Dendritic cell-targeted recombinant lactobacillus for expressing clostridium perfringens multiple antigens as well as construction method and application of dendritic cell-targeted recombinant lactobacillus

By constructing recombinant lactobacilli that target dendritic cells and utilizing fusion genes to achieve active targeting of dendritic cells and lysosomal escape of antigens, the shortcomings of traditional recombinant lactic acid bacteria vaccines in antigen delivery efficiency and immune activation ability have been overcome, resulting in a stronger immune response.

CN121759384AActive Publication Date: 2026-03-31JILIN AGRICULTURAL UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-05
Publication Date
2026-03-31

AI Technical Summary

Technical Problem

Traditional recombinant lactic acid bacteria vaccines are difficult for gut-associated antigen-presenting cells to actively recognize and capture, resulting in weak immunogenicity, low antigen delivery efficiency, and difficulty in blocking the adhesion and colonization of pathogenic bacteria, thus failing to effectively activate cellular immune responses.

Method used

A recombinant lactobacillus targeting dendritic cells was constructed. By expressing the fusion gene PgsA'-fimA-LysM-Fba-Pas-LP1261-NetB-phi54, active targeting of dendritic cells and lysosomal escape of antigens were achieved, thereby enhancing the immune response.

Benefits of technology

It significantly improved the capture efficiency of DC cells for recombinant bacteria, induced stronger humoral, mucosal, and cellular immune responses, and effectively reduced the severity of necrotizing enteritis in chickens.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121759384A_ABST
    Figure CN121759384A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to recombinant lactobacillus for expressing clostridium perfringens multiple antigens of targeted dendritic cells as well as a construction method and application of the recombinant lactobacillus. The recombinant lactobacillus contains an expression vector for expressing a fusion gene; the fusion gene comprises sequences for coding and expressing a PgsA '-fimA fusion protein, a LysM-Fba fusion protein, an LP1261-NetB fusion protein, a phi54 targeting element and a Pas escape element; a sequence for coding the PgsA '-fimA fusion protein is shown as SEQ ID NO: 1, a sequence for coding the LysM-Fba fusion protein is shown as SEQ ID NO: 2, and a sequence for coding the LP1261-NetB fusion protein is shown as SEQ ID NO: 3. When the recombinant lactobacillus is used for immunizing animals, mucosal immunity, cellular immunity and humoral immunity reactions can be induced, the immunocompetence of organisms can be comprehensively enhanced, and the recombinant lactobacillus can be used for preparing oral vaccines for prevention and control of chicken necrotic enteritis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a recombinant lactobacillus that expresses Clostridium perfringens multiple antigens targeting dendritic cells, its construction method, and its application. Background Technology

[0002] Necrotic enteritis (NE) in chickens is caused by Clostridium perfringens (Clostridium perfringens). Clostridium perfringens Clostridium perfringens, a major intestinal disease caused by SARS-CoV-2, poses a serious threat to the healthy development of the global poultry industry. Currently, the main pathogen is Clostridium perfringens type G, and its pathogenic mechanism is closely related to various virulence factors.

[0003] Currently, the control of necrotizing enterocolitis (NE) mainly relies on antibiotics. However, with the increasing prominence of bacterial resistance, the development of a vaccine for necrotizing enterocolitis in chickens has become an urgent problem to be solved in the poultry industry. Lactic acid bacteria, as oral vaccine carriers, have significant advantages such as high safety and the ability to effectively induce mucosal immune responses. However, traditional recombinant lactic acid bacteria vaccines are difficult for intestinal-associated antigen-presenting cells (such as dendritic cells, DCs) to actively recognize and capture, resulting in weak immunogenicity and low antigen delivery efficiency. Even when phagocytosed by DCs, the recombinant bacteria and their carried antigens are often trapped and degraded in phagosomes / lysosomes, making it difficult for them to escape into the cytoplasm and enter the MHC-I molecule presentation pathway, thus failing to effectively activate cellular immune responses. At the same time, traditional recombinant lactic acid bacteria vaccines cannot completely block the adhesion and intestinal colonization processes of pathogenic bacteria.

[0004] Therefore, developing a highly efficient oral vaccine that can simultaneously cover multiple key antigens, has cell-targeting capabilities, and can achieve lysosomal escape has become a current research focus and urgent direction in this field. Summary of the Invention

[0005] To address the shortcomings of the existing technology, the purpose of this invention is to provide a recombinant Lactobacillus that expresses Clostridium perfringens multiple antigens targeting dendritic cells, its construction method, and its application.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides a recombinant Lactobacillus expressing Clostridium perfringens multiple antigens targeting dendritic cells, wherein the recombinant Lactobacillus contains an expression vector expressing a fusion gene; the fusion gene comprises sequences encoding PgsA'-fimA fusion protein, LysM-Fba fusion protein, LP1261-NetB fusion protein, phi54 targeting element, and Pas escape element; the connection order of the parts of the fusion gene is: pgsA'-fimA-LysM-Fba-Pas-LP1261-NetB-phi54; the sequence encoding PgsA'-fimA fusion protein is shown in SEQ ID NO:1, the sequence encoding LysM-Fba fusion protein is shown in SEQ ID NO:2, and the sequence encoding LP1261-NetB fusion protein is shown in SEQ ID NO:3.

[0008] A second aspect of the present invention provides a method for constructing the above-mentioned recombinant lactobacillus, comprising the following steps: The expression vector containing the fusion gene was transformed into host cells; the nucleotide sequence of the fusion gene is shown in SEQ ID NO:4.

[0009] A third aspect of the invention provides a vaccine comprising the aforementioned recombinant lactobacillus.

[0010] In a fourth aspect, the invention provides a composition comprising the recombinant lactobacillus described above.

[0011] A fifth aspect of the invention provides the use of the above-described recombinant lactobacillus or vaccine or composition in the preparation of products for the prevention and control of necrotizing enteritis in chickens.

