Triple RT-qPCR method and kit for simultaneously detecting rainbow trout IHNV, VHSV and vibrio anguillarum

Abstract

The invention discloses a triple RT-qPCR method and kit for simultaneously detecting rainbow trout IHNV, VHSV and vibrio anguillarum, and belongs to the technical field of pathogen detection. According to the invention, qPCR primers and TaqMan probes for detecting IHNV, VHSV and vibrio anguillarum are respectively designed, and the nucleotide sequences of the qPCR primers and TaqMan probes are shown as SEQ ID NO: 1-9. The primer and the probe can be used for simultaneously qualitatively and quantitatively detecting three pathogens, namely IHNV, VHSV and vibrio anguillarum, by virtue of a triple qPCR (Quantitative Polymerase Chain Reaction) method. The triple RT-qPCR method for simultaneously detecting the IHNV, the VHSV and the vibrio anguillarum is established for the first time, common detection of RNA viruses and bacteria is realized, and the method has the characteristics of high efficiency and convenience; meanwhile, the molecular crowding agent is added as a component for improving the amplification efficiency, so that the detection of pathogens in a medium-low concentration range is ensured, and the reliability of the detection limit is improved. The method provided by the invention has no amplification curve for non-target pathogens, and has good specificity.

Description

Technical Field

[0001] This invention belongs to the field of pathogen detection technology, specifically relating to a triple reverse transcription real-time quantitative PCR method (RT-qPCR) and kit for the simultaneous detection of infectious hematopoietic organ necrosis virus (IHNV), viral hemorrhagic septicemia virus (VHSV), and Vibrio anguillarum in rainbow trout. Background Technology

[0002] rainbow trout ( Oncorhynchus mykiss Rainbow trout are cold-water fish belonging to the family Salmonidae and the genus Oncorhynchus. Native to northern North America and the Pacific coast, they are characterized by rapid growth, high feed efficiency, ease of artificial breeding, and high economic value. Rainbow trout have tender, odorless flesh, and their muscle is rich in unsaturated fatty acids, high in protein, and low in fat, making them popular with consumers. Rainbow trout farming began in my country in 1959, with farming areas distributed across Heilongjiang, Jilin, Liaoning, Shandong, Qinghai, and Xinjiang. As of 2023, my country's total rainbow trout production approached 40,000 tons, making it an important aquaculture species in the country. The rainbow trout farming market has enormous potential, and consumption upgrades and technological innovation will continue to drive demand growth. However, with the increasing intensification of rainbow trout farming, the widespread transmission of new and common pathogens such as infectious hematopoietic necrosis virus (IHNV), viral hemorrhagic septicemia virus (VHSV), and Vibrio anguillarum has brought serious biosecurity threats and economic losses to the aquaculture industry, affecting the healthy development of the industry.

[0003] Infectious hematopoietic necrosis virus is a single-stranded negative-sense RNA virus. Infected fish often exhibit typical symptoms such as blackening of the skin, bulging eyes, and pinpoint hemorrhages, along with neurological manifestations such as spiral swimming and abnormal behavior. Viral hemorrhagic septicemia virus is also a single-stranded negative-sense RNA virus. Infection symptoms include bulging eyes, abdominal distension, hemorrhage, and anemia, and it also exhibits a high mortality rate. This disease first spread to some European countries, then to North America in 1999, and then to the Asia-Pacific region after 2000. Confirmed cases of this disease have been reported in Japan, South Korea, and China. Vibrio anguillarum, a Gram-negative bacterium of the Vibrio family, is one of the most serious bacterial pathogens in marine and brackish water aquaculture environments worldwide. Infected fish primarily exhibit skin ulcers, fin base hemorrhage, anal swelling, internal bleeding, protruding eyes, and decreased appetite. Vibrio anguillarum was first discovered in Europe in the late 19th century. During the 1970s and 80s, the rise of cage aquaculture led to frequent outbreaks of vibrio disease, significantly impacting salmon and trout farming in countries like Chile and Norway. From the 1990s to the early 21st century, with the expansion of rainbow trout farming in my country, vibrio disease became a regular, seasonal outbreak, particularly prevalent in summer, resulting in substantial economic losses. All three pathogens mentioned above cause diseases characterized by high infectivity, high mortality, and difficulty in controlling once outbreaks occur. Currently, there are no effective treatments. Therefore, early, accurate, and sensitive diagnosis is crucial and key to preventing even larger-scale economic losses in the rainbow trout aquaculture industry due to disease outbreaks.

