEK cells include 293T cells and 293F cells; Preferably, the HEK cells are selected from 293T cells.
7. The method according to claim 6, characterized in that, The nucleic acid comprises: a) The first expression cassette encoding a foreign polypeptide nucleic acid; b) A second expression cassette comprising the promoter and the second nucleic acid as described in claim 1; Preferably, the promoter of claim 1 is effectively linked to the second nucleic acid; Preferably, the second nucleic acid encodes a selective marker; Preferably, the selective marker includes aminoglycoside phosphotransferase, antibiotic resistance gene, fluorescent protein, or luciferase; Preferably, the aminoglycoside phosphotransferase includes hygromycin phosphotransferase and neomycin phosphotransferase; Preferably, the antibiotic resistance gene includes a puromycin, bleomycin, fosetyl-aluminum, or chloramphenicol resistance gene; Preferably, the fluorescent protein includes green fluorescent protein, red fluorescent protein, yellow fluorescent protein, and orange fluorescent protein; Preferably, the selective labeling is selected from luciferase; Preferably, the selection method includes flow cytometry, ELISA, immunoprecipitation, immunoaffinity column chromatography, magnetic bead immunoaffinity sorting, microscopy-based separation methods, or immunobinding-based methods.
8. The application of the promoter according to claim 1 in peptide expression; Preferably, the polypeptide is ATP6V1E2.
9. A method for expressing polypeptides, characterized in that, The method includes culturing cells transfected with nucleic acids containing the promoter and polypeptide of claim 1, and collecting the polypeptide from the resulting culture.
10. A kit comprising the promoter of claim 1, the DNA of claim 2, the gene expression unit of claim 3, the vector of claim 4, or the cell of claim 5.