[0012] Compared with the prior art, the technical solution of the present invention has the following beneficial effects: This invention constructed a multifunctional recombinant expression plasmid pYL590 and transformed it into *Lactobacillus plantarum* NC8. In vitro experiments showed that dendritic cells (DCs) captured the recombinant bacteria with significantly higher efficiency than the non-targeted control strain. NC8 (pYL590) more efficiently induced DC maturation, significantly upregulating the mRNA expression levels of maturation markers such as CCR7, CCL5, CD83, and CD86, thereby inducing a stronger comprehensive immune response at the humoral, mucosal, and cellular levels. In a *Clostridium perfringens* challenge experiment, the NC8 (pYL590) immunized group had the lowest intestinal lesion score (average 1.0 point), with approximately 50% of individuals showing no obvious gross lesions, significantly reducing the damage caused by necrotizing enteritis in chickens. Immunizing animals with the aforementioned recombinant *Lactobacillus* can induce mucosal, cellular, and humoral immune responses, comprehensively enhancing the body's immune capacity. This recombinant *Lactobacillus plantarum* can be used to produce an oral vaccine for the prevention and control of necrotizing enteritis in chickens. Attached Figure Description

[0013] Figure 1 This is a schematic diagram of the expression cassette structure of the pYL561 plasmid and the pYL590 plasmid in an embodiment of the present invention; wherein, A is the expression cassette structure of the pYL561 plasmid; and B is the expression cassette structure of the pYL590 plasmid.

[0014] Figure 2 This is a schematic diagram of the antigen expression detection results using Western Blot in an embodiment of the present invention. In this diagram, A represents the protein expressed by FimA-specific primary antibodies pYL561 and pYL590 after incubation; B represents the protein expressed by Fba-specific primary antibodies pYL561 and pYL590 after incubation; C represents the protein expressed by NetB-specific primary antibodies pYL561 and pYL590 after incubation; and D represents the protein expressed by MYC-specific primary antibody pYL590 (phi54-MYC) after incubation.

[0015] Figure 3 In this embodiment of the invention, after incubation with the fimA-specific primary antibody, laser confocal microscopy (CLSM) was used to verify the anchoring effect of the anchoring proteins pYL561 and pYL590. In the figure, fimA-FLAG represents the fimA-specific primary antibody incubation group, Blank represents the blank control group, and Merged represents the merged group, which means that the images of different fluorescence channels are merged into one image.

[0016] Figure 4 In this embodiment of the invention, after incubation with NetB-specific primary antibody, laser confocal microscopy (CLSM) was used to verify the anchoring effect of pYL561 and pYL590 anchoring proteins. In the figure, NetB-FLAG represents the group incubated with NetB-specific primary antibody, Blank represents the blank control group, and Merged represents the merged group, which means that images of different fluorescence channels are merged into one image.

[0017] Figure 5 In this embodiment of the invention, after incubation with Fba-specific primary antibody, laser confocal microscopy (CLSM) was used to verify the anchoring effect of pYL561 and pYL590 anchoring proteins. In the figure, Fba-FLAG represents the Fba-specific primary antibody incubation group, Blank represents the blank control group, and Merged represents the merged group, which means that images of different fluorescence channels are merged into one image.

[0018] Figure 6These are transmission electron microscope (TEM) images of bone marrow-derived dendritic cells after co-incubation with PBS, NC8 (pYL561), and NC8 (pYL590) in an embodiment of the present invention; wherein, A is a TEM image of bone marrow-derived dendritic cells after co-incubation with PBS; B is a magnified view of A; C is a TEM image of bone marrow-derived dendritic cells after co-incubation with NC8 (pYL561); D is a magnified view of C; E is a TEM image of bone marrow-derived dendritic cells after co-incubation with NC8 (pYL590); and F is a magnified view of E.

[0019] Figure 7 These are laser confocal microscopy images of bone marrow-derived dendritic cells after co-incubation with PBS, NC8 (pYL561), and NC8 (pYL590) in embodiments of the present invention; wherein, A is a CLSM image of bone marrow-derived dendritic cells after co-incubation with PBS; B is a magnified view of A; C is a CLSM image of bone marrow-derived dendritic cells after co-incubation with NC8 (pYL561); D is a magnified view of C; E is a CLSM image of bone marrow-derived dendritic cells after co-incubation with NC8 (pYL590); and F is a magnified view of E.

[0020] Figure 8 This is an analysis of the average fluorescence intensity of intracellular bacteria in an embodiment of the present invention. (Figure 1) This indicates that P < 0.01. This means P < 0.0001.

[0021] Figure 9 In this embodiment of the invention, flow cytometry was used to detect the uptake capacity of DCs on FITC-labeled bacteria.

[0022] Figure 10 This is a statistical analysis of the mean fluorescence intensity (MFI) of FITC-labeled bacteria flow cytometry results in this embodiment of the invention; in the figure, This means P < 0.0001.

[0023] Figure 11 In this embodiment of the invention, RT-qPCR was used to detect the relative mRNA expression levels of maturation-related factors after DCs were co-incubated with PBS, LPS (positive control), NC8 (pYL561), and NC8 (pYL590). In the figure, A represents the relative expression level of CCL5; B represents the relative expression level of CCR7; C represents the relative expression level of CD83; and D represents the relative expression level of CD86. This indicates that P < 0.05. This indicates that P < 0.01. This indicates that P < 0.001. This means P < 0.0001.

[0024] Figure 12 In this embodiment of the invention, laser scanning confocal microscopy (CLSM) was used to observe the intracellular localization and quantification results of CFSE-labeled bacteria and Lyso-Tracker Red-labeled lysosomes in chicken bone marrow-derived dendritic cells (chBM-DCs). Among them, A and B are the observation images and quantification results of the control strain NC8 (pYL578) group after co-incubation for 4 h; C and D are the observation images and quantification results of the control strain NC8 (pYL578) group after co-incubation for 16 h; E and F are the observation images and quantification results of the strain NC8 (pYL590) group after co-incubation for 4 h; and G and H are the observation images and quantification results of the strain NC8 (pYL590) group after co-incubation for 16 h.

[0025] Figure 13 This is a diagram illustrating the animal experiment design in an embodiment of the present invention.

[0026] Figure 14 The values ​​of IgA and IgM antibodies in the intestinal mucosa were detected by specific enzyme-linked immunosorbent assays (ELISA) using NetB, fimA, and Fba on the seventh day after the second immunization in this embodiment of the invention. Wherein, A is the absorbance of slgA in Fba intestinal lavage fluid; B is the absorbance of slgA in NetB intestinal lavage fluid; C is the absorbance of slgA in fimA intestinal lavage fluid; D is the absorbance of IgM in Fba intestinal lavage fluid; E is the absorbance of IgM in NetB intestinal lavage fluid; and F is the absorbance of IgM in fimA intestinal lavage fluid.

[0027] Figure 15 The values ​​of intestinal mucosal IgG and serum IgG antibody titers were obtained by specific enzyme-linked immunosorbent assay (ELISA) of NetB, FimA, and Fba on the seventh day after the second immunization in this embodiment of the invention. Wherein, A is the absorbance of IgG in Fba intestinal lavage fluid; B is the absorbance of IgG in NetB intestinal lavage fluid; C is the absorbance of IgG in fimA intestinal lavage fluid; D is the absorbance of IgG in Fba serum; E is the absorbance of IgG in NetB serum; and F is the absorbance of IgG in fimA serum.

