Anti-SRP54 antibody and application thereof
By constructing and expressing a recombinant anti-SRP54 monoclonal antibody with high affinity and high specificity, the problems of unstable raw materials and large batch-to-batch variability of existing antibody materials have been solved, realizing efficient, stable and low-cost antibody preparation and detection, which is suitable for SRP54 detection and related disease diagnosis.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-15
- Publication Date
- 2026-04-03
AI Technical Summary
The existing anti-SRP54 antibody raw materials have unstable sources, large batch-to-batch variability, and low affinity and specificity, which makes it impossible for clinical test kits to meet the requirements of high efficiency, stability and low cost.
To develop high-affinity and high-specificity recombinant anti-SRP54 monoclonal antibodies, we constructed heavy and light chain variable regions containing specific CDR regions, expressed and purified them using eukaryotic cells, and prepared them into antibody products that can be industrially mass-produced.
It provides antibodies with high affinity and good specificity, simplifies the operation process, reduces production costs, stabilizes product quality, avoids sample sourcing problems, and is suitable for SRP54 detection and related disease diagnosis.
Smart Images

Figure CN121779566A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of antibody technology, and more specifically, to anti-SRP54 antibodies and their applications. Background Technology
[0002] Idiopathic inflammatory myopathy (IIM) is a group of autoimmune diseases characterized primarily by skeletal muscle inflammation and weakness, including subtypes such as polymyositis (PM), dermatomyositis (DM), and immune-mediated necrotizing myopathy (IMNM). More than 90% of PM / DM patients and some IMNM patients have autoantibodies targeting nuclear or cytoplasmic components of cells. Based on their specificity, these can be classified as "myositis-specific autoantibodies" (MSA) and "myositis-associated antibodies" (MAA). These antibodies are not only important serological markers for disease diagnosis but are also closely related to disease subtype classification, disease assessment, treatment selection, and prognosis, making them indispensable tools in clinical diagnosis and treatment. Among the many MSA types, anti-signal recognition particle (SRP) antibodies, especially those targeting the 54kD subunit (SRP54) of the SRP complex, have unique clinical value. Anti-SRP54 antibody-positive myopathy is an important subtype of IMNM, characterized by rapid onset, rapid progression, significant myofiber necrosis, and poor response to conventional immunosuppressive therapy. Therefore, early identification of this subtype is crucial for optimizing treatment strategies. Studies have confirmed that anti-SRP54 antibody has a diagnostic specificity of over 95% for IMNM, making it a core biomarker for distinguishing IMNM from other IIM subtypes. Furthermore, changes in its titer can reflect disease activity, providing a basis for prognostic monitoring.
[0003] However, there are still technical bottlenecks in the current clinical detection kits for anti-SRP54 antibodies, which limit their widespread application: (1) Limited source of human positive serum: Traditional kits mostly use serum from patients who are positive for anti-SRP54 antibodies as standards or capture reagents, but the source of positive serum is scarce and there are large batch-to-batch differences, which makes it difficult to meet the needs of large-scale production, and there are also biosafety risks; (2) Complexity and high cost of animal-derived antibodies: Some reagents prepare rabbit / mouse anti-SRP54 monoclonal antibodies through hybridoma technology, or purify polyclonal antibodies from positive serum of immunized animals (such as rabbits and sheep), and then chemically conjugate human IgG to simulate human antibody activity. Such methods have problems such as complicated operation steps, long production cycle and high cost, and animal-derived antibodies may trigger heterologous immune reactions, affecting the detection specificity; (3) Unmet needs of recombinant antibody technology: Although recombinant antibody technology has been widely used in the biopharmaceutical field, it is difficult for existing technologies to obtain antibodies with both high affinity (dissociation constant KD<10). -9 M), highly specific (no cross-reactivity) and scalable recombinant monoclonal antibodies.
[0004] In summary, anti-SRP54 antibodies, as the "gold standard" biomarker for IMNM diagnosis, directly impact the quality of clinical decision-making. However, current testing methods, such as reliance on scarce samples, complex procedures, high costs, or insufficient specificity, cannot meet the clinical demand for efficient, stable, and low-cost diagnostic reagents. Therefore, developing a readily available, industrially scalable, high-affinity, and highly specific recombinant anti-SRP54 monoclonal antibody and applying it to clinical diagnostic kits is of great significance.
[0005] In view of this, the present invention is proposed. Summary of the Invention
[0006] The purpose of this invention is to provide anti-SRP54 antibodies and their applications, in order to solve the problems of unstable raw material sources, large batch-to-batch variability, and low affinity and specificity of existing anti-SRP54 antibodies.
[0007] This invention is implemented as follows: Unless otherwise defined below, all technical and scientific terms used in the specific embodiments of this invention are intended to have the same meaning as commonly understood by those skilled in the art. While it is believed that the following terms will be well understood by those skilled in the art, the following definitions are set forth to better explain the invention.
[0008] In this invention, the term "antibody" includes any immunoglobulin capable of binding to a specific antigen. The term "antibody" is used in the broadest sense to encompass various antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, monospecific antibodies, multispecific antibodies, full-length antibodies, nanobodies, and antigen-binding fragments, as long as they exhibit the desired antigen-binding activity. The term "anti-SRP54 antibody" refers to an antibody capable of specifically binding to SRP54.
