Codon optimization type connexin cap protein as well as coding gene and application thereof

Abstract

The invention belongs to the technical field of protein engineering, and particularly relates to codon optimization type connexin cap protein as well as a coding gene and application thereof. On the premise of ensuring the result and function of the protein, the expression level of the protein is improved; in addition, the gene therapy developed on the basis of the codon optimization type teethnion designed by the invention not only can supplement the expression of teethnion, but also can improve the muscle function. The codon-optimized connexin cap protein disclosed by the invention can be used for remarkably relieving the injury degree of muscle cells and improving the functions of muscles, and an effective way is provided for treating LGMD2G.

Description

Technical Field

[0001] This invention belongs to the field of protein engineering technology, specifically relating to codon-optimized myosin cap protein and its encoding gene and applications. Background Technology

[0002] Limb-girdle muscular dystrophy 2G (LGMD2G) is a rare autosomal recessive subtype caused by a mutation in the TCAP gene. Muscle pathology in LGMD2G patients includes proximal myopathy and marginal vacuoles. Muscle biopsies reveal myopathic features such as heterogeneity in fiber size, atrophy and regeneration of muscle fibers, mild connective tissue hyperplasia, and disorganization of the myofibril network. To date, cases associated with LGMD2G have been reported... TCAP The mutations are primarily frameshift or nonsense mutations. The TCAP gene, located on chromosome 17q12 and comprising two exons, encodes Telethonin (also known as titin-cap), a 19 kDa protein expressed in the Z-disc of the heart and skeletal muscle. Telethonin binds to the Z1-Z2 domain of titin and acts as a substrate for titin kinase; these interactions are crucial for myofibril assembly. In LGMD2G patients, the absence or dysfunction of telethonin protein leads to disrupted sarcomere-membrane interactions and sarcomere assembly, which is considered the primary cause of the phenotype.

[0003] However, to date, only a small number of patients worldwide have been described as having this disease, and the onset time and severity vary. This high heterogeneity makes LGMD2G currently incurable, and there is a lack of effective treatment options to slow disease progression.

[0004] Gene therapy mediated by multiple recombinant adeno-associated viruses (rAAVs) offers the advantage of providing lifelong benefits through a single intravenous infusion. In recent years, muscle-specific adeno-associated viruses (MyoAAVs) have been explored and evaluated, exhibiting excellent muscle-specific transduction efficiency and liver detargeting effects. This will give MyoAAVs-mediated LGMD2G gene therapy significant advantages, including improved expression levels, enhanced safety, and reduced production costs. However, achieving clinically effective treatment remains a core challenge that urgently needs to be addressed in current research. Summary of the Invention

[0005] To address the problem of poor efficacy of existing gene therapy drugs in clinical applications and their inability to effectively treat LGMD2G, this invention provides a codon-optimized titin cap protein and its encoding gene, along with its applications, specifically including the following technical solutions: The present invention provides a codon-optimized titin cap protein, the nucleotide sequence encoding the codon-optimized titin cap protein being shown in SEQ ID NO:1.

[0006] The present invention also provides a recombinant vector comprising the nucleotide sequence of the codon-optimized titin cap protein as described above.

[0007] Preferably, the recombinant vector further includes a backbone vector, which includes a muscle-specific adeno-associated virus plasmid vector.

[0008] Preferably, the muscle-specific adeno-associated virus plasmid vector comprises the pAAV-(ITR-MHCK7-CW3SL) plasmid.

[0009] Preferably, the pAAV-(ITR-MHCK7-CW3SL) plasmid is obtained by gene editing of the pAAV-MCS vector plasmid. The gene editing includes replacing the promoter sequence of the pAAV-MCS vector plasmid with the promoter sequence shown in SEQ ID NO:2, and inserting the sequence shown in SEQ ID NO:3 between the MluI and EcoRI restriction sites of the pAAV-MCS vector plasmid to obtain the pAAV-(ITR-MHCK7-CW3SL) plasmid.

[0010] The present invention also provides a recombinant virus comprising the codon-optimized titin cap protein as described above or the recombinant vector as described above.

[0011] Preferably, the recombinant virus further includes the MyoAAV 2A capsid plasmid and the pAd-helper plasmid.

[0012] The present invention also provides the use of the codon-optimized titin cap protein, recombinant vector or recombinant virus as described above in the preparation of a medicament for treating limb girdle muscular dystrophy type 2G.

[0013] The present invention also provides a gene drug, the active ingredient of which includes the codon-optimized myosin cap protein, recombinant vector or recombinant virus as described above.