[0028] Figure 16The figures show the intestinal mucosal IgA and IgM antibody titers obtained by specific enzyme-linked immunosorbent assay (ELISA) using NetB, fimA, and Fba methods one day prior to challenge in this embodiment of the invention. Wherein, A represents the absorbance of slgA in Fba intestinal lavage fluid; B represents the absorbance of slgA in fimA intestinal lavage fluid; C represents the absorbance of slgA in NetB intestinal lavage fluid; D represents the absorbance of IgM in Fba intestinal lavage fluid; E represents the absorbance of IgM in NetB intestinal lavage fluid; and F represents the absorbance of IgM in fimA intestinal lavage fluid. (Figure 1 shows...) This indicates that P < 0.05. This indicates that P < 0.01. This indicates that P < 0.001. This means P < 0.0001.

[0029] Figure 17 The figures show the intestinal mucosal IgG and serum IgG antibody titers obtained by specific enzyme-linked immunosorbent assay (ELISA) using NetB, fimA, and Fba the day before challenge in this embodiment of the invention; where A is the absorbance of IgG in Fba intestinal lavage fluid; B is the absorbance of IgG in NetB intestinal lavage fluid; C is the absorbance of IgG in fimA intestinal lavage fluid; D is the absorbance of IgG in Fba serum; E is the absorbance of IgG in NetB serum; and F is the absorbance of IgG in fimA serum. This indicates that P < 0.05. This indicates that P < 0.01. This indicates that P < 0.001.

[0030] Figure 18 In this embodiment of the invention, on the seventh day after the second immunization and the day before challenge, ConA, a mixture of NetB, FimA, and Fba proteins were used as stimulants. Cell proliferation levels were analyzed using a CCK-8 assay kit. After 48 hours of stimulation with NetB, FimA, and Fba proteins, the intracellular mRNA levels of IL-4 and IFN-γ and their relative concentrations in the cell culture supernatant were measured by real-time quantitative polymerase chain reaction (qRT-PCR) and ELISA, respectively. In the figure, A and B represent the CCK-8 results on the seventh day after the second immunization, C and D represent the CCK-8 results on the day before challenge, E represents the relative expression level of IFN-γ, F represents the relative expression level of IL-4, G represents the ELISA results of IFN-γ, and H represents the ELISA results of IL-4. This indicates that P < 0.05. This indicates that P < 0.01.

[0031] Figure 19 This invention illustrates the observation of IgA secretion in chicken jejunum tissue sections using laser confocal microscopy in this embodiment. A represents the PBS group; B represents the NC8 group; C represents the NC8 (pYL561) group; D represents the NC8 (pYL590) group; and E represents the average fluorescence intensity analysis for each group. In the figure, blue fluorescence (DAPI) labels the cell nuclei, and green fluorescence (FITC) labels the IgA positive signal. This indicates that P < 0.01.

[0032] Figure 20 This invention illustrates the observation of IgA secretion in ileum tissue sections using laser confocal microscopy in various groups. A represents the PBS group; B represents the NC8 group; C represents the NC8 (pYL561) group; D represents the NC8 (pYL590) group; and E represents the average fluorescence intensity analysis for each group. In the figure, blue fluorescence (DAPI) labels the cell nuclei, and green fluorescence (FITC) labels the IgA positive signal. This indicates that P < 0.05. This indicates that P < 0.01.

[0033] Figure 21 The figures show the lesion scores of the PBS group, NC8 group, NC8 (pYL561) group, and NC8 (pYL590) group in this embodiment of the invention. This indicates that P < 0.05. This means P < 0.0001. Detailed Implementation

[0034] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0035] As mentioned earlier, traditional recombinant lactic acid bacteria vaccines suffer from low antigen delivery efficiency and weak cellular immune activation. This invention provides an oral vaccine for necrotizing enteritis in chickens that can efficiently induce humoral, cellular, and mucosal immunity. Its active ingredient, *Lactobacillus plantarum* (NC8-pYL590), not only simultaneously displays three key antigens of *Clostridium perfringens* type G (NetB, FimA, and Fba) on its surface, but also incorporates phi54 nanobody for active targeting of chicken dendritic cells (DCs) and Pas peptide to assist antigen escape from lysosomes.

[0036] In a typical embodiment of the present invention, a recombinant lactobacillus expressing Clostridium perfringens multiple antigens targeting dendritic cells is provided. The recombinant lactobacillus contains an expression vector expressing a fusion gene. The fusion gene includes sequences encoding PgsA'-fimA fusion protein, LysM-Fba fusion protein, LP1261-NetB fusion protein, phi54 targeting element, and Pas escape element. The connection order of the various parts of the fusion gene is: pgsA'-fimA-LysM-Fba-Pas-LP1261-NetB-phi54. The sequence encoding PgsA'-fimA fusion protein is shown in SEQ ID NO:1, the sequence encoding LysM-Fba fusion protein is shown in SEQ ID NO:2, and the sequence encoding LP1261-NetB fusion protein is shown in SEQ ID NO:3.

[0037] The term “expression” refers to the cellular processes involved in the production of RNA and proteins, and, where appropriate, the secretion of proteins, including, but not limited to, transcription, transcript processing, translation, and protein folding, modification, and processing, as applicable.

[0038] The term “encoding” includes references to nucleotides and / or amino acids that correspond to other nucleotides or amino acids in the sense of transcription and / or translation.

[0039] The recombinant lactobacillus described in this invention contains NetB (a core virulence factor), FimA (a key protein for adhesion and colonization), and Fba (a dual-function protein for metabolism and adhesion), covering key pathogenic processes. Utilizing three anchoring proteins—pgsA', LysM, and LP1261—the aforementioned antigens are efficiently anchored to the surface of the recombinant lactobacillus cell wall, mimicking the pathogen antigen exposure state. Simultaneously, the invention innovatively introduces the phi54 nanobody, which specifically recognizes molecules on the surface of chicken dendritic cells (DCs), and expresses it in the antigen complex. This endows the vaccine with the ability to actively "seek" and bind to DC cells. The introduction of the intracellular escape element (Pas) helps the antigen escape from the lysosomes of DC cells into the cytoplasm, enhancing antigen cross-presentation.

[0040] In one embodiment, the starting strain of the recombinant lactobacillus is *Lactobacillus plantarum* (Lactobacillus). Lactobacillus plantarum ).

[0041] In one embodiment, the starting strain of the recombinant lactobacillus is *Lactobacillus plantarum* (Lactobacillus). Lactobacillus plantarum NC8.