[0009] In this invention, the term "antigen-binding fragment" generally refers to one or more fragments in an antibody that specifically bind to antigens. The antigen-binding function of an antibody can be achieved by the full-length fragment of the antibody. The antigen-binding function of an antibody can also be achieved by a heavy chain comprising a fragment of Fv, scFv, dsFv, Fab, Fab', or F(ab')2, or a light chain comprising a fragment of Fv, scFv, dsFv, Fab, Fab', or F(ab')2.
[0010] In this invention, the term "CDR" is synonymous with "complementarity-determining region," referring to the highly variable region of the heavy and light chains of an immunoglobulin, specifically the region containing one or more, or even all, of the major amino acid residues that contribute to the binding affinity of an antibody or antigen-binding fragment to the antigen or epitope it recognizes.
[0011] In this invention, the heavy chain complementarity determination region is represented by HCDR, and the heavy chain variable region contains three CDR regions: HCDR1, HCDR2 and HCDR3; the light chain complementarity determination region is represented by LCDR, and the light chain variable region contains three CDR regions: LCDR1, LCDR2 and LCDR3.
[0012] In this invention, the "backbone region," also known as the "framework region" or "FR region," refers to the region of the antibody's heavy chain variable region excluding the CDR region. The heavy chain backbone region can be further subdivided into adjacent regions separated by CDRs (FR1, FR2, FR3, and FR4), wherein the heavy chain backbone region can be further subdivided into adjacent regions separated by CDRs, including the HFR1, HFR2, HFR3, and HFR4 backbone regions. The heavy chain variable region is obtained by arranging and connecting the following numbered CDRs with FRs (from the amino terminus to the carboxyl terminus): HFR1-HCDR1-HFR2-HCDR2-HFR3-HCDR3-HFR4.
[0013] A typical natural complete antibody consists of two heavy (H) chains and two light (L) chains. Each heavy chain comprises a variable region (heavy chain variable region, VH) and first, second, third, and fourth (optionally) constant regions (CH1, CH2, CH3, CH4, respectively). Mammalian light chains can be divided into λ or κ chains, and each light chain consists of a variable region (light chain variable region, VL) and a constant region (CL). The variable regions of the light and heavy chains determine antigen binding. Each chain's variable region typically contains three hypervariable regions called "complementarity-determining regions (CDRs)," where the light chain CDRs include LCDR1, LCDR2, and LCDR3, and the heavy chain CDRs include HCDR1, HCDR2, and HCDR3. Each variable region (VH and VL) consists of three complementarity-determining regions connected by four frames (FRs). Typically, the variable regions VL / VH of heavy and light chains can be obtained by connecting the following numbered CDRs with FRs in the following combination: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.
[0014] In this invention, the term "nucleic acid molecule" refers to a polymeric form of nucleotides of any length, including ribonucleotides and / or deoxyribonucleotides. Examples of nucleic acid molecules include, but are not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other naturally occurring, chemically or biochemically modified, non-natural, or derived nucleotide bases. When a nucleic acid molecule encodes a protein or polypeptide, it may optionally encode the sense or antisense strand. Nucleic acid molecules can be naturally occurring, synthetic, recombinant, or any combination thereof. The terms "nucleic acid molecule," "nucleic acid," and "polynucleotide" are used interchangeably.
[0015] In this invention, the term "vector" refers to a delivery vehicle that can operatively insert a genetic element (such as the aforementioned nucleic acid molecule) therein and enable the expression of that genetic element, for example, to produce a protein, RNA, or DNA encoded by the genetic element, or to replicate the genetic element. Vectors can be used to transform, transduce, or transfect host cells, enabling the expression of the genetic element they carry within the host cells. For example, vectors include: plasmids, episome plasmids, microcircular DNA, phage particles, cosmids, artificial chromosomes such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC), bacteriophages such as λ phage or M13 phage, and animal viruses, etc. Vectors may contain various elements controlling expression, including promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, vectors may contain a replication initiation site. Vectors may also include components that facilitate their entry into cells, including but not limited to viral particles, liposomes, or protein coats. Vectors can be expression vectors or cloning vectors. In some embodiments, the vectors (e.g., expression vectors) provided in this disclosure contain a nucleic acid sequence encoding an antibody or an antigen-binding fragment thereof as described in this disclosure, and at least one promoter operatively linked to said nucleic acid sequence (e.g., SV40, CMV, EF). 1α), and at least one selection marker.
[0016] In this invention, the term "recombinant cell" refers to a cell into which exogenous polynucleotides and / or vectors can be or have been introduced. The exogenous polynucleotides may or may not be integrated into the genome of the "recombinant cell." Vectors can be introduced into the cell to construct recombinant cells, which are then used to express antibodies or antigen-binding fragments provided in this disclosure. The recombinant cells can be cultured to obtain the corresponding antibodies. Recombinant cells can be prokaryotic or eukaryotic cells. Prokaryotic cells include, but are not limited to, *Escherichia coli*, *Bacillus*, or *Staphylococcus*. Eukaryotic cells include, but are not limited to, mammalian cells, insect cell lines, plant cells, and fungal cells. Mammalian host cells include human, mouse, rat, dog, monkey, pig, goat, cattle, horse, and hamster cells, including but not limited to Chinese hamster ovary (CHO) cells, NSO, HeLa cells, young hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., Hep G2), A549 cells, 3T3 cells, and HEK-293 cells. Fungal cells include yeast, including, for example, *Pichia pastoris* and *Saccharomyces cerevisiae*.