[0014] Preferably, the dosage form of the gene therapy includes a liquid formulation.

[0015] The beneficial effects of this invention are as follows: This invention provides a codon-optimized titenion cap protein. This codon-optimized titenion cap protein, telethnion, designed with optimized functional regions of human teletonin, restores the function of the titenion cap protein in the human body. By replacing the codons of the teletonin gene with high-frequency codons consistent with human myosin, this invention increases the expression frequency of the teletonin gene in the human body. Gene therapy developed based on the codon-optimized teletonion designed in this invention can not only supplement teletonin expression but also improve muscle function. The codon-optimized titenion cap protein described in this invention can significantly alleviate the degree of muscle cell damage and improve muscle function, thereby effectively treating LGMD2G. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0017] Figure 1 For MyoAAV 2A_MHCK7- Tcap Silver staining results of capsid protein subunits; Figure 2 Codon-optimized telethonin protein in the LGMD2G model ( Tcap Expression levels in different tissues of c.244C>T mice; In this image, a shows the results of immunoblotting of five tissues and the analysis results; b shows the immunofluorescence images of the gastrocnemius and triceps brachii muscles. The scale bar is 20 μm. Figure 3 telethonin protein pairs optimized for codons Tcap The effects of c.244C>T mice on myofibril morphology and behavior; In this study, a represents the results of mouse muscle morphology measurements, b represents the results of relative grip strength measurements of mouse limbs, c represents the results of mouse body weight measurements, d represents the results of time to exhaustion in the treadmill test, e represents the results of distance to exhaustion in the treadmill test, and f represents the results of creatine kinase assays in mice; n=6 for each group. All data are expressed as mean ± SD; statistical significance was calculated using one-way ANOVA. express P <0.05, express P <0.01, express P <0.001, scale bar is 200 μm. Detailed Implementation

[0018] The present invention provides a codon-optimized titin cap protein, the nucleotide sequence encoding the codon-optimized titin cap protein being shown in SEQ ID NO:1.

[0019] As one implementation method, the optimization described in this invention involves codon optimization of the expression cassette of the telethonin gene, replacing the codons with high-frequency codons consistent with human myosin.

[0020] Human myosin is a protein highly expressed in muscle fibers. Its codons are frequently expressed in the human body, and the frequency of codon usage is a key factor affecting gene expression efficiency. Therefore, this invention replaces the codons of the telethonin gene with high-frequency codons identical to those of human myosin, thereby increasing the expression frequency of the telethonin gene in the human body.

[0021] The present invention also provides a recombinant vector comprising the nucleotide sequence of the codon-optimized titin cap protein as described above.

[0022] In one embodiment, the recombinant vector further includes a backbone vector, which comprises a muscle-specific adeno-associated virus (AAV) plasmid vector. In another embodiment, the muscle-specific AAV plasmid vector comprises the pAAV-(ITR-MHCK7-CW3SL) plasmid. In another embodiment, the pAAV-(ITR-MHCK7-CW3SL) plasmid is obtained by gene editing of the pAAV-MCS vector plasmid. The gene editing includes replacing the promoter sequence of the pAAV-MCS vector plasmid with the promoter sequence shown in SEQ ID NO:2, and inserting the sequence shown in SEQ ID NO:3 between the MluI and EcoRI restriction sites of the pAAV-MCS vector plasmid to obtain the pAAV-(ITR-MHCK7-CW3SL) plasmid. In another embodiment, the codon-optimized titin cap protein is inserted into the pAAV-(ITR-MHCK7-CW3SL) plasmid between the SalI and EcoRI restriction sites.

[0023] The present invention also provides a recombinant virus comprising the codon-optimized titin cap protein or recombinant vector as described above.

[0024] In one embodiment, the recombinant virus further includes a MyoAAV 2A capsid plasmid and a pAd-helper plasmid. In another embodiment, the recombinant virus is prepared by co-transfection of HEK293T cells with the three plasmids. In yet another embodiment, the MyoAAV 2A capsid plasmid is obtained by inserting the sequence shown in SEQ ID NO:5 between Q585 and A586 of the pAAV2 / 9n Cap protein coding sequence using cloning technology.

[0025] The present invention also provides the use of the codon-optimized titin cap protein, recombinant vector or recombinant virus as described above in the preparation of a medicament for treating limb girdle muscular dystrophy 2G.

[0026] As one implementation method, when the target of the drug is a mouse, the dosage of the gene drug is: 1.0E+13 vg per kg body weight, calculated by viral titer.