[0004] Currently, the main early detection method for the above three pathogens is real-time quantitative PCR (qPCR). Among them, qPCR using TaqMan probes has the advantages of convenient operation, good reproducibility, high sensitivity and specificity. Furthermore, by modifying different fluorescent groups, the detection channels can be utilized to the maximum extent. It not only has the potential for widespread application in field detection, but also allows for the simultaneous analysis of multiple target genes, providing a sound theoretical basis for multiplex detection technology. However, previous detection methods for IHNV included only single-tube nested PCR and RT-RAA isothermal fluorescence data analysis. For VHSV, there are detection kits based on the RPA-CRISPR-Cas12a system and RT-RPA methods. There are currently no publicly available TaqMan qPCR detection methods for either virus. For Vibrio anguillarum, there are reports of TaqMan multiplex quantitative PCR detection methods, such as Chinese patent application CN119736422 A, which discloses a TaqMan multiplex quantitative PCR detection system, kit, application, and detection method for common Vibrio pathogens in aquaculture. However, it can only be used to detect common Vibrio pathogens. For samples with potential mixed infections of viruses and Vibrio anguillarum, multiple rounds of testing are required, which not only increases the time and cost of identification and reduces efficiency but also increases the template demand and contamination risk.

[0005] Real-time multiplex quantitative PCR (qPCR) technology can detect multiple pathogens simultaneously in a single reaction, offering advantages such as high throughput and rapid detection speed, making it more suitable for current integrated on-site testing needs. However, since IHNV and VHSV are RNA viruses, while Vibrio anguillarum is a type of bacteria, the design of primer sequences must consider the interference of different nucleic acids on the multiplex detection system and the difficulty of sample collection. Currently, there are no reports of triple qPCR detection of these three different types of pathogens in the same system.

[0006] Given the current trend of these three pathogens sharing a common prevalence in rainbow trout farming areas, there is an urgent need to develop a detection method that can simultaneously, rapidly, accurately, and conveniently detect all three pathogens. Crowding agents are common mediators in isothermal nucleic acid amplification techniques, increasing solution viscosity and mimicking the intracellular environment to promote enzyme-substrate interactions. However, there are currently no reports of adding such mediators to the TaqMan qPCR system. Summary of the Invention

[0007] To address the aforementioned issues, the present invention aims to provide a triple reverse transcription real-time quantitative PCR (RT-qPCR) method and kit for the simultaneous detection of IHNV, VHSV, and Vibrio anguillarum in rainbow trout. This method and kit offer advantages such as high sensitivity, high specificity, and quantification. Furthermore, the addition of a high-molecular-weight crowding agent effectively improves the detection efficiency and speed of low to medium concentrations of pathogen load, providing a convenient and reliable detection method and product for the early monitoring, warning, and diagnosis of these three common disease pathogens in rainbow trout farming.

[0008] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a triple RT-qPCR kit for the simultaneous detection of rainbow trout IHNV, VHSV, and Vibrio anguillarum, characterized in that it comprises a triple reverse transcription real-time quantitative PCR primer and TaqMan probe combination having the following nucleotide sequence: (1) Real-time quantitative PCR primers and TaqMan probes for detecting IHNV, including: IHNV-1-F: 5'- CACTGGACTCAGAGACATCAAG -3' (SEQ ID NO: 1); IHNV-1-R: 5'- GGTCAAAGTCTGTCTTGGAGAA -3' (SEQ ID NO: 2); IHNV-1-P: 5'- TCGAAGATGCAGAGACGGAGTATCGT -3' (SEQ ID NO: 3); The TaqMan probe IHNV-1-P has a HEX emission group labeled at its 5' end and a BHQ1 quenching group labeled at its 3' end.

[0009] (2) Primers and TaqMan probes for real-time quantitative PCR detection of VHSV, including: VHSV-1-F: 5'- CAACCTCGCCCTGTCAAA-3' (SEQ ID NO: 4); VHSV-1-R: 5'-GTGAACAGGTGTCCTTCTAGTG -3' (SEQ ID NO: 5); VHSV-1-P: 5'-ATTGGCAGGGAGTCTATTGGGTCG-3' (SEQ ID NO: 6).

[0010] The TaqMan probe VHSV-1-P has a 6-FAM emitting group labeled at its 5' end and a BHQ1 quenching group labeled at its 3' end.

[0011] (3) Primers and TaqMan probes for real-time quantitative PCR detection of Vibrio anguillarum, including: VIBRIO-2-F: 5'-ACCTATCGTTGAATACCCTCCT-3' (SEQ ID NO:7); VIBRIO-2-R: 5'-CCACCTATCATGTGATGCTCAA-3' (SEQ ID NO:8); VIBRIO-2-P: 5'- TCCAGTCTTAACGTTACACCACTGTAGT -3' (SEQ ID NO: 9).

[0012] The TaqMan probe VIBRIO-2-P is labeled with a CY5 emitting group at its 5' end and a BHQ3 quenching group at its 3' end.

[0013] Furthermore, in the primer and TaqMan probe combination of the kit, the concentration of each sequence is 10 nmol / L.

[0014] Furthermore, the kit also includes an enzyme premix (AccurSTART II U+ One Step RT-qPCR Super Premix, Nanjing Novizan Biotechnology Co., Ltd.), a positive control, a negative control, and a molecular crowding agent. The positive control is a mixture of positive plasmids for infectious hematopoietic necrosis virus, viral hemorrhagic septicemia virus, and Vibrio anguillarum. The negative control is ultrapure water, and the molecular crowding agent is PEG8000.

