Application of ShRDR1 protein and coding gene thereof in resisting tomato brown wrinkled fruit virus

By overexpressing the ShRDR1 protein or its encoding gene in tomatoes, constructing a recombinant expression vector, and transforming tomatoes, the problem of brown wrinkle virus infection in tomatoes was solved, and the antiviral ability of tomatoes was significantly improved.

CN121780591APending Publication Date: 2026-04-03河北省农林科学院经济作物研究所
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-27
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

In the existing technology, the brown wrinkled fruit virus of tomatoes seriously infects tomatoes, causing leaf mosaic and fruit deformity, affecting commercial value and is easy to spread, and there is a lack of effective control measures.

Method used

By using genetic engineering techniques, the ShRDR1 protein or its encoding gene from hairy tomatoes was overexpressed, a recombinant expression vector was constructed and transformed into tomatoes, thereby increasing the expression of the ShRDR1 gene or the amount of protein, and thus enhancing the resistance of tomatoes to tomato brown wrinkle virus.

Benefits of technology

It significantly enhanced the resistance of tomatoes to tomato brown wrinkle virus, inhibited viral RNA accumulation, improved leaf and fruit performance, and improved the antiviral ability of tomatoes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121780591A_ABST
    Figure CN121780591A_ABST
Patent Text Reader

Abstract

The invention discloses an application of ShRDR1 protein and a coding gene thereof in resisting tomato brown wrinkled fruit virus. The invention provides a new application of a tomato antiviral related gene ShRDR1 in resisting tomato brown wrinkled fruit virus. According to the invention, through a genetic engineering technology, an overexpression tomato plant which can be stably inherited is obtained. Phenotypic observation shows that overexpression of the ShRDR1 gene has no significant influence on growth and development of tomatoes. TOBRFV inoculation experiments are respectively carried out on wild-type tomatoes and transgenic tomatoes, and the result shows that the resistance of the tomatoes to TOBRFV can be obviously enhanced by overexpressing the ShRDR1 gene. The invention provides a method for improving the virus resistance of tomatoes, which can effectively improve the resistance of tomatoes to tomato brown wrinkled fruit virus TOBRFV, and has important application value in the field of tomato planting.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering technology and plant disease control, and in particular relates to the application of ShRDR1 protein and its encoding gene in resistance to tomato brown wrinkle virus. Background Technology

[0002] Tomato brown wrinkle virus ( Tomato brown rugose fruit virus ToBRFV belongs to the family Cladoviridae ( Virgaviridae Tobacco mosaic virus (TPV) Tobamovirus ToBRFV (Tobacco-Radiation Free Radiation Virus) is an RNA virus that can infect multiple plant families, including tomato, posing a serious threat to safe production. Tomato leaves infected with ToBRFV exhibit mosaic patterns, narrow and mottled growth, dark green raised bumps, and necrosis when leaf veins become severely yellowed. Tomato fruits show brown patches, a rough surface, and deformed growth; in severe cases, necrosis occurs in the inflorescence stalks, calyxes, and petioles, affecting the commercial value of tomatoes, causing complete crop failure, and resulting in significant economic losses. ToBRFV primarily targets tomatoes, and infected tomato seeds, weeds, and diseased plant debris can all serve as primary sources of infection, thus influencing the virus's spread. Infected seeds can be spread over long distances through international trade, while in fields and greenhouses, mechanical operations and insects are the main modes of transmission. Due to its high survival rate, strong latency, and easy transmissibility, ToBRFV's damage to crops continues to escalate, and the trend of global warming is further fueling its spread. Against this backdrop, exploring effective control methods has become a crucial issue that researchers urgently need to address.

[0003] RNA silencing is a major viral infection defense mechanism in plants. Dicer-like (DCL), Argonaute (AGO), and RNA-dependent RNA polymerase (RDR) proteins are crucial components of this mechanism, playing important roles in post-transcriptional regulation and chromatin modification. These three protein families cooperate to facilitate the complete gene silencing cycle. RDR proteins play a vital role in RNA-mediated processes. They contain a unique RdRP domain, enabling them to synthesize double-stranded RNA (dsRNA) using single-stranded RNA (ssRNA) as a template. Previous studies have found... AtRDR1 It can be induced by SA and viral infection. NbRDR1Genes can limit early systemic infection of potato spindle tuber viroid (PSTVd) in plants. The AtRDR6 protein plays a crucial role in multiple RNA silencing pathways, a function essential for defense against viruses such as tobacco mosaic virus and cucumber mosaic virus. In tomatoes, the gene derived from Chilean tomatoes (…) Solanum chilense )of Ty-1 and Ty-3 These two genes encode the alleles of the RDR3b protein, which play an important role in the formation of resistance to Tomato Yellow Leaf Curl Virus (TYLCV).