[0027] The present invention also provides a gene drug, wherein the active ingredient of the gene drug includes codon-optimized titin cap protein, recombinant vector or recombinant virus.

[0028] In one embodiment, the gene therapy drug further includes other pharmaceutically acceptable carriers or excipients. In one embodiment, the gene therapy drug is formulated as a liquid preparation. In one embodiment, the liquid preparation includes an injectable formulation.

[0029] To further illustrate the present invention, the codon-optimized myosin cap protein and its encoding gene and applications provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0030] Example 1: Determination of the nucleotide sequence of telethonin Codon frequency is a key factor affecting gene expression efficiency. Therefore, this embodiment optimized the expression cassette of the telethonin gene, using high-frequency codons consistent with those of human myosin (a protein highly expressed in muscle fibers) to improve its expression level. The optimized telethonin gene expression cassette sequence is shown in SEQ ID NO:1.

[0031] SEQ ID NO: 1: 5'-ATGGCCACTAGTGAATTGAGCTGTGAGGTTAGTGAGGAGAACTGTGAACGACGTGAAGCCTTCTGGGCCGAGTGGAAGGACCTAACACTGAGCACCAGACCCGAGGAGGGCTGCAGCCTGC ACGAGGAGGACACCCAGAGACACGAGACCTACCACCAGCAGGGCCAGTGCCAGGTGCTGGTGCAGAGAAGCCCCTGGCTGATGATGAGAATGGGCATCCTGGGCCGGGGCCTGCAGGAGTACCAGCTGC CCTACCAGAGAGTGCTGCCCCTGCCCATCTTCACCCCCGCCAAGATGGGCGCCACCAAGGAGGAGAGAGAGGACACCCCCATCCAGCTGCAGGAGCTGCTGGCCCTGGAGACCGCCCTGGGCGGCCAGT GCGTGGACAGACAGGAGGTGGCCGAGATCACCAAGCAGCTGCCCCCCGTGGTGCCCGTGAGCAAGCCCGGCGCCCTGAGAAGGAGCCTGAGCAGAAGCATGAGCCAGGAGGCCCAGAGAGGCTGA-3'.

[0032] Example 2 High-titer MyoAAV 2A-MHCK7- Tcap Preparation 1. Construct a carrier Tcap Core plasmid of gene expression cassette The codon-optimized telethonin gene expression cassette described in Example 1 was placed between the SalI and EcoRI restriction sites of the pAAV-(ITR-MHCK7-CW3SL) plasmid to obtain pAAV-(ITR-MHCK7-CW3SL) plasmid. Tcap -CW3SL) core plasmid.

[0033] Sanger sequencing technology was used to analyze pAAV-(ITR-MHCK7-) Tcap The core plasmid (-CW3SL) was used for plasmid identification, resulting in pAAV-(ITR-MHCK7-) Tcap -CW3SL) plasmid Tcap The Sanger sequencing results of the fragment show that pAAV-(ITR-MHCK7-) was successfully constructed. Tcap -CW3SL) core plasmid.

[0034] The pAAV-(ITR-MHCK7-CW3SL) plasmid backbone described above is derived from the pAAV-MCS vector plasmid in the AAV Helper-Free System (240071, Agilent Technologies) kit. The difference lies in that the promoter sequence of the pAAV-MCS vector plasmid is replaced with the promoter sequence shown in SEQ ID NO:2, and a scaled-down CW3SL sequence with WPRE and SV40PA functions (as shown in SEQ ID NO:3) is used as a stabilizing element for the RNA (that is, the invention modifies the CW3SL sequence in the original pAAV-MCS vector plasmid). Thus, the expected MyoAAV 2A-MHCK7- Tcap The actual gene fragment packaged by the virus is approximately 1832 bp in length, as shown in SEQ ID NO:4.

[0035] SEQ ID NO:2:5'-ctagagcttgcatgtctaagctagacccttcagattaaaaataactgaggtaagggcctgggtaggggaggtggtgtgagacgctcctgtctctcctctatctgcccatcggccctttggggaggaggaatgtgcccaaggactaaaaaaaggccatggagccagaggggcgagggcaacagacctttcatgggcaaaccttggggccctgctgtctagcatgccccactacgggtctaggctgcccatgtaaggaggcaaggcctggggacacccgagatgcctggttataattaacccagacatgtggctgcccccccccccccaacacctgctgcctctaaaaataaccctgtccctggtggatcccctgcatgcgaagatcttcgaacaaggctgtgggggactgagggcaggctgtaacaggcttgggggccagggcttatacgtgcctgggactcccaaagtattactgttccatgttcccggcgaagggccagctgtcccccgccagctagactcagcacttagtttaggaaccagtgagcaagtcagcccttggggcagcccatacaaggccatggggctgggcaagctgcacgcctgggtccggggtgggcacggtgcccgggcaacgagctgaaagctcatctgctctcaggggcccctccctggggacagcccctcctggctagtcacaccctgtaggctcctctatataacccaggggcacaggggctgccctcattctaccaccacctccacagcacagacagacactcaggagccagccagc-3'。