[0015] In a second aspect, the present invention provides a triple RT-qPCR method for the simultaneous detection of rainbow trout IHNV, VHSV, and Vibrio anguillarum, used for the simultaneous qualitative detection of the above three pathogens and / or the quantitative detection of positive samples in the same system, characterized by comprising the following steps: (1) Extract RNA and DNA from the sample to be tested; (2) Using the RNA and DNA obtained in step (1) as templates, and employing the primer and probe combination or the kit described above, establish the following reaction system: 1 μL template, 4 μL enzyme premix, 1.2 μL each of INV-1-F and IHNV-1-R, 2.4 μL each of VHSV-1-F and VHSV-1-R, 1.6 μL each of VIBRIO-2-F and VIBRIO-2-R, 0.26 μL each of IHNV-1-P, 0.26 μL each of VHSV-1-P, 0.34 μL each of VIBRIO-P, and 3.74 μL ultrapure water; Optionally, the predicted pathogen detection concentration in the sample is low to medium (approximately 10 for positive plasmid samples). 1 -10 4 When the reaction volume is 4% w / v, PEG8000 can be added to the reaction system and the concentration can be adjusted so that the reaction system contains PEG8000 with a final concentration of 4% w / v. (3) Using the reaction system established in step (2), and using the channel settings adapted to detect the fluorescence emitted by the CY5 emitting group, 6-FAM emitting group, and HEX emitting group, reverse transcription and amplification were performed according to the following program: 55℃ for 15 min, 1 cycle; 95℃ for 30 s, 1 cycle; 95℃ for 10 s, 60℃ for 30 s, 40 cycles; (4) For quantitative detection, using the positive control provided in this kit, plasmid standards containing at least five gradient concentrations are prepared. Each plasmid standard contains positive controls of equal concentrations of infectious hematopoietic necrosis virus, viral hemorrhagic septicemia virus, and Vibrio anguillarum. Using the selected plasmid standards at each concentration as templates, the triple reverse transcription real-time fluorescence quantitative PCR primers and TaqMan probe combination provided in the first aspect of this invention are used to perform detection according to the reaction system and reaction procedure established in step (2). A standard curve is obtained by plotting the logarithmic value of the concentration of each plasmid standard (X-axis) against its corresponding Ct value (Y-axis). Specifically, the logarithmic base value of the selected concentration should be the gradient value of the dilution at the time of implementation.

[0016] (5) For qualitative detection, when the Ct value is ≤35 and there is a specific amplification curve in the HEX channel, the sample is determined to have a positive test result for infectious hematopoietic necrosis virus, that is, the sample contains infectious hematopoietic necrosis virus; when the Ct value is ≤35 and there is a specific amplification curve in the 6-FAM channel, the sample is determined to have a positive test result for viral hemorrhagic septicemia virus, that is, the sample contains viral hemorrhagic septicemia virus; when the Ct value is ≤35 and there is a specific amplification curve in the CY5 channel, the sample is determined to have a positive test result for Vibrio anguillarum, that is, the sample contains Vibrio anguillarum.

[0017] The beneficial effects of this invention are as follows: (1) A reverse transcription triple fluorescence quantitative PCR method for the first time was established for the simultaneous detection of infectious hematopoietic necrosis virus, viral hemorrhagic septicemia virus and Vibrio anguillarum. It realizes the joint detection of RNA viruses and bacteria, and has the characteristics of high efficiency and convenience. It solves the problem of time-consuming and labor-intensive single fluorescence quantitative PCR, and effectively reduces the cost of manpower and material resources.

[0018] (2) By effectively screening primers and probes, the detection limit of the reverse transcription triple fluorescence quantitative PCR method established in this invention was increased to 10. 1 The sample size was measured at copies / μL, and the coefficient of variation (CV) of Ct values ​​within the same detection batch was reduced to below 3%, while the coefficient of variation of Ct values ​​between different detection batches was reduced to below 2%, demonstrating good repeatability and sensitivity. The inter-batch CV index was superior to existing standards and published patent applications. Under triple conditions, the amplification efficiency was close to 100%, indicating minimal interference between the screened target combinations and suitability for complex field environments.

[0019] (3) Using a reagent that integrates reverse transcription and quantitative PCR, there is no need to perform a reverse transcription step after sampling, thus reducing the loss of sample RNA in the aforementioned steps.

[0020] (4) The reverse transcription triple fluorescence quantitative PCR method established in this invention includes an integrated reverse transcription quantitative step, which simultaneously realizes reverse transcription and fluorescence quantitative PCR amplification, simplifies the operation steps, and improves the detection efficiency.

[0021] (5) The reverse transcription triple fluorescence quantitative PCR method established in this invention has no amplification curve for non-target pathogens and has good specificity.