[0042] In another typical embodiment of the present invention, a method for constructing the above-mentioned recombinant lactobacillus is provided, comprising the following steps: The expression vector containing the fusion gene was transformed into host cells; the nucleotide sequence of the fusion gene is shown in SEQ ID NO:4.

[0043] The recombinant lactobacillus of the present invention can also insert the fusion gene into the chromosome of the starting strain using conventional methods. Any known genetic engineering method can be used to insert the gene into the chromosome of the starting strain. For example, methods using retroviral vectors, adenovirus vectors, adeno-associated virus vectors, herpes simplex virus vectors, poxvirus vectors, lentiviral vectors, and non-viral vectors are available.

[0044] A "vector" is a DNA product containing a DNA sequence that is operatively linked to a suitable regulatory sequence capable of expressing that DNA in a suitable host. Vectors can be plasmids, phage particles, or simple potential genomic inserts. When transformed into a suitable host, vectors can be replicated or perform functions independent of the host genome, or some can integrate with the genome. Plasmids are currently the most commonly used form of vector.

[0045] Typical plasmid vectors include (a) an origin of replication for efficient replication, such that a predetermined number of plasmid vectors are contained in each host cell; (b) an antibiotic resistance gene or auxotrophic marker gene to screen host cells transformed with the plasmid vector; and (c) a restriction enzyme site for inserting a foreign DNA fragment. Even if a suitable restriction enzyme site is not available, the vector and foreign DNA can be easily ligated using synthetic oligonucleotide adaptors or linkers according to conventional methods (Gibson assembly). If necessary, methods that synthesize the entire desired sequence are also typically used.

[0046] Furthermore, when a nucleic acid sequence aligns with another nucleic acid sequence based on their functional relationship, it is said to be "operably linked" to it. This can be a gene and a control sequence linked in such a way that gene expression is possible when a suitable molecule (e.g., a transcription activator protein) is linked to the control sequence. For example, when expressed as a pre-protein involved in polypeptide secretion, the DNA for the pre-sequence or secretion leader sequence is operably linked to the DNA of the polypeptide; when influencing the transcription of the sequence, a promoter or enhancer is operably linked to the coding sequence; when influencing the transcription of the sequence, a ribosome binding site is operably linked to the coding sequence; or when localized to promote translation, a ribosome binding site is operably linked to the coding sequence.

[0047] Typically, the term "operably ligated" means that the ligated DNA sequence is in contact with it, or that the secretory leader sequence is in contact with it and present in the reading frame. However, enhancers do not need to be in contact with it. The ligation of these sequences is achieved by binding (ligation) to a convenient restriction enzyme site. When such a site is not available, synthetic oligonucleotide adaptors or linkers are used according to conventional methods.

[0048] It should be understood that not all vectors function identically when expressing the DNA sequences of this invention. Similarly, not all hosts function identically for the same expression system. However, those skilled in the art will be able to make appropriate selections from a variety of vectors, expression control sequences, and hosts without incurring excessive experimental burden and without departing from the scope of this invention. For example, the host should be considered when selecting a vector, as the vector should replicate within it. The number of times the vector replicates, the ability to control the number of times the vector replicates, and the expression of other proteins encoded by the corresponding vector, such as the expression of antibiotic markers, should also be considered.

[0049] The terms “host,” “host cell,” “host cell line,” and “host cell culture” are used interchangeably and refer to cells in which exogenous nucleic acids have been introduced, including the progeny of such cells. Host cells include “transformations” and “transformed cells,” which include primary transformed cells and their derived progeny, regardless of passage number. The nucleic acid content of progeny cells may not be exactly the same as that of parent cells, but may contain mutations. Mutant progeny cells having the same function or biological activity as those screened or selected in the initially transformed cells are included herein. Host cells are any type of cell system that can be used to produce the fusion proteins of the present invention. Host cells include cultured cells, such as bacterial cells, such as Escherichia coli (e.g., Escherichia coli), Lactococcus (e.g., Lactococcus lactis), Bacillus, Lactobacillus, Pseudomonas, Streptomyces, Corynebacterium, and halophilic bacteria; mammalian cultured cells, such as CHO cells, BHK cells, NSO cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells or hybridoma cells; yeast cells; insect cells; and plant cells (to name just a few); as well as cells contained in transgenic animals, transgenic plants, or cultured plant or animal tissues.

[0050] This document discloses recombinant host cells containing expressed fusion genes as defined herein. In one embodiment, the host cell is *Escherichia coli* or *Lactobacillus plantarum*. Lactobacillus plantarum ).

[0051] Recombinant lactobacilli can be prepared using any transformation method. The term "transformation" refers to the introduction of DNA into a host, enabling the DNA to replicate as a component of a chromosome or through chromosome integration; it signifies the artificial induction of genetic changes by introducing exogenous DNA into cells. Common transformation methods include electroporation and lithium acetate-polyethylene glycol (PEG).

[0052] In another typical embodiment of the present invention, a composition is provided comprising the above-described recombinant lactobacillus.

[0053] When the intended use is to elicit or enhance an immune response, the composition is referred to as an "immunogenic" or "immunomodulatory" composition. Such compositions include prophylactic compositions and therapeutic compositions.

[0054] In some embodiments, the composition may include a buffer and may also include other substances suitable for the intended use.

[0055] Those skilled in the art can readily select suitable buffers for the intended use, many of which are known in the art. In some cases, the composition may contain pharmaceutically acceptable excipients, many of which are known in the art and need not be discussed in detail herein. Pharmaceutically acceptable excipients have been well described in various publications, including, for example, A. Gennaro (2000) "Remington: The Science and Practice of Pharmacy", 20th edition, Lippincott, Williams, & Wilkins; Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) H. Ansel et al., eds. 7. sup. th ed., Lippincott, Williams, & Wilkins; and Handbook of Pharmaceutical Excipients (2000) A. H. Bibbe et al., eds. 3. sup. rd ed. Amer. Pharmaceutical Association.

[0056] In one embodiment, the recombinant lactobacillus is encapsulated. The recombinant lactobacillus may, for example, be encapsulated in chitosan-coated alginate beads.

[0057] In one embodiment, the composition is a freeze-dried or hydrated composition. Recombinant lactobacillus can be used in hydrated or dried form. The drying process can be any system that maintains the integrity of the bacterial cell wall and bound proteins, including freeze-drying and spray drying.

[0058] In another typical embodiment of the present invention, a vaccine is provided which comprises the above-described recombinant lactobacillus.

[0059] In one implementation, the vaccine is a vector vaccine, particularly a live vector vaccine.