[0036] SEQ ID NO:3:5'-gataatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttagttcttgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgtttatttgtgaaatttgtgatgctattgctttatttgtaaccatctagctttatttgtgaaatttgtgatgctattgctttatttgtaaccattataagctgcaataaacaagttaacaacaacaattgcattcattttatgtttcaggttcagggggagatgtgggaggttttttaaagcgg-3'。

[0037]

[0038] 2. Synthesis of MyoAAV 2A capsid plasmid The MyoAAV 2A capsid plasmid was obtained by inserting the motif shown in SEQ ID NO:5 between Q585 and A586 of the pAAV2 / 9n (plasmid #112865, addgene) Cap protein coding sequence using cloning technology.

[0039] SEQ ID NO:5:GPGRGDQTTL.

[0040] 3. MyoAAV 2A- was prepared using the HEK293T three-plasmid co-transfection method. Tcap Virus pAAV-(ITR-MHCK7- Tcap HEK293T three-plasmid co-transfection was performed using the core plasmid (-CW3SL), the MyoAAV 2A capsid plasmid, and the pAd-helper auxiliary plasmid (240071, Agilent Technologies).

[0041] The specific steps for co-transfection with three plasmids are as follows: HEK293T cells were passaged into 15 cell culture dishes with a diameter of 10 cm, each dish containing 7 × 10⁻⁶ cells. 6 cell / ml ~1×10 7 Cells were seeded at a density of 1 cell / ml. 10 ml of high-glucose DMEM medium containing 2% FBS and 1% penicillin-streptomycin antibiotics was added to each dish. Transfection was performed within 24 hours after cell seeding.

[0042] The transfection steps are as follows: 1) Calculate plasmid and PEI dosage: The plasmid transfection mass per dish is calculated according to a fixed ratio, and the PEI dosage is twice the total plasmid amount (actual experiment: 6 μg pAd-helper plasmid, 5 μg MyoAAV 2A capsid plasmid, and pAAV-(ITR-MHCK7-) per dish). Tcap (3 μg of core plasmid (CW3SL), 28 μg of PEI).

[0043] 2) Dilute each plasmid and PEI with 500 μl of serum-free and antibiotic-free DMEM and let stand for 5 min.

[0044] 3) Mix the diluted plasmid and PEI thoroughly, incubate for 15 min, and then add the mixture evenly to a cell culture dish. After 72 h of transfection, collect the cells and supernatant for virus purification.

[0045] 4.MyoAAV 2A_MHCK7-Tcap Purification and titer determination The virus was purified using ultracentrifugation, and the specific steps are as follows: First, the HEK293T cells obtained in step 3 were subjected to six freeze-thaw cycles in liquid nitrogen and a 37°C water bath. Then, 4 volumes of lysis buffer (containing 50 U / mL benzonase (Sigma) and 150 mM NaCl) were added to both the cells and the supernatant, and the mixture was treated at 37°C for 1 h. After centrifugation at 2500 g for 15 min, the cells and supernatant were combined and purified further by density gradient centrifugation with iodixanol (OptiPrep (Sigma)). Hum Gene Ther Methods. 2015 Aug;26(4):147-57).

[0046] The purification steps included: first, preparing iodixanol gradient solutions of 15%, 25%, 40%, and 58% concentrations using 60% iodixanol and PBS-MK Buffer (1×PBS, 1 mM MgCl2, 2.5 mM KCl), and sequentially adding them to 39 mL Quick-Seal tubes (Beckman 30 Coulter). Then, adding the supernatant containing the lysate of the treated rAAV, and centrifuging at 48,000 rpm for 2 h at 18°C ​​using a Backman ultracentrifuge (Optima XPN-100) with a 70 Ti rotor. After centrifugation, the 40% gradient phase solution was aspirated, dialyzed against PBS buffer, and then concentrated by ultrafiltration using an Amicon Ultra-15 (MWCO 100 kDa, Merck Millipore) tube to obtain purified MyoAAV 2A_MHCK7-. Tcap After being repackaged, it is frozen at -80℃.