[0022] (6) This invention is the first to add a molecular congesting agent to the real-time fluorescence quantitative PCR system as a component to improve amplification efficiency, achieving an initial concentration of 10 for the standard plasmid reference. 1 -10 4 The 5% increase in amplification efficiency under extreme amplification conditions with a coefficient / μL reduces the Ct value required for the detection limit by 2, effectively improving the detection method for pathogens in the low to medium concentration range to ensure detection and enhancing the reliability of the detection limit. Attached Figure Description

[0023] Figure 1 This is a fluorescence amplification curve of the concentration gradient of the standard plasmid for the infectious hematopoietic necrosis virus of this invention.

[0024] Figure 2 This is a fluorescence amplification curve of the concentration gradient of the Vibrio anguillarum standard plasmid of this invention.

[0025] Figure 3 This is a fluorescence amplification curve of the concentration gradient of the standard plasmid for viral hemorrhagic septicemia virus of the present invention.

[0026] Figure 4 This is a standard curve diagram of the plasmids of infectious hematopoietic necrosis virus, viral hemorrhagic septicemia virus, and Vibrio anguillarum of the present invention.

[0027] Figure 5 This is a specific detection diagram for the infectious hematopoietic necrosis virus of this invention.

[0028] Figure 6 This is a diagram illustrating the specific detection of Vibrio anguillarum in this invention.

[0029] Figure 7 This is a specific detection diagram for viral hemorrhagic sepsis virus according to the present invention.

[0030] Figure 8 Fluorescence amplification curves for detecting infectious hematopoietic necrosis virus with added molecular crowding agents.

[0031] Figure 9 The fluorescence amplification curve for detecting Vibrio anguillarum with added molecular crowding agent.

[0032] Figure 10Fluorescence amplification curves for detecting viral hemorrhagic septicemia virus with added molecular crowding agents. Detailed Implementation

[0033] The following examples provide a detailed description of the specific implementation methods and kits provided by this invention. Unless otherwise specified, all examples below are performed using conventional existing techniques, and all reagents used are available from legitimate commercial sources. Experimental methods without specific conditions are generally performed under standard conditions or as recommended by the manufacturer. Unless otherwise defined, the technical terms used in all examples have meanings that are within the scope of understanding of those skilled in the art.

[0034] Example 1: Preparation of probe-primer composition and optimization of experimental conditions Example 1 of this invention prepared a probe-primer composition for the simultaneous detection of infectious hematopoietic necrosis virus (IHNV), viral hemorrhagic septicemia virus (VHSV), and Vibrio anguillarum, and optimized the experimental method. All primers and probes used can be synthesized using existing technologies.

[0035] 1. Preparation of probe-primer composition Based on existing reports and current standards, the gene sequences of the nucleoprotein (N) of infectious hematopoietic necrosis virus, the glycoprotein (G) of viral hemorrhagic septicemia virus, and the gene sequence of Vibrio anguillarum metalloproteinase (empA) were selected from the public database GenBank. Some of the initial alignment sequences used are shown in Table 1.

[0036] Table 1. Initial alignment sequence accessions of three pathogens obtained from GenBank.

[0037] Conserved sequences for the three pathogens were identified using the NCBI-BLAST online sequence alignment tool and DNAMAN software. Multiple probe-probe combinations were designed using the IDT PrimerQuest Tool targeting the most conserved portions of these sequences. The reference sequences for Infectious Hematopoietic Necrolysis Virus (IHHV) were GenBank No. X73872, for Viral Hemorrhagic Septicemia Virus (VHSV) GenBank No. MF176926, and for Vibrio anguillarum GenBank No. CP031528. After verifying the interspecies specificity of the corresponding combinations using the NCBI-primer BLAST online primer specificity verification tool, the PrimerSelect secondary structure prediction software was used to eliminate combinations prone to hairpin structures and containing complementary sequences. Finally, single primer-probe combinations were determined for each of the three pathogens, and the corresponding sequences were synthesized and fluorescently modified by Sangon Biotech (Shanghai) Co., Ltd.

[0038] The final determined sequence is as follows: IHNV-1-F: 5'- CACTGGACTCAGAGACATCAAG -3' (SEQ ID NO: 1); IHNV-1-R: 5'- GGTCAAAGTCTGTCTTGGAGAA -3' (SEQ ID NO: 2); IHNV-1-P: 5'- TCGAAGATGCAGAGACGGAGTATCGT -3' (SEQ ID NO: 3); The TaqMan probe IHNV-1-P has a HEX emission group labeled at its 5' end and a BHQ1 quenching group labeled at its 3' end.

[0039] VHSV-1-F: 5'- CAACCTCGCCCTGTCAAA-3' (SEQ ID NO: 4); VHSV-1-R: 5'-GTGAACAGGTGTCCTTCTAGTG -3' (SEQ ID NO: 5); VHSV-1-P: 5'-ATTGGCAGGGAGTCTATTGGGTCG-3' (SEQ ID NO: 6).

[0040] The TaqMan probe VHSV-1-P has a 6-FAM emitting group labeled at its 5' end and a BHQ1 quenching group labeled at its 3' end.

