A primer set for serratia plymuthica PCR detection and its detection method and application

By designing specific primers SR-F and SR-R, based on the gene sequence of an unnamed protein product from *Millettia sclerotium*, a highly sensitive and specific PCR detection was achieved, solving the problems of long detection time and low accuracy of traditional detection methods, and making it suitable for rapid disease control.

CN121759638BActive Publication Date: 2026-07-03GUANGZHOU DR MIAO BIOTECHNOLOGY CO LTD

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
GUANGZHOU DR MIAO BIOTECHNOLOGY CO LTD
Filing Date
2026-03-02
Publication Date
2026-07-03

AI Technical Summary

Technical Problem

Traditional methods for detecting Sclerotinia sclerotiorum are time-consuming and have low accuracy, making it difficult to meet the needs of rapid disease control.

Method used

Specific primers SR-F and SR-R were designed based on the gene sequence of an unnamed protein product of *Sclerotium rigescens* (GenBank: CQ975807.1) for PCR detection. *Sclerotium rigescens* was specifically detected in total soil DNA by PCR amplification.

Benefits of technology

It achieves rapid detection with high sensitivity and specificity, shortening the detection time from 3-5 days to 2-3 hours, and is suitable for early disease monitoring and control in the field.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121759638B_ABST
    Figure CN121759638B_ABST
Patent Text Reader

Abstract

This invention discloses a primer set for PCR detection of *Sclerotium rigescens*, along with its detection method and application, belonging to the field of microbial detection technology. The primer set includes primers SR-F and SR-R, with the following specific primer sequences: SR-F: TTCGTGGGGTGCTAAGGGAGT; SR-R: TTGTCGTGTCAGCGGGGAGAG. Detection method: (1) Collect rhizosphere soil samples from economic crops and extract total soil DNA; (2) Use the total soil DNA as a template for PCR amplification using the primer set; (3) Perform nucleic acid electrophoresis on the amplified products. If a specific amplification band of 361 bp is detected in the soil sample, it indicates the presence of *Sclerotium rigescens* in the soil sample. The primer set and detection method of this invention have high sensitivity and specificity, allowing direct detection of *Sclerotium rigescens* from soil samples without pure culture. The identification time is shortened from 3-5 days to 2-3 hours, making it suitable for early disease monitoring and control in the field.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial detection technology, and more specifically to a primer set for PCR detection of *Sclerotium sclerotiorum*, its detection method, and its application. Background Technology

[0002] Sclerotium rolfsii (or Agorathelia rolfsii) is an important pathogenic fungus causing white mold disease in various economic crops (such as peanuts, tomatoes, and peppers). It has a strong ability to survive in the soil, making disease control difficult after an outbreak. Traditional detection methods rely on pathogen isolation and morphological identification, which are time-consuming and have low accuracy.

[0003] In recent years, molecular detection techniques such as specific primer PCR have been widely used for the rapid detection of soil pathogens, with advantages such as high sensitivity, high specificity and ease of operation.

[0004] Therefore, how to develop a primer set and detection method for the PCR detection of *Millettia sclerotiorum* is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide a primer set for PCR detection of *Sclerotium tumefaciens*, as well as its detection method and application, to overcome the shortcomings of the prior art.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A primer set for PCR detection of *Millettia sclerotiorum* includes primers SR-F and SR-R, with the following primer sequences:

[0008] SR-F: TTCGTGGGGTGCTAAGGGAGT (sequence as shown in SEQ ID NO.1);

[0009] SR-R: TTGTCGTGTCAGCGGGGAGAG (sequence as shown in SEQ ID NO.2).

[0010] This invention uses an unnamed protein product gene sequence of *Sclerotium sclerotiorum* (GenBank: CQ975807.1) as a molecular marker to design a pair of specific primers, SR-F and SR-R. Using these primers, the target strain can be specifically detected in total soil DNA by PCR amplification. Timely measures can effectively control white mold disease in economic crops, overcoming the shortcomings of poor timeliness of traditional methods.

[0011] The sequence of the unnamed protein product gene (GenBank: CQ975807.1) is shown in SEQ ID NO.3, specifically as follows:

[0012]

[0013] The present invention also claims protection for the use of the above-described primer set for PCR detection of *Sclerotium sclerotium* in the detection of *Sclerotium sclerotium*.

[0014] A rapid method for detecting uniform sclerotium in soils used for economic crops includes the following steps:

[0015] (1) Collect rhizosphere soil samples from economic crops and extract total DNA from the soil;

[0016] (2) Using total soil DNA as a template, PCR amplification was performed using the primer set described above for the PCR detection of Sclerotium tumefaciens;

[0017] (3) The amplification products were detected by nucleic acid electrophoresis. If a specific amplification band of 361 bp was detected in the soil sample, it indicates that there are neat small sclerotia in the soil sample.

[0018] Furthermore, in step (2) above, the reaction conditions for PCR amplification are: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 56℃ annealing for 20 s, 72℃ extension for 50 s, 35 cycles; 72℃ extension for 1 min, and storage at 4℃.

[0019] The present invention also claims protection for the use of the above-described primer set for PCR detection of *Sclerotium sclerotium* in the preparation of a kit for detecting *Sclerotium sclerotium*.

[0020] A kit for detecting *Sclerotium sclerotiorum*, comprising the primer set described above for PCR detection of *Sclerotium sclerotiorum*.