[0047] Purified MyoAAV 2A_MHCK7- Tcap Viral titers were determined using quantitative real-time PCR with the iQSYBR Green Supermix kit (Bio-Rad). A standard curve was plotted based on the CT (Cycle Threshold) value and copy number of plasmid standards to determine the MyoAAV 2A_MHCK7- viral titer. Tcap The viral DNA copy number was counted, and MyoAAV 2A_MHCK7- was derived. Tcap The titer.

[0048] The formula for calculating plasmid copy number is: 6.02×10 23(Copies / mol) × Plasmid concentration (g / μl) / Average molecular weight of plasmid (MV) (g / mol) = Copy number / μl.

[0049] pAAV-(ITR-MHCK7-) was prepared according to the above formula. [[ID= -CW3SL) plasmid standard was prepared in 6 gradients using a 10-fold dilution method: 1×10 9 1×10 8 1×10 7 1×10 6 1×10 5 1×10 4 (copy / μl). Primers selected for MHCK7 promoter-specific quantification were MHCK7-F and MHCK7-R, and the primer sequences are shown below; viral titer is expressed as vector genome (VG) / ul.

[0050] MHCK7-F (SEQ ID NO:6): 5'-gctttatacgtgcctgggact-3'; MHCK7-R (SEQ ID NO:7): 5'-tgacttgctcactggttcct-3'.

[0051] The detection revealed that the MyoAAV 2A- of the present invention ​ The viral titer was 1.31E+13 vg / ml. Simultaneously, viral purity was analyzed using silver staining of the three subunits of the viral capsid protein. These results indicate that the MyoAAV 2A_MHCK7- strain of this invention... ​ The virus is low in protein contamination, and the three subunits of the capsid protein have single and proportionate bands.

[0052] Example 3: Effect Verification Experiment 1.MyoAAV 2A_MHCK7- ​ delivery Prepare 12 newborns for 3 days ​ c.244C>T mice and 6 newborn 3-day-old C57 mice, the ​ The method for constructing c.244C>T mice is as described in patent CN116837026A.

[0053] The MyoAAV 2A_MHCK7- prepared in Example 2 ​ The virus was injected intraperitoneally into six mice at a dose of 1.0E+13 vg / kg (1710 SN syringe, Hamilton) as... ​ c.244C>T+MyoAAV 2A_MHCK7-​ Group; simultaneously, six newborn 3-day-old animals were injected intraperitoneally with an equal volume of PBS. ​ c.244C>T mice and six newborn 3-day-old C57 mice (purchased from Jackson's laboratory) were used as, in sequence, as ​ The mice were divided into c.244C>T+PBS group and WT+PBS group, and then marked using the Aramis Micro tattoo kit (Ketchum Manufacturing Inc, Canada) to avoid confusion.

[0054] 2. Carrier processing and tissue storage After feeding mice under normal conditions for 4 weeks, blood was collected from the orbital vein under isoflurane anesthesia (R510-22-10, Reward). The quadriceps, gastrocnemius, tibialis anterior, triceps brachii, myocardium, diaphragm, and liver were rapidly separated and cryopreserved. Designated tissue samples were placed in OCT (4583, Sakura) containing an embedding mold (Richard Allan Scientific) and rapidly frozen in isopentane (PHR1661, Sigma) cooled in liquid nitrogen. Other designated biological tissue samples were placed in tissue containers and rapidly frozen in liquid nitrogen. All samples were stored at -80°C.

[0055] Frozen sections of 5-7 μm thickness were cut at -25°C on a cryostat (Microm™ HM550, Thermo Scientific) and mounted on glass slides (Superfrost Plus, Fisher Scientific), and stored at -20°C for later use.