[0041] VIBRIO-2-F: 5'-ACCTATCGTTGAATACCCTCCT-3' (SEQ ID NO:7); VIBRIO-2-R: 5'-CCACCTATCATGTGATGCTCAA-3' (SEQ ID NO:8); VIBRIO-2-P: 5'- TCCAGTCTTAACGTTACACCACTGTAGT -3' (SEQ ID NO: 9).

[0042] The TaqMan probe VIBRIO-2-P is labeled with a CY5 emitting group at its 5' end and a BHQ3 quenching group at its 3' end.

[0043] 2. Optimization of experimental conditions According to the instructions for use of the reverse transcription and polymerase premix, the condition optimization steps of this invention are as follows: (1) Preparation of standard plasmids: The detection sequence fragment for infectious hematopoietic necrosis virus is shown below as IHNV-A: 5'-CGGATCACGAACGATGACTAGTGCACTCAGAGAGACGTTCACTGGACTCAGAGACATCAAGGGGGGAGTCCTCGAAGATGCAGAGACGGAGTATCGTCCCGGTACGATAACCCTCCCTCTATTTTTCTCCAAGACAGACTTTGACCTAGAGATGATCAAGCGGGCGGTGAGTCAAGTCGGAGGAGAGGGAACGAGAAGGG-3' (SEQ ID NO: 10).

[0044] The sequence was amplified from the virus strain preserved in our laboratory, and the obtained sequence was ligated into the pClone007 (Beijing Qingke Biotechnology Co., Ltd.) vector, transferred to Escherichia coli Trelief 5α (Beijing Qingke Biotechnology Co., Ltd.), and positive clones were screened by PCR and confirmed by sequencing.

[0045] The detection sequence fragment for viral hemorrhagic septicemia virus is shown below as VHSV-A: 5'-TGCACAACCTCGCCCTGTCAAACTCATTGGCAGGGAGTCTATTGGGTCGGTGCCACACCTACAGCCCATTGCCCCACGTCGGAAACACTAGAAGGACACCTGTTCACCAG-3' (SEQ ID NO: 11).

[0046] The sequence was amplified from a virus strain preserved in our laboratory, ligated into the pClone007 vector, and transferred to *E. coli* Trelief 5α. Positive clones were screened by PCR and their correctness was confirmed by sequencing.

[0047] The detection sequence fragment for Vibrio anguillarum is shown below in Vibrio-A: 5'-ATAACAAAAGTGCTGTGGTTATATCGATAGCAAGCCATAACAACAAATCGGTGTTTCGATGCTTAAGACAAGGCGAATTTGTGGAGGCGGAGAAGCTGGCAAGAAAAGACTAGAAACAAACACCGTGGTTGTTAAACAACCTATCGTTGAATACCCTCCTACATAACAAAGGGGCACCGACTCGTGCCCCTTTAAATTTAATCAATAA AGATGATTAATCCAGTCTTAACGTTACACCACTGTAGTTACTATAGCCTTTGAGCATCACATGATAGGTGGTTCCTGGTGTTGCAGAAATTGTGCACTGTTCATTGTTGCCCGATTTGTAAGGGCGACAATCCCACGAAGAAGTGGTTGGTTTGCTGCCGGCTTTGACATACAAATCAGCATCACCTGAGCCCAAACTAATCGAAACTTTA -3' (SEQ ID NO: 12).

[0048] The corresponding sequence was synthesized by Beijing Qingke Biotechnology Co., Ltd., and cloned into the vector pUC57.

[0049] This invention uses a plasmid extraction kit to obtain the corresponding positive plasmids, and calculates the plasmid concentration according to the formula: copy number concentration (copies / μL) = [mass concentration (ng / μL) × 10]. -9 ×6.02×10 23 [] / (base pairs × 660), convert the recombinant plasmid mass concentration to copy number concentration. Adjust the concentration to 1 × 10 7 copies / μL.

[0050] (2) Orthogonal table design: The present invention optimizes the annealing temperature, primer concentration and probe concentration. The annealing temperature is set to 55, 56, 57, 58, 59, 60, 61, 62 and 63℃ respectively. The forward primer and reverse primer are added in the amounts of 0.4μL, 0.6μL, 0.8μL, 1.2μL, 1.4μL, 1.6μL and 2μL respectively. The probe is added in the amounts of 0.14μL, 0.18μL, 0.22μL, 0.26μL, 0.3μL, 0.34μL, 0.38μL, 0.42μL and 0.46μL respectively. A factor table is made based on the orthogonal design table of L81.9.3 to simultaneously optimize the best detection conditions for the three viruses.