[0060] In another typical embodiment of the present invention, the use of the above-mentioned recombinant lactobacillus or vaccine or composition in the preparation of products for the prevention and control of necrotizing enteritis in chickens is provided.

[0061] In one embodiment, the necrotizing enteritis in chickens is necrotizing enteritis caused by Clostridium perfringens type G.

[0062] In one embodiment, the product is a microbial agent, a pharmaceutical preparation, or feed. The pharmaceutical preparation is a biological product or a live vector vaccine.

[0063] In one embodiment, the present invention discloses a method for preventing or treating necrotizing enteritis in chickens, the method comprising administering to a subject recombinant lactobacillus or a composition or vaccine as defined herein.

[0064] In one implementation, the subject is a chicken.

[0065] In one implementation, recombinant lactobacillus is prepared into a bacterial suspension and administered orally to prevent or treat necrotizing enterocolitis caused by Clostridium perfringens type G.

[0066] As used herein, the term "therapeutic effective amount" includes, within its meaning, a sufficient amount of non-toxic but recombinant lactobacillus or a combination thereof to provide the desired therapeutic effect. The exact amount required will vary from subject to subject, depending on factors such as the species being treated, the subject's age and general condition, the severity of the condition being treated, the specific drug administered, and the method of administration. The effective amount is sufficient to induce an immune response in the subject, thereby preventing and / or treating necrotizing enterocolitis in chickens. Therefore, it is impossible to specify an exact "effective amount." However, for any given situation, a suitable "effective amount" can be determined by a person skilled in the art using only routine experimental methods.

[0067] The terms “treatment,” “curing,” and similar terms are used interchangeably herein to mean the reduction, decrease, relief, improvement, or otherwise suppression of a condition, including one or more symptoms of the condition. The terms “prevent,” “avoid,” “prevent,” “preventive,” “preventive,” and similar terms are used interchangeably herein to mean the prevention or delay of the onset of a condition, or the risk of developing a condition.

[0068] The terms “treatment,” “cure,” and similar terms also include the reduction, decrease, relief, improvement, or other suppression of the effects of a condition for at least a period of time. It should also be understood that the terms “treatment,” “cure,” and similar terms do not imply a permanent reduction, decrease, relief, improvement, or other suppression of the condition or its symptoms, and therefore also include temporary reduction, decrease, relief, improvement, or other suppression of the condition or its symptoms.

[0069] As used herein, “immune response” refers to the response of a subject’s immune system. For example, an immune response can be directed against antigens / immunogens that the subject’s immune system recognizes as foreign (e.g., non-self antigens) or self (e.g., recognized as foreign self antigens). Immune responses can be humoral, involving the production of immunoglobulins or antibodies, or cellular, involving various types of B and T lymphocytes, dendritic cells, macrophages, antigen-presenting cells, etc., or both. Immune responses may also involve the production or processing of various effector molecules such as cytokines. The term “immune response” includes an immunogenic response that causes, activates, initiates, stimulates, or induces an immune response against a specific antigen (e.g., an antigen of a pathogenic organism) or an organism (e.g., a pathogenic microorganism) in a subject, as well as an immunosuppressive or tolerance-inducing immune response that inhibits, prevents, reduces, or eliminates an immune response to an allergen or self-antigen or cells, tissues, or organs expressing such an antigen, or renders the immune system unresponsive to an allergen or self-antigen or cells, tissues, or organs expressing such an antigen, or delays the occurrence or initiation of an immune response to an allergen or self-antigen or cells, tissues, or organs expressing such an antigen.

[0070] References to any prior publications (or information derived therefrom) or any known matters in this specification are not and should not be construed as endorsement or acknowledgment or any form of implication that such prior publications (or information derived therefrom) or known matters constitute part of the general knowledge in the relevant field of this specification.

[0071] Those skilled in the art will understand that variations and modifications can be made to the invention described herein, in addition to the specific description. It should be understood that the invention includes all such variations and modifications falling within its spirit and scope. The invention also includes all steps, features, compositions, and compounds individually or collectively mentioned or pointed to in this specification, as well as any and all combinations of any two or more of the stated steps or features.

[0072] The experimental materials and reagents used in the following examples are from the following sources: Escherichia coli TOP10 was purchased from Sangon Biotech, catalog number B528412, and the G-type Clostridium perfringens was isolated in the laboratory; L. plantarumNC8 was a silage isolate, kindly provided by Senior Researcher Anbazhagan K. Kamalaj University, India. The strain was originally derived from Thea aukrust (1992). The seamless cloning kit was purchased from Novizan, catalog number C116-01 / 02. The pYL490, pYL439, and pYL531 vectors were constructed in the early stages of the experiment. The nucleotide sequence of pYL490 is shown in SEQ ID NO:5, the nucleotide sequence of pYL439 is shown in SEQ ID NO:6, and the nucleotide sequence of pYL531 is shown in SEQ ID NO:7.

[0073] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0074] Example 1 Construction and identification of recombinant lactobacillus To construct a highly effective vaccine against norepinephrine (NE), we designed a basic vector pYL561 that fused to express the triple antigens FimA, Fba, and NetB. Based on this, we introduced the phi54 targeting element and the Pas escape element to construct pYL590. The detailed scheme is as follows: 1. Construction and identification of recombinant plasmids: Based on the pYL490 vector, a series of recombinant plasmids were constructed using a multi-step enzyme digestion and ligation strategy, as follows: (1) pYL510 (P23-pgsA'-fimA): Using pYL439 template, the fimA fragment was amplified by primers (FimA-F:TATtctagaagcaacctgccgagc, SEQ ID NO:8; FimA-R:GCGctcgagttagttgttcatcac, SEQ ID NO:9). The amplified product was digested with XbaI / XhoI to obtain the digested fragment. The amplified product and pYL490 vector were digested with XbaI / XhoI, respectively. The product fragment and the linearized vector fragment were recovered and ligated to construct the basic anchoring vector pYL510.

[0075] (2) pYL533 (P23-pgsA'-fimA-LP1261-NetB): The pYL510 plasmid was digested with NheI / XhoI sites to obtain a linearized fragment; the LP1261-NetB sequence (SEQ ID NO:2) was synthesized, and primers (LP1261-F:TAGctcgagaggaaacagaccatg, SEQ ID NO:10; NetB-R:GCGgctagcttacagataatattc, SEQ ID NO:11) were designed for amplification. The amplified product was digested with NheI / XhoI sites to obtain the digested fragment; the linearized fragment of the vector was ligated with the digested fragment of the amplified product to obtain the plasmid pYL533.