[0056] 3. Expression level of codon-optimized Telethonin in injected mice The expression level of codon-optimized telethonin in injected mice was detected by Western blotting. The specific steps were as follows: Add 30 mg of tissue to 300 μl of pre-chilled protein lysis buffer (89901, ThermoFisher), place on ice, cut appropriately, add a small amount of zirconium oxide particles, and homogenize in a BulletBlender Storm / Lite electric tissue homogenizer at 12000 rpm in a 4°C chromatography cabinet. After homogenization, remove the sample, let it stand at 4°C for 30 min, then centrifuge at 12000 rpm for 10 min at 4°C. Take 200 μl of the supernatant for protein quantification (23227, ThermoFisher). Place the quantified protein sample in a water bath or metal zone and heat at 85°C for 10 min. Spot the sample from the collection tube cap, aliquot, and store at -80°C for later use. Before electrophoresis, place the precast gel (M00657, Nanjing Genscript Biotech Co., Ltd.) in the electrophoresis tank and add 1×MES SDS Running Buffer according to the required volume. Load 20 μg of the target tissue protein into each well, and simultaneously load 3 μl of PageRuler pre-stained protein marker into one well. Electrophoresis is performed at 80 V for approximately 30 min. After the sample enters the separating gel, the voltage is increased to 130 V, and electrophoresis continues until the target proteins are completely separated (refer to the separation distance of the pre-stained marker bands). During transfer, place the sponge pad, filter paper, gel, PVDF membrane (IPVH00010, Immobilon), filter paper, and sponge pad sequentially on the black side of the transfer clamp, and then clamp the black side with the white side facing down. The entire process is completed in a vessel containing transfer buffer, while avoiding air bubbles. The PVDF membrane needs to be pre-cut and activated in methanol for 3 s. Place the assembled transfer clamp into the transfer tank according to the corresponding electrodes, add a certain volume of pre-cooled transfer buffer to the transfer tank, turn on the power, and place the tank in an ice-filled foam box for transfer. Based on the molecular weight of the protein to be detected according to this invention, 300 mA and 90 min are determined to be the optimal transfer conditions. After transfer, remove the membrane and dry it in a 37°C oven for 30 min. Using the pre-stained protein marker, cut out the band containing the target protein. Place the target band in methanol and activate for 30 s. Wash with 1×PBS for 5 min, then block in 5% skim milk blocking buffer at room temperature for 1 h. Dilute the primary antibody with 1×PBST.

[0057] In this invention, the telethonin-specific antibody (sc-25327, Santa) was diluted 1:500, and the vinculin antibody (V9131, Sigma) was diluted 1:10000. The corresponding antibodies and protein bands were placed in an antibody incubation chamber and incubated overnight at 4°C. The next day, the bands were removed and washed in 1×PBST three times for 5 min each. The secondary antibody was diluted with 1×PBST containing 10% SDS (100 μl of 10% SDS was added to 10 ml of 1×PBST). The secondary antibodies were IRDye 800CW goat anti-rabbit IgG (H+L) (926-32211, Licor) and IRDye 680CW goat anti-mouse IgG (H+L) (926-68020, Licor), both diluted 1:10000. Place the primary antibody band corresponding to the secondary antibody's properties into the appropriate secondary antibody dilution buffer and incubate at room temperature for 1 h. Remove the band and rinse it in 1×PBST for 5 min × 3 times. After washing, place the band into 1×PBS. Turn on the dual-color infrared laser imaging system (Odyssey, Licor) and place the band into the scanning plate. Set channels 680 and 800 to be on simultaneously, select the scanning range, and start scanning. Import the images obtained from the dual-color infrared laser imaging system into ImageJ 1.50g software for grayscale analysis.

[0058] The results are as follows ​ As shown in Figure a, Western blotting analysis revealed the expression levels of full-length teleethonin in the muscle tissue of the three groups of mice. The relative expression levels of full-length teleethonin to vinculin were compared between WT and MyoAAV 2A_MHCK7- ​ The values ​​were 1.000 ± 0.000 and 0.7547 ± 0.4455, respectively, in Tcap c.244C>T mice. Only after delivery of MyoAAV 2A_MHCK7- ​ Full-length telethonin expression was detected in the above five tissues of c.244C>7 mice, with expression levels at 75% of those in wild-type mice.

[0059] 4. Cellular localization of codon-optimized Telethonin in injected mice Immunofluorescence was used to detect the expression level and cellular localization of telethonin. The specific procedures were as follows: The sample section was circled with a hydrophobic pen. The slide with the attached section was inserted into a staining rack, and washed with 1×PBS for 5 min × 3 times. 3% BSA (0332, AMRESCO) blocking buffer was added to the circled area, and the slide was blocked at room temperature for 1 h. For blocking, the primary antibody was prepared and diluted with 3% BSA. Telethonin (SC-25327) antibody was used to detect the expression level and localization of telethonin at a dilution of 1:50. α-actinin 2 antibody (14221-1-AP, Proteintech) was used to locate the Z-band at a dilution of 1:400. After blocking, the primary antibody was added, and the slide was incubated overnight at 4°C. The next day, the slide was removed, washed with 1×PBST for 5 min × 3 times, and then incubated with secondary antibody at room temperature for 1 h. When the primary antibody host is mouse, the secondary antibody is Alexa Fluor® 594 (ab150116, Abcom) or Alexa Fluor® 488 (ab150113, Abcom) labeled goat anti-mouse IgG at a dilution of 1:500. When the primary antibody host is rat, the secondary antibody is Alexa Fluor® 594 (ab150160, Abcom) goat anti-rat IgG at a dilution of 1:1000. After incubation, the cells are washed with 1×PBST for 5 min × 3. After washing, DAPI is added, and the cells are incubated at room temperature for 10 min to counterstain the nuclei. Finally, the cells are mounted with anti-fluorescence quenching mounting medium, and images are acquired using a confocal microscope (TCS-SP8, LEICA).