[0051] (3) Conduct the experiment using the factor table obtained in step (2), taking 1×10 4Using positive plasmids with a copy / μL ratio as templates, and selecting the minimum Ct value and moderate fluorescence intensity during the plateau phase as screening criteria, the optimal experimental conditions were chosen as the basis for the implementation of the following examples. In this example, the optimal conditions obtained were: 1 μL template, 4 μL enzyme premix, 1.2 μL each of INV-1-F and IHNV-1-R, 2.4 μL each of VHSV-1-F and VHSV-1-R, 1.6 μL each of VIBRIO-2-F and VIBRIO-2-R, 0.26 μL each of IHNV-1-P and VHSV-1-P, 0.34 μL of VIBRIO-P, and 3.74 μL ultrapure water.

[0052] Example 2: Establishment of standard curve and sensitivity test for reverse transcription triple fluorescence quantitative detection In Example 2 of this invention, a Ct value-logarithmic curve of standard positive plasmid concentration for simultaneous quantitative detection of infectious hematopoietic necrosis virus (IHNV), viral hemorrhagic septicemia virus (VHSV), and Vibrio anguillarum was prepared, and the detection limit of this invention was verified.

[0053] 1. Establishment of the standard curve The plasmid standards of the three viruses were serially diluted tenfold with ultrapure water to obtain concentrations of 1×10⁻⁶. 1 -1× 10 6 Six concentrations of plasmids at each of the three viruses were mixed in equal volumes to obtain six sets of combined plasmid standards. Using the optimal amplification system and procedure obtained in step (2) of Example 1, each set of combined plasmid standards was used as a template for detection. Simultaneously, fluorescence signals were collected using a qPCR instrument to create raw amplification curves, yielding fluorescence amplification curves for Infectious Hematopoietic Necrosis Virus, Viral Hemorrhagic Septicemia Virus, and Vibrio anguillarum virus (e.g., 6 copies / μL). Figure 1-3 ).

[0054] Linear regression analysis was performed using the logarithm of plasmid standard concentration (lgC, where C is the plasmid standard concentration in copies / μL) as the abscissa (x) and the corresponding Ct value as the ordinate (y). Standard curves for infectious hematopoietic necrosis virus, viral hemorrhagic septicemia virus, and Vibrio anguillarum were obtained, and the plasmid standard concentrations corresponding to each curve were labeled (e.g., ...). Figure 4-6 ).

[0055] The linear equation of the standard curve for the plasmid of infectious hematopoietic necrosis virus was y = 37.5607 - 3.3765x, R² = 0.99956, and the amplification efficiency was 97.77%. The linear equation of the standard curve for the plasmid of viral hemorrhagic septicemia virus was y = 37.1487 - 3.2322x, R² = 0.99567, and the amplification efficiency was 103.89%. The linear equation of the plasmid standard curve of Vibrio anguillarum is y=37.1758-3.6267x, R²=0.99896, and the amplification efficiency is 96.19%.

[0056] The method established in this invention provides a quantitative fitting linear equation with R² > 0.99 for three viruses, and the amplification efficiency is in the range of 95-105%, indicating that this invention has good reliability. Theoretically, the triple detection system may experience interference between targets, leading to abnormal amplification efficiency. However, through effective optimization of primer and probe combinations, the amplification efficiency of IHNV in this invention (97.77%) is significantly superior to existing RT-RAA methods, exceeding the 96% amplification efficiency proposed by Lü Xiaonan et al. (Lü Xiaonan, Xu Lipu, Zhang Wen, et al. Establishment of rapid RT-RAA detection method for infectious hematopoietic necrosis virus [J]. Journal of Inspection and Quarantine, 2019, 29(03):22-26.), indicating a high target amplification efficiency. The amplification efficiency of Vibrio anguillarum (96.19%) is lower than the 100% amplification efficiency of the Taqman multiplex quantitative PCR detection method proposed by Zhang Jian et al. (Yantai University. Taqman multiplex quantitative PCR detection system, kit, application and detection method for common Vibrio pathogens in aquaculture: 202510259283.X [P]. 2025-04-01.), indicating that the number of non-specific amplifications is less than that of current methods, which is more conducive to accurate quantification. Under triple detection conditions, the detection efficiency of the three pathogens all approached the ideal value of 100%, which shows that the primer-probe combination designed in this invention has strong anti-interference ability and the detection effect is closer to the ideal situation, making it suitable for on-site detection.

[0057] 2. Sensitivity Experiment Mix equal volumes of the three viruses at 1×10⁻⁶. 1 copies / μL and 1×10 0 Two sets of combined plasmid standards were obtained by using copies / μL of the same concentration of standard. The optimal amplification system and procedure obtained in step (2) of Example 1 were used as templates for detection, and the lowest concentration at which the amplification curve appeared was taken as the limit of detection of the present invention.

[0058] The detection limit of the method established in this invention is 1×10⁻⁶ for all three viruses. 1The copies / μL ratio indicates that the present invention has good sensitivity. In particular, the limit of detection for Vibrio anguillarum plasmid samples is less than 4 copies as described in the prior art patent application CN 119736422 A, a reduction of 4 times, resulting in a significant improvement in sensitivity. This demonstrates that the designed primer-probe combination effectively solves the problem of low sensitivity in current methods.