[0076] (3) pYL538 (P23-pgsA'-fimA-LysM-Fba-LP1261-NetB): pYL533 plasmid was digested with XhoI to obtain a linearized fragment; the LysM-Fba sequence (SEQ ID NO:3) was synthesized, and primers (LysM-F: TAACTCGAGATGAAAAAATTGGTTTCAACGATTG, SEQ ID NO:12; LysM-R: TTTAATACTTAACTTTTGACCTGGTAAAAT, SEQ ID NO:13) were designed to amplify the LysM-Fba sequence. The amplified product was seamlessly cloned and ligated with the linearized fragment to complete the construction of the triple antigen vector pYL538.

[0077] (4) pYL561 (Plac-pgsA'-fimA-LysM-Fba-LP1261-NetB): The pYL531 plasmid was digested with Kpnl / Ndel sites to obtain a linearized fragment; using pYL538 as a template, primers (538-F:ATGGGTACCGGGAAGAAAGAATTAAG, SEQ ID NO:14; 538-R:GGAATTCCATAT AGGAAGCTTGCT, SEQ ID NO:15) were designed to amplify the multi-antigen expression cassette in pYL538, and the amplified product was digested with Kpnl / Ndel sites to obtain the digested fragment; by ligating the linearized fragment of the vector with the digested fragment of the amplified product, the plasmid pYL561 was obtained. The nucleotide sequence of the plasmid is shown in SEQ ID NO:25, and its expression cassette structure is as follows. Figure 1 As shown in A in the diagram.

[0078] (5) pYL578 (Plac-pgsA'-fimA-LysM-Fba-LP1261-NetB-phi54): The pYL561 plasmid was digested with Smal / Ndel sites to obtain a linearized fragment; using pYL561 and phi54 (SEQ ID NO:16) as templates, primers were designed (561-NetB-F:aggaaacagaccatagcccgggATGAATTTCAAAACAGC, SEQ ID NO:17; 561-NetB-R:gatcagcttctgctcCAGATAATATTCAATTTTATGA, SEQ ID NO:18; phi54-F:atctgGAGCAGAAGCTGATCAGCGAG, SEQ ID NO:19; phi54-R:ccgtttgcgtaccttcatatgttaCTGCG, SEQ ID NO:19). NO:20) Amplify the NetB and phi54 fragments, and seamlessly clone the amplification products with the enzyme-digested vector to obtain plasmid pYL578.

[0079] (6) pYL590 (Plac-pgsA'-fimA-LysM-Fba-Pas-LP1261-NetB-phi54): The pYL578 plasmid was digested at the Xhol site to obtain a linearized fragment; using pYL578 and Pas (SEQ ID NO) as templates, primers were designed (578-Fba-F:gtgatgaacaactaactcgagATGAAAAAATTGGTTTCAACGATTG, SEQ ID NO:21; 578-Fba-R:gcgccgTTAAGCTCTGTTTACTGAACCGAACA, SEQ ID NO:22; Pas-F:taaacagagcttaaCGGCGCCGTCAACGTCGT, SEQ ID NO:23; Pas-R:catggtctgtttcctctcgagTCCTTTTGGAATTAAAAAAAAACGA, SEQ ID NO:23; Pas-R:catggtctgtttcctctcgagTCCTTTTGGAATTAAAAAAAAACGA, SEQ ID NO:24). NO:24) Amplify the Fba and Pas fragments, and seamlessly clone the amplified products with the enzyme-digested vector to obtain plasmid pYL590. The nucleotide sequence of the plasmid is shown in SEQ ID NO:26, and its expression cassette structure is as follows. Figure 1 As shown in B in the diagram.

[0080] 2. Construction and identification of recombinant lactobacillus: The recombinant plasmids pYL561, pYL578, and pYL590 prepared in step 1 were electroporated to... L. plantarumRecombinant strains NC8 (pYL561), NC8 (pYL578), and NC8 (pYL590) were obtained from NC8 competent cells.

[0081] 3. Expression and identification of recombinant antigens: The recombinant strain obtained in step 2 was induced and cultured to OD600 = 0.8, and then ultrasonically disrupted to prepare whole-cell lysate. Western blotting was used to detect antigen expression, and the results were validated with NetB, FimA, and Fba specific antibodies. Figure 2 As shown in A, B, C, and D, the recombinant strain lysates all showed bands of the expected size (fimA≈37kDa, NetB≈35kDa, Fba≈35kDa) under the action of specific antibodies, confirming the correct expression of the protein.

[0082] The distribution of antigens on the bacterial surface was observed using laser confocal microscopy to verify the effectiveness of the anchoring protein. Recombinant Lactobacillus plantarum NC8 (pYL561) and NC8 (pYL590) were incubated with FimA, Fba, NetB primary antibodies, and FITC-labeled fluorescent secondary antibody. The results are as follows: Figure 3 , Figure 4 and Figure 5 As shown, after incubation with specific antibodies, NC8 (pYL561) and NC8 (pYL590) exhibited a dense green fluorescent signal on their cell surfaces. This demonstrates that FimA, Fba, and NetB are anchored and expressed on the surface of *Lactobacillus plantarum* NC8 (pYL561) and NC8 (pYL590). This result proves that the pgsA, LysM, and LP1261 anchoring system successfully displays antigens on the bacterial cell wall surface, laying the foundation for subsequent interactions with host immune cells.

[0083] Example 2: Validation of Dendritic Cell Targeting and Lysosomal Escape Abilities and Functions Chicken bone marrow-derived dendritic cells (chBM-DCs) were isolated and cultured, and then induced to mature by GM-CSF and IL-4.