[0060] The results are as follows ​ As shown in Figure b, full-length and truncated telethonin in muscle tissue co-localizes with the protein actinin-2 in the Z-disc of the sarcomere, and their cellular localization and expression levels are significantly different compared to the Tcap c.244C>T + PBS group. ​ Telethonin was clearly expressed in both tissue types and was located in the Z band.

[0061] 5. Codon-optimized Telephone pairs ​ Effects of c.244C>T mouse myocyte morphology Four weeks after delivery, the muscle histological characteristics were examined using H&E, and the results were as follows: ​ As shown in Figure a, it can be seen that, with ​ Compared to c.244C>T+PBS ​ c.244C>T+MyoAAV 2A_MHCK7- ​The number of central nuclear fibers in mice (white arrows) was significantly reduced. Compared with PBS-treated WT mice, PBS-treated Tcap c.244C>T mice showed atrophic scattered fibers in the triceps brachii, quadriceps femoris, and gastrocnemius muscles, accompanied by central nuclearization and diffuse abnormalities, with a significantly increased level of central nuclear fibers (triceps brachii). P <0.0001, quadriceps femoris P <0.0001, gastrocnemius muscle P <0.0001). However, systemic MyoAAV 2A_MHCK7- ​ These characteristics decreased significantly after delivery (triceps brachii) P <0.05, quadriceps femoris P <0.05, gastrocnemius muscle P <0.01), which supports the view that the inherent muscle damage of LGMD2G can be mitigated by expressing codon-optimized Telethonin.

[0062] 6. Codon-optimized Telephone pairs ​ Effect of grip strength on c.244C>T mice Four weeks after delivery, the grip strength of the limbs of three groups of mice was measured using the YLS-13A rat and mouse grip strength meter (Jinan Yiyan Technology Development Co., Ltd.). Studies have shown that body weight is a key influencing factor on grip strength. Therefore, in this invention, absolute grip strength and relative grip strength normalized to body weight are used to evaluate the effects of codon-optimized Telethonin on... ​ The effects of c.244C>T mice on body weight and grip strength were as follows: ​ As shown in b and c.

[0063] Depend on ​ As shown in figures b and c, the relative grip strength of the limbs in the three groups of mice was 7.767 ± 0.904 in the WT+PBS group. ​ The c.244C>T+PBS group had a c.244C>T+PBS group size of 5.997±0.4296. ​ c.244C>T+MyoAAV 2A_MHCK7- ​ The total weight of the 4-month-old mice in the three groups was 7.606 ± 0.3209 g. The total weight of the WT+PBS group was (28.43 ± 1.553) g. ​ The c.244c>T+PBS group had a Tcap of (26.67±1.007)g, and the Tcap c.244c>T+MyoAAV 2A_MHCK7- ​ The weight of the group was (25.73±0.4933) g; compared with the C57+PBS group, ​ The relative gripping strength of the +PBS group decreased significantly ( P<0.05), delivering MyoAAV 2A_MHCK7- ​ Four weeks later, ​ c.244C>T mice showed a significant increase in relative grip strength, and there was no statistically significant difference in body weight among the three groups of mice.

[0064] 7. Codon-optimized Telephone pairs ​ Effects of 244C>T mice on motor function In this invention, the delivery of MyoAAV2A_MHCK7- was evaluated by comparing the exhaustion distance and exhaustion time in three groups of mice during a treadmill test. ​ right ​ Effects of c.244C>T mice on motor function.

[0065] The specific testing method is as follows: Before the test, all animals ran on the test treadmill at a speed of 10 m / min for 5 minutes with an incline of 0%. During the test, the treadmill was set to a fixed incline of 0%. Mice moved at a speed of 10 m / min for 5 minutes, then the acceleration was set to 1 m / min until exhaustion. The standard for exhaustion was that the animal could not run on the treadmill for 10 seconds under mechanical stimulation. The distance to exhaustion and the time to exhaustion are as follows: ​ As shown in d and e.