[0059] Example 3: Specificity and repeatability test of triple fluorescence quantitative PCR for reverse transcription In Example 3 of this invention, the ability of the optimal amplification system and program obtained in step (2) of Example 1 to distinguish similar pathogens was tested, and repeatability analysis was performed, including intra-group repeatability and inter-group repeatability.

[0060] 1. Specificity test Nucleic acids from common rainbow trout pathogens preserved in our laboratory, including infectious hematopoietic necrosis virus (IHNV), viral hemorrhagic septicemia virus (VHSV), infectious pancreatic necrosis virus (IPNV), Vibrio anguillarum, Vibrio parahaemolyticus, Vibrio harveyi, and Vibrio alginolyticus, were selected for detection using the optimal amplification system and procedure obtained in Example 1, subheading 2. The positive control was a plasmid template, and the negative control was ultrapure water. Results are shown in […]. Figure 7-9 .

[0061] Experimental results show that the triple reverse transcription real-time quantitative PCR system designed in this invention only shows positive amplification signals for infectious hematopoietic necrosis virus (IHNV), viral hemorrhagic septicemia virus (VHSV), and Vibrio anguillarum. No signals were found for non-target pathogen nucleic acids and negative controls, indicating that the established method has good specificity.

[0062] 2. Repeatability experiment According to the experimental method in subheading 1 of Example 2, three technical replicates were set up for each plasmid standard in the same batch, and three independent experiments were repeated at different time periods to obtain the Ct values ​​within the group and different groups. The repeatability was examined according to the coefficient of variation (CV%) = standard deviation (SD) / mean × 100%. The results are shown in Table 2.

[0063] Table 2. Repeatability test results of the detection method of the present invention

[0064] Under the experimental method of step 1 in Example 2, the coefficient of variation of the three viruses was less than 3%, and the inter-group detection coefficient of variation of the three viruses was less than 2%. The repeatability was significantly higher than that of the methods established in existing research, proving that the method designed in this invention has good repeatability and high reliability of the detection results.

[0065] Example 4: Molecular congestant assay for triple fluorescence quantitative detection of reverse transcription Sodium alginate, methylcellulose, PEG 8000, and chitosan were selected as initial screening polymers. Plasmid standards for the three pathogens were serially diluted tenfold with ultrapure water to obtain concentrations of 1×10⁻⁶. 1 -1× 10 4 Four concentrations of three pathogen standards (copies / μL / μL) were prepared, and equal volumes of standards at the same concentration were mixed to obtain four sets of combined plasmid standards. Using the optimal amplification system and procedure obtained in step 2 of Example 1, each set of combined plasmid standards was used as a template for detection. Simultaneously, fluorescence signals were collected using a qPCR instrument to create raw amplification curves, yielding fluorescence amplification curves for Infectious Hematopoietic Necrosis Virus (IHNV), Viral Hemorrhagic Septicemia Virus (VHSV), and Vibrio anguillarum, respectively. Figure 10 The measured Ct values ​​were analyzed and compared with the amplification results of the standard without the addition (control group). Let ΔCt = Ct value of the test group - Ct value of the control group. The molecular crowding agent types and their final concentrations in groups with ΔCt ≥ 1 were selected as the crowding agent addition methods of this invention. The results are shown in Table 3.

[0066] In the experimental procedure of step 1 in Example 2, the addition of PEG8000 at a final concentration of 4% w / v can effectively improve the detection efficiency of three pathogens to varying degrees. For example, for infectious hematopoietic necrosis virus, in addition to 1×10 3 copies / μL and 1×10 4 Besides the fact that adding PEG8000 at copies / μL had no effect, the average Ct values ​​for the other two concentrations were advanced by 1-2 cycles, the amplification efficiency was improved by nearly 5%, and the amplification time was shortened by nearly 1 minute for the same amplification program. Viral hemorrhagic septicemia virus at 1×10 3 copies / μL and 1×10 4 When copies / μL, ΔCt≥3, Vibrio anguillarum at 1×10 1 copies / μL and 1×10 2 When the number of copies / μL is ΔCt≥1, other concentrations have no significant impact on amplification results (see bolded portion of Table 3). The results of these examples demonstrate that PEG8000 improves detection efficiency and shortens detection time for low to medium concentrations, fully showcasing the advantages of PEG8000 as a molecular crowding agent.

[0067] Table 3. Effect of PRG8000 on amplification efficiency

[0068] Although the present invention has been described in detail, the above embodiments are not intended to limit the invention in any way. Any methods and materials similar to or equivalent to those described herein may be used in the implementation or testing of the present invention. Based on the embodiments of the present invention, all implemented techniques and all other embodiments obtained without inventive effort are within the scope of protection of the present invention.