[0084] Validating the targeting effect of the phi54 nanobody: CFSE-labeled recombinant bacterial strains were co-incubated with chBM-DCs, and the binding was observed using laser confocal microscopy and transmission electron microscopy. The fluorescence signal intensity of bacteria captured by DCs was quantitatively detected using flow cytometry. Transmission electron microscopy images of bone marrow-derived dendritic cells after co-incubation with PBS, NC8 (pYL561), and NC8 (pYL590) are shown below. Figure 6 As shown in A, C, and E, their enlarged partial views are as follows: Figure 6 As shown in B, D, and F; laser confocal microscopy images of bone marrow-derived dendritic cells co-incubated with PBS, NC8 (pYL561), and NC8 (pYL590) are shown in Figures B, D, and F, respectively. Figure 7 As shown in A, C, and E, their enlarged partial views are as follows: Figure 7 Figures B, D, and F are shown in the diagram. Laser confocal microscopy and electron microscopy revealed that NC8(pYL590) DC cells captured more bacteria compared to NC8(pYL561), indicating that phi54 significantly enhanced the capture efficiency of DCs for probiotic carriers. The results of the average fluorescence intensity analysis of intracellular bacteria are shown in the diagram. Figure 8 As shown, the mean fluorescence intensity (MFI) of NC8 (pYL590) co-incubated with DCs was significantly higher than that of the untargeted NC8 (pYL561) group (P<0.001). Flow cytometry analysis was performed to detect the uptake capacity of DCs for FITC-labeled bacteria. Figure 9 As shown, the statistical analysis of the mean fluorescence intensity (MFI) of the flow cytometry results is as follows: Figure 10 As shown, DC maturity detection: DCs were co-incubated with NC8 (pYL561) and NC8 (pYL590) for 24 h. Total RNA was extracted from the DCs, and the expression levels of maturity markers (CD83, CD86) and chemokine receptors (CCL5, CCR7) were detected by qRT-PCR. The qRT-PCR results are shown below. Figure 11 As shown in A, B, C, and D, compared to NC8 (pYL561), NC8 (pYL590) can more effectively induce the upregulation of CCL5, CCR7, CD83, and CD86 mRNA expression in DCs (P<0.05), suggesting that targeted delivery can more directly activate antigen-presenting cells.

[0085] Lysosomal escape detection: Lysosomes were labeled with Lyso-Tracker Red probes, with NC8 (pYL578) as a control. The co-localization of CFSE-labeled bacteria and lysosomes was observed using confocal microscopy to assess Pas peptide-mediated escape ability. Figure 12 As shown in Figures A, B, C, D, E, F, G, and H, the co-localization of NC8 (pYL590) carrying the Pas peptide with the lysosomal probe was significantly lower than that of the control group (pYL578) without the Pas peptide. After 16 hours of co-incubation, the NC8 (pYL578) group showed a large overlap of green and red fluorescence, indicating that the bacteria were confined within lysosomes; while the NC8 (pYL590) group showed clear separation of green and red fluorescence, suggesting that the bacteria had escaped into the cytoplasm. This indicates that the NC8 (pYL590) strain can effectively utilize a pH-dependent mechanism to escape lysosomal degradation, which is beneficial for antigen presentation into the cytoplasm.

[0086] Example 3 Comparison of the Immunogenic Effects of Recombinant Bacteria 1. Animal Immunization and Challenge Protection Experiment: A schematic diagram of the animal immunization and challenge protection experiment process is shown below. Figure 13As shown, 70 healthy male broiler chickens were randomly divided into 4 groups: PBS control group, NC8 empty bacterial group, NC8 (pYL561) group (basic vaccine group), and NC8 (pYL590) group (booster vaccine group). A non-challenged normal control group was also included. The immunized groups received two oral immunizations at 7 days and 21 days of age (3 consecutive days, dose 1.0 × 10⁻⁶). 9 CFU). Coccidiosis induction was performed 7 days after the second immunization (oral administration of 1×10⁻⁶). 4 10 oocysts), challenged with Clostridium perfringens type G 14 days after the second immunization (10). 9 CFU / chicken, for 3 consecutive days). Sample collection: 7 days after the second immunization and 1 day before challenge, 4 chickens were randomly selected from each group, and jejunum and ileum segments, serum, and intestinal lavage fluid were collected. Pathological evaluation: On the 4th day after challenge (end of the experiment), all remaining chickens were necropsy and weight changes were recorded. Pathological lesions were scored according to the scoring criteria shown in Table 1.

[0087] Table 1 Scoring Criteria score Symptom description 0 points There are no visible lesions, the intestines appear normal, the intestinal wall structure is intact, the mucosa is undamaged, the contents are normal, and there are no signs of inflammation, ulcers, or fibrin deposition. 1 point The intestinal wall appears thin or fragile, or the intestinal mucosa has a diffuse, superficial, easily removable fibrin coating. In this case, there may be minor damage to the mucosa, but no obvious ulcers have formed. The intestine may appear slightly fragile, with a thin wall felt upon light touch, and a thin, membrane-like layer of fibrin adhering to the mucosal surface. After wiping, the mucosa appears largely intact, without obvious bleeding or necrosis. 2 points Focal necrosis or ulceration may occur, or there may be fibrin deposits that are difficult to remove, with 1-5 lesions in number. The necrotic or ulcerated areas are usually accompanied by symptoms such as mucosal damage, congestion, or bleeding. For example, 1-5 small necrotic areas may be seen on the intestinal mucosa, which are grayish-white or black, with congestion and swelling of the surrounding mucosa, or fibrin that is difficult to remove and adheres to the mucosal surface, forming a crust-like substance. 3 points The number of focal necrosis, ulceration, or non-removable fibrin deposition lesions ranges from 6 to 15. Compared to a score of 2, the lesion area is larger, and the intestinal damage is more severe. At this stage, there are more necrotic or ulcer sites on the intestinal mucosa, which are more widely distributed. There may be multiple thinned and fragile areas in the intestinal wall, increased fibrin deposition, and a more pronounced intestinal inflammatory response. 4 points When the number of lesions reaches 16 or more, they also present as focal necrosis, ulceration, or the presence of difficult-to-remove fibrin deposits. Extensive damage to the intestinal mucosa is observed, with an increase in necrotic and ulcerated areas, severely affecting normal intestinal function. Numerous scattered lesions are visible on the intestinal exterior, with multiple ruptures and hemorrhages in the intestinal wall. The intestinal contents may contain blood and sloughed tissue fragments, and the fibrin deposition area is substantial. 5 points Necrotic patches measuring 2-3 cm in length appear. These necrotic areas merge to form larger plaques, further exacerbating the damage to intestinal tissue. These necrotic patches are hard in texture, dark in color, and accompanied by intense inflammation in the surrounding tissue, severely impacting intestinal absorption and digestion. 6 points The intestinal tract dies and exhibits typical diffuse necrosis, with extensive damage to the entire intestinal mucosa and severe disruption of the normal structure and function of the intestine. The intestinal appearance shows large areas of necrosis, the intestinal wall loses elasticity and becomes fragile and easily broken, and the contents may be bloody or purulent, accompanied by a large amount of fibrin exudate and inflammatory cell infiltration.