[0017] In a first aspect, the present invention provides an anti-SRP54 antibody or an antigen-binding fragment thereof, comprising a heavy chain variable region and a light chain variable region; the heavy chain variable region includes a complementarity-determining region VH. CDR1, VH CDR2 and VH CDR3; The variable region of the light chain includes the complementarity-determining region VL. CDR1, VL CDR2 and VL CDR3.
[0018] Among them, VH-CDR1, VH-CDR2 and VH-CDR3 are amino acid sequences consistent with VH-CDR1, VH-CDR2 and VH-CDR3 of the heavy chain variable region shown in SEQ ID NO.6; VL-CDR1, VL-CDR2 and VL-CDR3 are amino acid sequences consistent with VL-CDR1, VL-CDR2 and VL-CDR3 of the light chain variable region shown in SEQ ID NO.7.
[0019] The regions in the heavy chain variable region shown in SEQ ID NO. 6 and the light chain variable region shown in SEQ ID NO. 7, excluding the CDRs, constitute the skeleton region. In this invention, the skeleton region may be the same as or different from the skeleton regions in SEQ ID NO. 6-7. In the variable regions shown in SEQ ID NO. 6-7, VH-CDR1, VH-CDR2, VH-CDR3, VL-CDR1, VL-CDR2, and VL-CDR3 are defined by any one of the systems Kabat, Chothia, IMGT, ABM, or Contact.
[0020] In some embodiments, as defined by IMGT: VH The amino acid sequence of CDR1 is shown in SEQ ID NO.1, VH The amino acid sequence of CDR2 is shown in SEQ ID NO.2, VH The amino acid sequence of CDR3 is shown in SEQ ID NO.3; VL The amino acid sequence of CDR1 is shown in SEQ ID NO.4, VL The amino acid sequence of CDR2 is KVS, VL The amino acid sequence of CDR3 is shown in SEQ ID NO.5.
[0021] In some embodiments, the heavy chain variable region and the light chain variable region also include a skeleton region.
[0022] In some embodiments, the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.6, and the light chain variable region is shown in SEQ ID NO.7.
[0023] In some embodiments, the antibody or its antigen-binding fragment further includes a constant region. Optionally, the constant region includes a heavy chain constant region and / or a light chain constant region. The light chain of the full-length antibody includes a light chain variable region domain VL and a constant region domain CL, wherein VL is located at the amino terminus of the light chain and the CL domain is located at the carboxyl terminus, and the light chain includes a κ chain and a λ chain; the heavy chain of the full-length antibody includes a heavy chain variable region domain VH and a constant region CH, wherein VH is located at the amino terminus of the heavy chain and the CH domain is located at the carboxyl terminus.
[0024] In some embodiments, the constant region is selected from the constant regions of any one of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, and IgD.
[0025] In some embodiments, the species source of the constant region is cattle, horses, pigs, sheep, rats, mice, dogs, cats, rabbits, donkeys, deer, mink, chickens, ducks, geese, or humans.
[0026] In some embodiments, the heavy chain constant region is derived from the constant region of human IgG1, and preferably, the amino acid sequence of the heavy chain constant region is shown in SEQ ID NO.8.
[0027] In some embodiments, the light chain constant region is derived from a mouse-derived light chain constant region, and preferably, the amino acid sequence of the light chain constant region is shown in SEQ ID NO.9.
[0028] In some embodiments, the heavy chain amino acid sequence of the anti-SRP54 antibody or its antigen-binding fragment is shown in SEQ ID NO. 10, and the light chain amino acid sequence is shown in SEQ ID NO. 11.
[0029] Secondly, the present invention provides biological materials related to the above-mentioned antibodies or their antigen-binding fragments, including nucleic acid molecules, vectors, recombinant cells and antibody conjugates.
[0030] In some embodiments, the nucleic acid molecule is RNA or DNA encoding the antibody or its antigen-binding fragment described above. The nucleic acid molecule can be single-stranded or double-stranded, preferably double-stranded DNA.
[0031] In some embodiments, the above-described vector contains a nucleic acid molecule encoding the antibody or its antigen-binding fragment.
[0032] In some embodiments, the recombinant cells contain a nucleic acid molecule encoding the antibody or its antigen-binding fragment, or a vector containing the nucleic acid molecule.
[0033] In some embodiments, the antibody conjugate contains the antibody or its antigen-binding fragment described above, and a solid-phase carrier conjugated thereto.
[0034] In some embodiments, the solid support is selected from microspheres, plates, and membranes, such as magnetic microspheres, plastic microspheres, latex microparticles, microporous plates, glass, capillaries, nylon or nitrocellulose membranes, etc.
[0035] In some embodiments, the antibody conjugate contains the antibody or its antigen-binding fragment thereof and a detectable marker conjugated thereto.