[0066] Depend on ​ As shown in figures d and e, the time to exhaustion for the three groups of 4-month-old mice was (1570±85.50) s in the WT+PBS group. ​ c.244C>T+PBS was (1287±95.46) s. ​ c.244C>T+MyoAAV 2A_MHCK7- ​ The exhaustion distance for 4-month-old mice in the three groups was (1454±80.03) s; the exhaustion distance for the WT+PBS group was (498.3±45.25) m. ​ c.244C>T+PBS was (353.2±34.67) m. ​ c.244C>T+MyoAAV 2A_MHCK7- ​ The value was (434.2±52.09) m. Compared with the C57+PBS group, ​ The time to exhaustion and distance to exhaustion decreased in the +PBS group. P The values ​​are respectively P <0.001, P <0.001). Delivery of MyoAAV 2A_MHCK7- ​ Four weeks later, the time to exhaustion and distance to exhaustion in Tcap c.244C>T mice significantly increased. P <0.05).

[0067] 8. Codon-optimized Telephone pairs ​ Effect of serum creatine kinase levels in c.244C>T mice Four weeks after delivery, the CK levels in the serum of the three groups of mice were detected using a double-antibody sandwich ELISA method (ml037724, Shanghai Enzyme-Link Biotechnology Co., Ltd.). The results are as follows: ​ As shown in f.

[0068] Depend on ​ As shown in the figure, the serum CK level in the WT+PBS group of the three groups of 4-month-old mice was (152.2±40.75) UL. -1 , ​ c.244C>T+PBS group: (306±95.46) UL -1 , ​ c.244C>T+MyoAAV 2A_MHCK7- ​ The group is (210.4±33.94) UL -1 Compared with the C57+PBS group, ​ c. The CK level in the 244C>T group was significantly increased ( P <0.01), delivering MyoAAV 2A_MHCK7- ​ Four weeks later, ​ c.244C>T mice showed a significant decrease ( P <0.05).

[0069] In summary, this invention, through codon-optimized telethonion designed with optimized functional regions of human telethonin, significantly improves functional stability. This invention enhances protein expression levels while maintaining protein structure and function. Furthermore, gene therapies developed based on the codon-optimized telethonion designed in this invention can not only supplement telethonin expression but also improve muscle function. The codon-optimized telethonion cap protein described in this invention can significantly alleviate myocyte damage and improve muscle function, thereby effectively treating LGMD2G.

[0070] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments without creative effort, as shown in these embodiments, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A codon-optimized titin cap protein, characterized in that, The nucleotide sequence encoding the codon-optimized myosin cap protein is shown in SEQ ID NO:

1.

2. A recombinant vector, characterized in that, The recombinant vector comprises the nucleotide sequence of the codon-optimized myosin cap protein as described in claim 1.

3. The recombinant vector as described in claim 2, characterized in that, The recombinant vector also includes a backbone vector, which includes a muscle-specific adeno-associated virus plasmid vector.

4. The recombinant vector as described in claim 3, characterized in that, The muscle-specific adeno-associated virus plasmid vector includes the pAAV-(ITR-MHCK7-CW3SL) plasmid.

5. The recombinant vector as described in claim 4, characterized in that, The pAAV-(ITR-MHCK7-CW3SL) plasmid was obtained by gene editing from the pAAV-MCS vector plasmid; The gene editing involves replacing the promoter sequence of the pAAV-MCS vector plasmid with the promoter sequence shown in SEQ ID NO:2, and inserting the sequence shown in SEQ ID NO:3 between the MluI and EcoRI restriction sites of the pAAV-MCS vector plasmid to obtain the pAAV-(ITR-MHCK7-CW3SL) plasmid.

6. A recombinant virus, characterized in that, The recombinant virus includes the codon-optimized myosin cap protein as described in claim 1 or the recombinant vector as described in any one of claims 2 to 5.

7. The recombinant virus as described in claim 6, characterized in that, The recombinant virus also includes the MyoAAV 2A capsid plasmid and the pAd-helper helper plasmid.

8. The use of the codon-optimized titin cap protein of claim 1, the recombinant vector of any one of claims 2 to 5, or the recombinant virus of claim 6 or 7 in the preparation of a medicament for treating limb-girdle muscular dystrophy 2G.

9. A gene therapy drug, characterized in that, The active ingredient includes the codon-optimized myosin cap protein as described in claim 1, the recombinant vector as described in any one of claims 2 to 5, or the recombinant virus as described in claim 6 or 7.

10. The gene therapy drug as described in claim 9, characterized in that, The dosage form of the gene therapy includes liquid formulations.

Images