[0021] As can be seen from the above technical solution, compared with the prior art, the beneficial effects of the present invention are as follows:

[0022] The primer set and detection method of this invention have high sensitivity and specificity. They can directly detect *Sclerotium moniliforme* from soil samples without pure culture, and the identification time is shortened from 3-5 days to 2-3 hours. They are suitable for early disease monitoring and control in the field. Attached Figure Description

[0023] Figure 1 The PCR identification results are for Example 1; where 1-Rhizoctonia solani, 2-Rhizoctonia solani, 3-Fusarium oxysporum, 4-Fusarium graminearum, 5-Trichoderma harzianum, M-Marker;

[0024] Figure 2 The results of primer SR-F / SR-R electrophoresis detection in Example 2 are shown; where 1-control (sterile water), 2-Rhizoctonia solani, 3-Fusarium oxysporum, 4-Fusarium graminearum, 5-Trichoderma harzianum, 6-Sclerotium sclerotiorum, M-Marker;

[0025] Figure 3 The results of electrophoresis detection of field soil samples in Example 3 are shown; where 1-soil from diseased plot, 2-soil from diseased plot, 3-soil from diseased plot, 4-soil from diseased plot, 5-soil from diseased plot, 6-soil from diseased plot, and M-Marker. Detailed Implementation

[0026] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0027] Example 1: Isolation and Identification of Strains

[0028] Sample collection: Rhizosphere soil samples were collected from diseased peanut-growing areas in Henan Province at a depth of 5-15 cm, with each sample weighing 50 g.

[0029] Sample separation: The soil sample was diluted and spread using the PDA plate dilution method. After single colonies grew, they were picked out and purified.

[0030] DNA extraction: Use a DNA extraction kit to extract purified total DNA.

[0031] PCR identification: PCR identification was performed using ITS molecular markers (ITS1: TCCGTAGGTGAACCTGCGG, sequence as shown in SEQ ID NO.4; ITS4: TCCTCGCTTATTGATATGC, sequence as shown in SEQ ID NO.5). Figure 1 After sequencing, the results were compared with the NCBI database and showed that the soil contained *Sclerotium sclerotiorum*, *Rhizoctonia solani*, *Fusarium oxysporum*, *Fusarium graminearum*, and *Trichoderma harzianum*.

[0032] Example 2: Primer Design and Specificity Validation

[0033] Primer design: Genomic sequences of *S. rolfsii*, *Rhizoctonia solani*, *Fusarium oxysporum*, *Fusarium graminearum*, and *Trichoderma harzianum* were downloaded from the NCBI database. Through multiple sequence alignment, an unnamed protein product gene sequence from *S. rolfsii* was selected (GenBank: CQ975807.1, sequence shown as SEQ ID NO. 3). Specific primers SR-F: TTCGTGGGGTGCTAAGGGAGT (sequence shown as SEQ ID NO. 1) and SR-R: TTGTCGTGTCAGCGGGGAGAG (sequence shown as SEQ ID NO. 2) were designed using Primer Premier 5.0 software.

[0034] Specificity verification: Genomic DNA was extracted from *Sclerotium sclerotiorum* and five other common soil fungi as templates, and PCR amplification was performed using primers SR-F / SR-R. The PCR reaction conditions were: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 56℃ annealing for 20 s, 72℃ extension for 50 s, 35 cycles; 72℃ extension for 3 min; and storage at 4℃. The results are shown in Table 1 below, and the electrophoresis results are available in [reference needed]. Figure 2 .

[0035] Table 1. Specificity test results of primers SR-F / SR-R

[0036]

[0037] From Table 1 and Figure 2 It is known that the designed primers SR-F and SR-R can only specifically amplify the DNA of *Millettia sclerotiorum*.

[0038] Example 3: Field soil sample testing

[0039] Sample collection: Rhizosphere soil samples were collected from diseased (plants showing typical symptoms of white mold disease) and healthy plots in a peanut-growing area in Henan Province, with each sample weighing 500 g.

[0040] DNA extraction: Total DNA was extracted from a 200 mg soil sample using a soil total DNA extraction kit, following the instructions.

[0041] PCR detection: Using total soil DNA diluted 10-fold as a template, PCR amplification was performed using primers SR-F and SR-R. The results are shown in Table 2 below. Electrophoresis results for typical samples are also shown. Figure 3 .

[0042] Table 2. Test results of field soil samples

[0043]

[0044] From Table 2 and Figure 3 It can be seen that this method can effectively detect uniform sclerotium bacteria directly from the soil in complex field environments, which is highly consistent with the occurrence of diseases in the field, proving its great potential for practical application.

[0045] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for rapid detection of uniform sclerotium in soil of economic crops, characterized in that, Specifically, the following steps are included: (1) Collect rhizosphere soil samples from economic crops and extract total DNA from the soil; (2) Using total soil DNA as a template, PCR amplification was performed using a primer set; The primer set includes primer SR-F and primer SR-R, and the primer sequences are as follows: SR-F:TTCGTGGGGTGCTAAGGGAGT; SR-R:TTGTCGTGTCAGCGGGGAGAG; The PCR amplification reaction conditions were as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 56℃ annealing for 20 s, 72℃ extension for 50 s, 35 cycles; 72℃ extension for 1 min, and storage at 4℃. (3) The amplification products were detected by nucleic acid electrophoresis. If a specific amplification band of 361 bp was detected in the soil sample, it indicates that there are neat small sclerotia in the soil sample.