[0036] In some embodiments, the detectable marker is selected from fluorescent substances, quantum dots, digoxigenin-labeled probes, radioactive isotopes, radioactive contrast agents, paramagnetic ion fluorescent microspheres, electron-dense substances, chemiluminescent markers, ultrasound contrast agents, photosensitizers, colloidal metals, or enzymes; optionally, the detectable marker is selected from fluorescent microspheres, colored latex microspheres, acridinium esters, alkaline phosphatase, horseradish peroxidase, or colloidal gold.
[0037] Thirdly, the present invention provides a method for preparing the above-mentioned antibody or its antigen-binding fragment, the method comprising culturing the above-mentioned recombinant cells, and then separating and purifying the antibody or its antigen-binding fragment.
[0038] In some embodiments, the preparation method further includes converting a nucleic acid molecule encoding an antibody or an antigen-binding fragment thereof into recombinant cells and expressing it.
[0039] In some embodiments, the preparation method further includes synthesizing a nucleic acid molecule containing a gene encoding the antibody or its antigen-binding fragment as needed, and / or preparing a suitable expression vector as needed, transforming the expression vector into the desired cells and expressing it, and obtaining the antibody or its antigen-binding fragment by purification.
[0040] In some embodiments, the preparation method includes: fusing a human IgG1 constant region fragment to the C-terminus of the heavy chain variable region to construct a plasmid containing the complete IgG heavy chain expression plasmid; fusing a mouse constant region fragment to the C-terminus of the light chain variable region to construct a light chain expression plasmid; and then transforming the heavy chain expression plasmid and the light chain expression plasmid into recombinant cells.
[0041] In some embodiments, the host cell used in the preparation method is a eukaryotic cell, preferably a mammalian cell, and more preferably, the host cell includes 293 cells or CHO cells, more preferably 293F cells.
[0042] Fourthly, the present invention provides a composition comprising the above-described antibody or its antigen-binding fragment or biological material.
[0043] In some embodiments, the above composition is a kit for detecting SRP54, which is used to detect anti-SRP54 antibodies or for diagnosing and / or assisting in the diagnosis of SRP54 antibody-positive diseases.
[0044] This includes SRP54 antibody test kits, standards and / or quality control products, which contain antibodies or their antigen-binding fragments.
[0045] In some embodiments, the above composition is a kit for detecting idiopathic myositis, the kit further comprising detection reagents for detecting autoantibodies of at least one of the following components: Jo-1, PL-7, PL-12, EJ, Mi-2β, Mi-2α, MDA-5, TIF1-γ, SSA / Ro-52, SAE-1, NXP-2, HMGCR, Ku, PM-scl 75, PM-scl 100, cN-1A, SAE-2.
[0046] In some embodiments, the kit may also include one or more of the following detection reagents: buffer reagent, salt, secondary antibody, chromogenic substrate, blocking solution, washing solution, solvent, elution solution, coupling agent, negative control, positive control, standard, quality control, and signaling agent. Those skilled in the art can formulate reagents or other reagents in the kit according to the corresponding detection method, and this invention does not limit this.
[0047] Fifthly, the present invention provides the use of the above-described antibody or its antigen-binding fragment, biological material or antibody conjugate in any of the following: (1) Detection of SRP54 antibodies for non-diagnostic and treatment purposes; (2) Prepare products for detecting SRP54 antibodies; (3) Prepare products for the diagnosis and / or auxiliary diagnosis of SRP54 antibody-positive diseases; (4) Detection of SRP54 or detection of cells expressing SRP54 for non-diagnostic and therapeutic purposes; (5) Prepare products for detecting SRP54 or for detecting cells expressing SRP54; (6) Used for purifying SRP54; (7) Prepare a product for purifying SRP54.
[0048] In applications (1) to (3), the antibody or its antigen-binding fragment is used as a standard or quality control for detecting SRP54 antibodies or for diagnosing and / or assisting in the diagnosis of SRP54 antibody-positive diseases.
[0049] In some embodiments, SRP54 antibody-positive diseases include idiopathic inflammatory myopathy, preferably immune-mediated necrotizing myopathy.
[0050] In applications (4) and (5), antibodies or their antigen-binding fragments can not only be used to detect SRP54, but also provide a cell detection method based on these antibodies. This method can be applied to disease research and antibody discovery, such as directly screening, identifying, and isolating B cells that can secrete specific antibodies from patient samples (such as blood and bone marrow) to analyze disease mechanisms or discover new therapeutic antibodies; it can also be applied to vaccine efficacy evaluation, such as assessing whether the immune system has produced long-lasting immune memory (long-lived plasma cells and memory B cells) against the target pathogen after vaccination.
[0051] In some embodiments, any one of the above-described product reagents, kits, and drugs.
[0052] In some embodiments, the medicament further includes a pharmaceutically acceptable carrier and / or excipient. Acceptable carriers and pharmaceutically acceptable excipients may be any carrier and / or excipient known in the art and conventionally available. Examples of carriers include, but are not limited to, any physiologically compatible solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents, and delayed absorption agents; examples of excipients include, but are not limited to, fillers, disintegrants, preservatives, solubilizers, and emulsifiers.
[0053] In some embodiments, the drug is used to treat, prevent, or alleviate idiopathic inflammatory myopathy, particularly the immune-mediated necrotizing myopathy subtype.