[0088] 2. Immunological marker detection: Serum and intestinal lavage fluid were collected, and the levels of specific IgG, IgM, and sIgA antibodies were detected using ELISA. On the seventh day after the second immunization, the intestinal mucosal IgA and IgM antibody titers were determined by NetB, fimA, and Fba specific enzyme-linked immunosorbent assays (ELISA). Figure 14 As shown in Figures A, B, C, D, E, and F, compared to the PBS and empty vector groups, both recombinant vaccine groups induced significant antibody responses after the second immunization and before challenge, but the pYL590 group showed a more significant advantage. The results of intestinal mucosal IgG and serum IgG antibody titers obtained by NetB, FimA, and Fba-specific enzyme-linked immunosorbent assays (ELISA) on day seven after the second immunization are shown in Figures. Figure 15 As shown in Figures A, B, C, D, E, and F, the serum IgG levels of the NC8 (pYL590) group against NetB, FimA, and Fba were significantly higher than those in the NC8 (pYL561) group, indicating that dendritic-targeting nanobodies and lysosomal escape peptides enhanced the immune response. The results of intestinal mucosal IgA and IgM antibody titers obtained by specific enzyme-linked immunosorbent assay (ELISA) for NetB, FimA, and Fba one day prior to challenge are shown in Figures B, C, D, E, and F. Figure 16 As shown in A, B, C, D, E, and F, the results of intestinal mucosal IgG and serum IgG antibody titers obtained by NetB, FimA, and Fba specific enzyme-linked immunosorbent assays (ELISA) one day before challenge are as follows. Figure 17As shown in A, B, C, D, E, and F, the NC8 (pYL590) group showed the highest peak levels of sIgA, IgM, and IgG antibodies against NetB, fimA, and Fba antigens, which were significantly better than those of the NC8 (pYL561) group.

[0089] On the seventh day after the second immunization and the day before challenge, cell proliferation levels were analyzed using a CCK-8 assay kit with ConA, a mixture of NetB, fimA, and Fba proteins as stimulants. Forty-eight hours after stimulation with NetB, fimA, and Fba proteins, the intracellular mRNA levels of IL-4 and IFN-γ, and their relative concentrations in the cell culture supernatant, were measured by real-time quantitative polymerase chain reaction (qRT-PCR) and ELISA, respectively. Figure 18 As shown in A and B, one week after the second immunization, the NC8 (pYL590) group showed the highest proliferation level after antigen stimulation, which was significantly higher than that of the PBS control group (p<0.01). Figure 18 As shown in C and D, the NC8 (pYL590) group maintained a relatively high proliferation level even after antigen stimulation the day before challenge. Figure 18 As shown in Figures E, F, G, and H, after antigen stimulation, the expression levels of IFN-γ (Th1 type) and IL-4 (Th2 type) in spleen cells of the immunized group were significantly upregulated. Notably, the NC8 (pYL590) group, which integrates targeting and escape functions, exhibited the best cytokine induction capacity, significantly superior to the pYL561 group, suggesting that it can more effectively activate antigen-specific T cell responses. Splenic lymphocyte proliferation and cytokine detection further revealed the immune mechanism, with the lymphocyte proliferation capacity of the pYL590 group being significantly higher than that of the pYL561 group.

[0090] The distribution of sIgA in the intestinal mucosa was observed using immunofluorescence histochemistry. Immunofluorescence of intestinal sections visually confirmed the results. Results for the jejunum of each group of chickens are shown below. Figure 19 As shown in A, B, C, D, and E, the results of the chicken ileum in each group are as follows. Figure 20 As shown in A, B, C, D, and E, the PBS group showed only a weak background signal, the NC8 (pYL561) group showed scattered positive signals, and the NC8 (pYL590) group showed extensive and high-intensity specific sIgA fluorescence distribution in the jejunal and ileal mucosa, indicating that the enhanced vaccine established a stronger immune barrier at the first line of defense against pathogen invasion.

[0091] lesion scoring results as follows Figure 21As shown, the average intestinal lesion score in the PBS group was 3.25, with a high proportion of severe lesions. The average intestinal lesion score in the NC8 (pYL561) group decreased to 1.83, while that in the NC8 (pYL590) group further decreased to 1.0, and approximately 50% of the individuals showed no macroscopic pathological damage.

[0092] Comprehensive data indicate that, compared to basic vaccines, NC8 (pYL590) provides superior protection against norepinephrine (NE) by significantly reducing intestinal damage and maintaining production performance, demonstrating good clinical protective efficacy.

[0093] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of them. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A recombinant lactobacillus expressing Clostridium perfringens multiple antigens targeting dendritic cells, characterized in that, The recombinant Lactobacillus contains an expression vector for expressing a fusion gene; the fusion gene contains sequences encoding the expression of PgsA'-fimA fusion protein, LysM-Fba fusion protein, LP1261-NetB fusion protein, phi54 targeting element, and Pas escape element; the connection order of the parts of the fusion gene is: pgsA'-fimA-LysM-Fba-Pas-LP1261-NetB-phi54; the sequence encoding PgsA'-fimA fusion protein is shown in SEQ ID NO:1, the sequence encoding LysM-Fba fusion protein is shown in SEQ ID NO:2, and the sequence encoding LP1261-NetB fusion protein is shown in SEQ ID NO:

3.

2. The recombinant lactobacillus as described in claim 1, characterized in that, The recombinant lactobacillus originated from Lactobacillus plantarum (Lactobacillus plantarum). Lactobacillus plantarum ).

3. The method for constructing recombinant lactobacillus according to any one of claims 1 to 2, characterized in that, Includes the following steps: The expression vector containing the fusion gene was transformed into host cells; the nucleotide sequence of the fusion gene is shown in SEQ ID NO:

4.

4. A vaccine, characterized in that, It includes the recombinant lactobacillus as described in any one of claims 1 to 2.

5. The vaccine as described in claim 4, characterized in that, The vaccine in question is a vector vaccine.

6. A composition, characterized in that, It includes the recombinant lactobacillus as described in any one of claims 1 to 2.

7. The use of the recombinant lactobacillus according to any one of claims 1 to 2, the vaccine according to any one of claims 4 to 5, or the composition according to claim 6 in the preparation of a product for the prevention and control of necrotizing enteritis in chickens.

8. The application as described in claim 7, characterized in that, The product is a microbial agent, pharmaceutical preparation, or feed.

9. The application as described in claim 8, characterized in that, The pharmaceutical preparation is a biological product.

10. The application as described in claim 8, characterized in that, The drug formulation is a live vector vaccine.

Citation Information

Patent Citations

  • Genetically-engineered lactobacillus oral vaccine strain for targeted delivery of vaccine antigens and application thereof in preventing and treating chicken colibacillosis

    CN107619816A

  • Recombinant lactobacillus plantarum for expressing anchored eimeria tenella RON2 antigen and application

    CN116948933A

  • Recombinant lactic acid bacteria vector for expressing coronavirus M protein epitope peptide, recombinant lactobacillus plantarum and application

    CN117535323A

  • Vaccine against necrotic enteritis in poultry

    US20200093913A1