Claims

1. A triple RT-qPCR kit for simultaneous detection of rainbow trout IHNV, VHSV, and Vibrio anguillarum, characterized in that, include: (1) Primers and TaqMan probes for real-time quantitative PCR to detect IHNV, wherein: The nucleotide sequence of the upstream primer IHNV-1-F is shown in SEQ ID NO:1, the nucleotide sequence of the downstream primer IHNV-1-R is shown in SEQ ID NO:2, and the nucleotide sequence of the TaqMan probe IHNV-1-P is shown in SEQ ID NO:

3. (2) Primers and TaqMan probes for real-time quantitative PCR detection of VHSV, wherein: The nucleotide sequence of the upstream primer VHSV-1-F is shown in SEQ ID NO:4, the nucleotide sequence of the downstream primer VHSV-1-R is shown in SEQ ID NO:5, and the nucleotide sequence of the TaqMan probe VHSV-1-P is shown in SEQ ID NO:

6. (3) Primers and TaqMan probes for real-time quantitative PCR detection of Vibrio anguillarum, wherein: The nucleotide sequence of the upstream primer VIBRIO-2-F is shown in SEQ ID NO:7, the nucleotide sequence of the downstream primer VIBRIO-2-R is shown in SEQ ID NO:8, and the nucleotide sequence of the TaqMan probe VIBRIO-2-P is shown in SEQ ID NO:

9.

2. The triple RT-qPCR kit as described in claim 1, characterized in that, The TaqMan probe IHNV-1-P has a HEX emission group labeled at its 5' end and a BHQ1 quenching group labeled at its 3' end.

3. The triple RT-qPCR kit as described in claim 1, characterized in that, The TaqMan probe VHSV-1-P has a 6-FAM emitting group labeled at its 5' end and a BHQ1 quenching group labeled at its 3' end.

4. The triple RT-qPCR kit as described in claim 1, characterized in that, The TaqMan probe VIBRIO-2-P is labeled with a CY5 emitting group at its 5' end and a BHQ3 quenching group at its 3' end.

5. The triple RT-qPCR kit according to any one of claims 1-4, characterized in that, The kit also includes an enzyme premix, a positive control, a negative control, and a molecular crowding agent. The positive control is a mixture of positive plasmids for infectious hematopoietic necrosis virus, viral hemorrhagic septicemia virus, and Vibrio anguillarum. The negative control is ultrapure water.

6. The triple RT-qPCR kit as described in claim 5, characterized in that, The molecular crowding agent is PEG8000.

7. A triple RT-qPCR method for simultaneous detection of rainbow trout IHNV, VHSV, and Vibrio anguillarum, characterized in that, Includes the following steps: (1) Extract RNA and DNA from the sample to be tested; (2) Using the RNA and DNA obtained in step (1) as templates, and employing the kit described in claim 1, establish the following reaction system: 1 μL template, 4 μL enzyme premix, 1.2 μL each of INV-1-F and IHNV-1-R, 2.4 μL each of VHSV-1-F and VHSV-1-R, 1.6 μL each of VIBRIO-2-F and VIBRIO-2-R, 0.26 μL each of IHNV-1-P, 0.26 μL each of VHSV-1-P, 0.34 μL each of VIBRIO-P, and 3.74 μL ultrapure water; (3) Using the reaction system established in step (2), and using the channel settings adapted to detect the fluorescence emitted by the CY5 emitting group, 6-FAM emitting group, and HEX emitting group, reverse transcription and amplification were performed according to the following program: 55℃ for 15 min, 1 cycle; 95℃ for 30 s, 1 cycle; 95℃ for 10 s, 60℃ for 30 s, 40 cycles; (4) For quantitative detection, the positive control provided in this kit is used to prepare plasmid standards containing at least five gradient concentrations. Each plasmid standard contains positive controls of infectious hematopoietic necrosis virus, viral hemorrhagic septicemia virus, and Vibrio anguillarum at equal concentrations. Using the selected plasmid standards at each concentration as templates, the real-time fluorescence quantitative PCR primers and TaqMan probes described in claim 1 are used to perform detection according to the reaction system and reaction procedure established in steps (2) and (3). The concentration logarithm of each plasmid standard is plotted against its corresponding Ct value, and a standard curve is obtained by linear regression analysis. (5) For qualitative detection, when the Ct value is ≤35 and there is a specific amplification curve in the HEX channel, the sample is determined to have a positive test result for infectious hematopoietic necrosis virus, that is, the sample contains infectious hematopoietic necrosis virus; when the Ct value is ≤35 and there is a specific amplification curve in the 6-FAM channel, the sample is determined to have a positive test result for viral hemorrhagic septicemia virus, that is, the sample contains viral hemorrhagic septicemia virus; when the Ct value is ≤35 and there is a specific amplification curve in the CY5 channel, the sample is determined to have a positive test result for Vibrio anguillarum, that is, the sample contains Vibrio anguillarum.

8. The triple RT-qPCR method as described in claim 7, characterized in that, When the predicted pathogen detection concentration in the sample is low, PEG8000 is added to the reaction system and the concentration is adjusted so that the reaction system contains a final concentration of 4% w / v of PEG8000.

Images