[0054] The present invention has the following beneficial effects: (1) The present invention provides an SRP54 binding protein that specifically recognizes and binds to the SRP54 antigen. Based on the binding protein, a human-mouse chimeric recombinant monoclonal antibody was further prepared. The antibody has advantages such as high detection affinity, good specificity and strong stability, which provides support for the effective detection of SRP54 or idiopathic inflammatory myopathy.
[0055] (2) The preparation method of the antibody provided by the present invention is not only simple to operate and short in time, but also has the characteristics of high expression level, controllable production process and small batch-to-batch difference.
[0056] (3) The antibody of the present invention can be used as a quality control in the detection kit, which can alleviate the problems of cumbersome operation of polyclonal antibodies and low subsequent conjugation efficiency, reduce production costs, stabilize product quality, and significantly improve reaction values; compared with the direct use of human serum, it can also avoid the problems of difficult sample sources and high costs. In addition, the antibody can also be used to detect SRP54 antigen, purify SRP54, or prepare related products. Therefore, the anti-SRP54 antibody of the present invention has good market promotion prospects. Attached Figure Description
[0057] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.
[0058] Figure 1 This is an electrophoresis image of the heavy chain (Fd) and light chain (VL) used to construct the library in Example 1; Figure 2 This is an electrophoresis image of the Fab gene fragment used to construct the library in Example 1; Figure 3 This is an SDS-PAGE protein electrophoresis image of the three anti-SRP54 recombinant monoclonal antibodies in Example 2; SRP54-Ab-non-reduced: size approximately 150 kDa; SRP54-Ab-reduced: heavy chain and light chain are 50 kDa and 25 kDa, respectively; Figure 4 The SPR method was used in Example 4 to determine the affinity between the recombinant monoclonal antibody and the SRP54 protein. Detailed Implementation
[0059] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.
[0060] The features and performance of the present invention will be further described in detail below with reference to embodiments.
[0061] The SRP54 antigen used in this invention is produced by Zhuhai Lihe Medical Diagnostic Products Co., Ltd., catalog number RAG3041-1.
[0062] Example 1 This example demonstrates the screening of SRP54-binding proteins. (a) Preparation of phage display library 1) Spleens were harvested from mice immunized with SRP54 antigen, and lymphocytes were separated using mouse lymphocyte separation solution.
[0063] 2) RNA extraction: Take 1×10 6 Total RNA was extracted from 100 cells and lymphocytes. 3) Reverse transcription: The extracted total RNA is reverse transcribed to synthesize cDNA. 4) Antibody gene fragment amplification: Using cDNA as a template, specific amplification primers are used to amplify the κ and λ light chains and the VH-CH1 (Fd) region of the heavy chain of the antibody.
[0064] 20 μL reaction system: 1 μL cDNA, 0.8 μL Prime F, 0.8 μL Prime R, 10 μL 2×phantamax master mix, 7.4 μL Nuclease-Free Water; Reaction program: Demothering at 95℃ for 30 s, Annealing at 55℃ for 30 s, Extension at 72℃ for 45 s, 30 cycles.
[0065] After the reaction was complete, loading buffer was added to the system, and the mixture was identified by 1% agarose gel electrophoresis. The electrophoresis results are shown below. Figure 1 As shown.
[0066] The target band was excised, and the antibody heavy chain (Fd, approximately 750 bp) gene fragment and light chain (VL, approximately 350 bp) gene fragment were recovered separately.
[0067] 5) Antibody light chain and heavy chain gene fragments are combined into complete Fab gene fragments by overlapping PCR.
[0068] 25 μL reaction system and procedure: 30 ng light chain, 4.3 ng CL+linker, 30 ng heavy chain, 0.5 μL sfiIF (upstream primer), 0.5 μL sfiIR (downstream primer), 12.5 μL 2×phanta max master mix, and Nuclease-Free Water to a total volume of 25 μL. Reaction procedure: Depolymerization at 95℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 90 s, 30 cycles. After the reaction, loading buffer was added, and the system was identified by 1% agarose gel electrophoresis. The electrophoresis result is shown below. Figure 2 As shown, the target band is approximately 1500 bp. The target band was excised, and the antibody Fab fragment was recovered.
[0069] Upstream primer sfiⅠF: 5'>GAGCAGGAGCATAGGAGGATCGGGCCGGCGGCC<3' (SEQ ID NO. 12); Downstream primer sfiⅠR: 5'>CCATGGCAATGGTGATTCTGCTGCGCGGCCTGGCC<3' (SEQ ID NO. 13.
[0070] 6) Plasmid construction: Digest the antibody Fab fragment and pComb3xSS plasmid with sfiI enzyme, mix them at a molar ratio of 3:1 between the digested fragment and the plasmid, add T4 DNA ligase, and ligate overnight at 16°C.
[0071] 7) Library Construction: Recover the ligation product from the previous step. Take 500 ng of the recovered product, add TG1 competent cells, mix well, and transfer to an electroporation cuvette for electroporation. Parameter selection: Bac-Ec1. After electroporation, activate and incubate at 37℃ for 1 h. Transfer the activated bacterial culture to 2×YT medium, add 1 / 1000 ampicillin antibiotic and a final concentration of 2% glucose solution, and incubate at 37℃ and 220 rpm until OD600 = 0.6. Add 20 times the number of helper phage M13K07. Mix well and place in a shaker at 37℃ for static infection for 45 min. Centrifuge for 15 min to collect the bacteria, resuspend the pellet in fresh 2×YT+Amp+Kana medium, and incubate at 30℃ and 220 rpm for 14 h for phage amplification. The next day, centrifuge to collect the supernatant, add 1 / 4 volume of 20% PEG6000 to precipitate the phage, and resuspend in PBS to obtain the phage display library.
[0072] (ii) Screening for anti-SRP54 antibodies using a phage display library 1) Using biotin-conjugated SRP54 protein as the target antigen, after incubating with SA magnetic beads for 1 h, 1×10⁻⁶ SRP54 protein was added to the reaction system. 12 The phages obtained in Example 1 were incubated for 1 h, and the specific phages were captured by the antigen. They were then washed 10 times with PBST (PBS + 0.03% Tween-20).
[0073] 2) Add the antigen-binding magnetic beads to the TG1 bacterial culture, incubate at 37°C for 45 min, then activate and culture at 37°C and 220 rpm for 1 h. Take an appropriate amount of the incubated bacterial culture, serially dilute it and spread it on ampicillin plates. Add glucose (final concentration 2%) and 1 / 1000 ampicillin antibiotic to the remaining bacterial culture, and shake at 37°C and 220 rpm for 3 h.
[0074] 3) Add 10 μL of M13K07 to the bacterial culture and incubate at 37℃ for 45 min for infection.
[0075] 4) Centrifuge at 6000×g for 10 min, resuspend in 10 mL of 2×YT+Amp+Kana medium, and amplify the phage by shaking at 30℃ and 220 rpm for 14 h. The next day, centrifuge to collect the supernatant, add 1 / 4 volume of 20% PEG6000 to precipitate the phage, and resuspend in PBS to obtain the phages selected in the first round of screening.
[0076] 5) Using the phages obtained in the first round of screening, repeat steps 1 to 4 to perform the second round of screening.
[0077] 6) Single clone identification: Single clones were selected from the second round of screening and plated onto 96-well deep-well plates, and the phages were amplified by overnight shaking.
[0078] Plate coating: SRP54 antigen was used to coat ELISA plates, and BSA was used as a control protein for plate coating. The plates were incubated overnight at 4°C.
[0079] Blocking: On the second day, discard the coating solution, wash the plate 3 times with PBST, pat dry, add 3% milk, and block at 37°C for 2 hours.
[0080] Primary antibody preparation: Centrifuge 96-well deep-well plates, take the supernatant and dilute it in milk to a final concentration of 1%, mix well and use as primary antibody for later use.
[0081] Primary antibody incubation: Discard the blocking solution, wash the plate 3 times with PBST, pat dry, add the primary antibody, and incubate at 37°C for 2 hours.
[0082] Secondary antibody incubation: Discard the primary antibody, wash the plate 5 times with PBST, pat dry, add 1:5000 diluted Anti-M13 Antibody (HRP) secondary antibody, and incubate at 37°C for 1 h. Discard the secondary antibody, wash the plate 5 times with PBST, pat dry, add the chromogenic substrate for color development, and add stop solution after 15 min to stop the reaction. Read the value using a microplate reader.
[0083] 7) Select clones with high read values (SRP54 antigen well OD value > 1) and low non-specific binding (BSA control protein well OD value < 0.5) for sequencing.
[0084] Light chain sequencing primers: Bomp: 5'>GTGTGGAATTGTGAGCGG<3' (SEQ ID NO.14); Heavy chain sequencing primers: PELB: 5'>ACCTATTGCCTACGGCAGCCG<3' (SEQ ID NO.15).
[0085] Twenty single clones were selected for sequencing, and the sequencing results showed three different SRP54 binding protein sequences, including antigen-binding domains.
[0086] Example 2 This example demonstrates the expression and purification of the anti-SRP54 recombinant monoclonal antibody. After obtaining the Fab region sequence of the candidate antibody through sequencing, gene synthesis is performed. The PTT5 plasmid was selected as the vector, and the EcoRI+BamHI cloning site was used to insert a light chain gene fragment. The light chain constant region sequence is shown in SEQ ID NO.9 and is a mouse-derived sequence.
[0087] The CH1 region of the heavy chain was replaced with the CH1 region of human IgG1, and the Fc region of human IgG1 was fused at the C-terminus. Using EcoRI+BamHI as the cloning site, the complete heavy chain fragment was inserted into the PTT5 plasmid. The heavy chain constant region sequence is shown in SEQ ID NO.8 and is a human-derived sequence.
[0088] Expression was performed using the mammalian cell 293F expression system.
[0089] 1) Plasmid extraction: The synthesized plasmids were transformed into TOP10 competent cells, activated for 1 h, and then transferred to LB medium. The cells were cultured overnight at 37°C. The plasmids were extracted the next day using an endotoxin-free plasmid extraction kit to obtain the corresponding heavy chain plasmids and light chain plasmids.
[0090] 2) One day before transfection, 293F cells were seeded into suspension cell culture flasks, and the cell density was controlled at 1×10⁻⁶ cells / year. 6 per mL.
[0091] 3) On the second day, dilute 40 μg of heavy chain plasmid and 80 μg of light chain plasmid in 6 mL of transfection buffer and mix gently. Add 480 μL of PEI and mix gently. Incubate at room temperature for 20 min. Add the mixture dropwise to the cells and place the cells in an incubator for suspension culture at 98 rpm, 37°C, and 5% CO2.
[0092] 4) After 6 days, the culture medium supernatant was collected, and IgG was purified using rProtein A packing material. Elution was performed with 0.1 M Glycine (pH 3.0), followed by neutralization with 1 M Tris (pH 8.0). After elution, the ultrafiltration centrifuge tubes were replaced with PBS buffer and concentrated. Protein concentration was determined, and purity was verified by SDS-PAGE. Results are as follows: Figure 3 As shown.
[0093] Example 3 This embodiment utilizes immunofluorescence assay to determine the binding activity of the recombinant monoclonal antibody to the SRP54 antigen, and further tests the detection performance, cross-reactivity, and stability of the three monoclonal antibodies: 1) The three recombinant antibodies were diluted 40, 80, 160, 320, 640, 1280, 2560 and 5120 times with analytical buffer, respectively, and were tested using a multiplex reagent containing all indicators. The test results of each group were statistically analyzed.
[0094] 2) The antibody 2 with qualified performance and best specificity was aliquoted into two vials. One vial was frozen and the other was repeatedly frozen and thawed 6 times. The two vials were then taken out and diluted 40, 80, 160, 320, 640, 1280, 2560 and 5120 times respectively. The results were tested at the same time and the relative deviation of the MFI results of the two were compared.
[0095] Table 1. Results of chemiluminescence assay for the reactivity of three anti-SRP54 recombinant monoclonal antibodies.
[0096] The test results are shown in Table 1. Antibody No. 2 has the best titer and specificity, and it can still maintain good detection effect after repeated freeze-thaw cycles of 6 times, indicating good stability.
[0097] According to the sequencing results, the heavy chain variable region sequence of antibody 2 is shown in SEQ ID NO.1, and the light chain variable region sequence is shown in SEQ ID NO.2.
[0098] Further analysis revealed that the antigen-binding domain comprises the following light chain and heavy chain CDRs: VH-CDR1 is GFTFSSYD (SEQ ID NO.1); VH-CDR2 is ANSNGAST (SEQ ID NO.2); VH-CDR3 is ARDDYFFDY (SEQ ID NO.3); VL-CDR1 is QSIVHSNGNTY (SEQ ID NO.4); VL-CDR2 is KVS; VL-CDR3 is FQGSHVPLT (SEQ ID NO.5).
[0099] The amino acid sequence of the heavy chain variable region of the corresponding recombinant monoclonal antibody is shown in SEQ ID NO.6, the light chain variable region is shown in SEQ ID NO.7, the complete light chain sequence is shown in SEQ ID NO.10, and the complete heavy chain sequence is shown in SEQ ID NO.11.
[0100] Example 4 This embodiment verifies the affinity of the recombinant monoclonal antibody No. 2 selected in Example 3 for the SRP54 antigen, and further measures the affinity of the selected recombinant antibody No. 2 for the SRP54 protein: 1) Ligand preparation: Dilute the antibody to 10 μg / mL with sample diluent.
[0101] 2) Analyte preparation: Dilute SRP54 antigen to 32 μg / mL with sample diluent.
[0102] 3) Chip cleaning: Clean the chip twice with 150 μl / well of regeneration solution, sample diluent, and ultrapure water, and then pat dry.
[0103] 4) Ligand fixation: Set the ligand fixation parameters. According to the prompts, add 50 μl of sample diluent per well to run the baseline. After the baseline is run, remove the chip plate from the instrument and shake it dry. Add 50 μl of the prepared ligand solution per well to the chip plate to perform ligand fixation.
[0104] 5) Affinity determination: Immediately after ligand immobilization, remove the chip, discard the ligand solution, and pat dry. Set the affinity detection parameters, and according to the prompts, add 50 μl / well of the prepared analyte to perform binding and dissociation operations.
[0105] 6) Data processing: Set calculation parameters and calculate antigen-antibody affinity.
[0106] The results are as follows Figure 4 As shown, the KD of recombinant antibody 2 with SRP54 antigen is 7.23E. -11 M.
[0107] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. An anti-SRP54 antibody or its antigen-binding fragment, characterized in that, It includes variable regions for heavy chains and variable regions for light chains; The heavy chain variable region includes the complementarity-determining region VH. CDR1, VH CDR2 and VH CDR3; the light chain variable region includes a complementarity-determining region VL. CDR1, VL CDR2 and VL CDR3; The VH-CDR1, VH-CDR2, and VH-CDR3 are amino acid sequences identical to those of the VH-CDR1, VH-CDR2, and VH-CDR3 of the heavy chain variable region shown in SEQ ID NO. 6; the VL-CDR1, VL-CDR2, and VL-CDR3 are amino acid sequences identical to those of the VL-CDR1, VL-CDR2, and VL-CDR3 of the light chain variable region shown in SEQ ID NO.
7.
2. The anti-SRP54 antibody or its antigen-binding fragment according to claim 1, characterized in that, The variable regions VH-CDR1, VH-CDR2, VH-CDR3, VL-CDR1, VL-CDR2, and VL-CDR3 are defined by any one of the systems Kabat, Chothia, IMGT, ABM, or Contact. Preferably, according to the IMGT definition: The VH The amino acid sequence of CDR1 is shown in SEQ ID NO.1, and the VH The amino acid sequence of CDR2 is shown in SEQ ID NO.2, and the VH The amino acid sequence of CDR3 is shown in SEQ ID NO.3; The VL The amino acid sequence of CDR1 is shown in SEQ ID NO.4, and the VL The amino acid sequence of CDR2 is KVS, and the VL The amino acid sequence of CDR3 is shown in SEQ ID NO.
5.
3. The anti-SRP54 antibody or its antigen-binding fragment according to claim 1, characterized in that, The heavy chain variable region and the light chain variable region also include a skeleton region; Preferably, the amino acid sequence of the heavy chain variable region of the anti-SRP54 antibody or its antigen-binding fragment is shown in SEQ ID NO. 6, and the light chain variable region of the anti-SRP54 antibody or its antigen-binding fragment is shown in SEQ ID NO.
7.
4. The anti-SRP54 antibody or its antigen-binding fragment according to claim 1, characterized in that, The antibody or its antigen-binding fragment further includes a constant region; Preferably, the constant region is selected from the constant regions of any one of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE and IgD; Preferably, the species source of the constant region is cattle, horses, pigs, sheep, rats, mice, dogs, cats, rabbits, donkeys, deer, mink, chickens, ducks, geese, or humans; Preferably, the heavy chain constant region of the antibody or its antigen-binding fragment is derived from the constant region of human IgG1; Preferably, the amino acid sequence of the heavy chain constant region is as shown in SEQ ID NO.8; Preferably, the light chain constant region of the antibody or its antigen-binding fragment is derived from a mouse-derived light chain constant region; Preferably, the amino acid sequence of the light chain constant region is as shown in SEQ ID NO.
9.
5. The anti-SRP54 antibody or its antigen-binding fragment according to claim 1, characterized in that, The heavy chain amino acid sequence of the anti-SRP54 antibody or its antigen-binding fragment is shown in SEQ ID NO.10, and the light chain amino acid sequence is shown in SEQ ID NO.
11.
6. A biomaterial relating to the antibody or antigen-binding fragment thereof as described in any one of claims 1 to 5, characterized in that, Includes any one of the following items (1) to (4): (1) A nucleic acid molecule encoding the antibody or antigen-binding fragment thereof as described in any one of claims 1 to 5; (2) A carrier containing the nucleic acid molecule described in (1); (3) Recombinant cells containing the nucleic acid molecule described in (1) or the vector described in (2); (4) An antibody conjugate containing any one of the antibodies or antigen-binding fragments thereof as claimed in claims 1 to 5; Preferably, the antibody conjugate further includes a solid-phase carrier conjugated to the antibody or its antigen-binding fragment; Preferably, the antibody conjugate further includes a detectable marker conjugated to the antibody or its antigen-binding fragment.
7. A method for preparing the antibody or its antigen-binding fragment according to any one of claims 1 to 5, characterized in that, This includes culturing the recombinant cells as described in claim 6, and then isolating and purifying the antibody or its antigen-binding fragment.
8. A composition, characterized in that, It comprises the antibody or its antigen-binding fragment as described in any one of claims 1 to 5, or the biological material as described in claim 6.
9. The composition according to claim 8, characterized in that, The composition is a kit for detecting SRP54, which is used to detect anti-SRP54 antibodies or for the diagnosis and / or auxiliary diagnosis of SRP54 antibody-positive diseases; The kit includes an SRP54 antibody detection reagent, standards and / or quality control products, wherein the standards and / or quality control products contain the antibody or its antigen-binding fragment; Preferably, the composition is a kit for detecting idiopathic myositis, the kit further comprising a detection reagent for detecting autoantibodies of at least one of the following components: Jo-1, PL-7, PL-12, EJ, Mi-2β, Mi-2α, MDA-5, TIF1-γ, SSA / Ro-52, SAE-1, NXP-2, HMGCR, Ku, PM-scl 75, PM-scl 100, cN-1A, SAE-2.
10. The use of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 5, the biological material according to claim 6, or the composition according to claim 8 in any one of the following: (1) Detection of SRP54 antibodies for non-diagnostic and treatment purposes; (2) Prepare products for detecting SRP54 antibodies; (3) Prepare products for the diagnosis and / or auxiliary diagnosis of SRP54 antibody-positive diseases; (4) Detection of SRP54 or detection of cells expressing SRP54 for non-diagnostic and therapeutic purposes; (5) Prepare products for detecting SRP54 or for detecting cells expressing SRP54; (6) Used for purifying SRP54; (7) Prepare products for purifying SRP54; Preferably, the disease includes idiopathic inflammatory myopathy; Preferably, the disease includes immune-mediated necrotizing myopathy; Preferably, the antibody or its antigen-binding fragment is used as a standard or quality control product.