[0004] Hairy tomatoes Solanum habrochaites This is a wild tomato variety with superior resistance and quality characteristics lacking in cultivated tomatoes, making it suitable for tomato breeding to improve resistance. Currently, the components related to the RNA silencing pathway in hairy tomatoes and their defensive role against viral diseases have not been identified or elucidated. Hairy tomato RDR gene ShRDR There are no reports on the antiviral function of RDR in plants or on the creation of germplasm materials resistant to TOBRFV. Summary of the Invention

[0005] To address at least some of the problems in the prior art, the present invention provides a tomato antiviral related gene. ShRDR1 A novel application in resistance to tomato brown wrinkle virus. This invention utilizes genetic engineering techniques to obtain stably heritable overexpression tomato plants. Phenotypic observation revealed that overexpression... ShRDR1 The gene had no significant effect on the growth and development of tomatoes. TOBRFV inoculation experiments were conducted on wild-type and transgenic tomatoes, respectively, and the results showed overexpression... ShRDR1 The gene can significantly enhance the resistance of tomatoes to TOBRFV. This invention provides a method for improving the virus resistance of tomatoes, which can effectively improve the resistance of tomatoes to Tomato Brown Ruffle Fruit Virus (TOBRFV) and has application value in the field of tomato cultivation. Specifically, this invention includes the following:

[0006] A first aspect of the present invention provides the use of isolated ShRDR1 protein or its encoding gene in resistance to tomato brown wrinkle virus, wherein the protein is selected from at least one of the following: (1) A protein having the amino acid sequence shown in SEQ ID No. 4; (2) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence of (1). (3) Proteins that have more than 80% identity with the amino acid sequence in (1) or (2) and have the same function; (4) In (1) The fusion protein obtained by attaching a tag to the end of any of the proteins described in (3).

[0007] In some embodiments, the application of substances regulating the ShRDR1 protein or its encoding gene according to the present invention in resistance to tomato brown wrinkle virus, wherein the protein is selected from at least one of the following: (1) A protein having the amino acid sequence shown in SEQ ID No. 4; (2) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence of (1). (3) Proteins that have more than 80% identity with the amino acid sequence in (1) or (2) and have the same function; (4) In (1) The fusion protein obtained by attaching a tag to the end of any of the proteins described in (3).

[0008] In some embodiments, the application of substances regulating ShRDR1 protein or its encoding gene according to the present invention in resistance to tomato brown wrinkle virus, wherein said substances include those capable of increasing the amount of ShRDR1 protein or promoting... ShRDR1 The substances that express genes.

[0009] In some embodiments, the application of a substance regulating the ShRDR1 protein or its encoding gene according to the present invention in resistance to tomato brown wrinkle virus, wherein the substance comprises at least one of the following: (a) A nucleic acid molecule expressing the protein; (b) An expression cassette containing the nucleic acid molecule described in (a); (c) A recombinant vector containing the nucleic acid molecule described in (a) or a recombinant vector containing the expression cassette described in (b); (d) A recombinant microorganism containing the nucleic acid molecule described in (a), or a recombinant microorganism containing the expression cassette described in (b), or a recombinant microorganism containing the recombinant vector described in (c); (e) A transgenic plant cell line containing the nucleic acid molecule described in (a) or a transgenic plant cell line containing the expression cassette described in (b); (f) Transgenic plant tissue containing the nucleic acid molecule described in (a), or transgenic plant tissue containing the expression cassette described in (b); (g) A transgenic plant organ containing the nucleic acid molecule described in (a) or a transgenic plant organ containing the expression cassette described in (b).

[0010] In some embodiments, the application of substances regulating the ShRDR1 protein or its encoding gene according to the present invention in resistance to tomato brown wrinkle virus, wherein... ShRDR1 The gene has the coding sequence shown in SEQ ID NO.3.

[0011] A second aspect of the present invention provides a method for improving the resistance of tomatoes to tomato brown wrinkle virus, comprising promoting ShRDR1 The steps to express the gene or increase the amount of ShRDR1 protein.

[0012] A third aspect of the present invention provides a method for preparing transgenic tomatoes with resistance to tomato brown wrinkle virus, comprising the following steps: 1) Construction ShRDR1 Recombinant expression vectors for gene overexpression; 2) The recombinant expression vector was transformed into tomato to obtain transgenic tomatoes with resistance to tomato brown wrinkle virus.

[0013] In some embodiments, the method for preparing transgenic tomatoes with resistance to tomato brown wrinkle virus according to the present invention, wherein, ShRDR1 The gene overexpression recombinant expression vector contains the coding sequence shown in SEQ ID NO.3.

[0014] In a fourth aspect, the present invention provides a transgenic tomato with resistance to tomato brown wrinkle virus, which is prepared by the method described in the third aspect.

[0015] A fifth aspect of the invention provides the application of the method described in the second or third aspect of the invention in the screening of resistant tomato lines or in tomato breeding.

[0016] This invention discloses for the first time a hairy tomato ShRDR1 The use of the gene in resistance to Tomato Brown Ruffle Fruit Virus (TOBRFV). This invention also provides a method for preparing transgenic tomatoes resistant to TOBRFV. In an exemplary embodiment, an overexpression vector is constructed from a gene fragment with the nucleotide sequence shown in SEQ ID NO.3, and then transferred into tomatoes via Agrobacterium-mediated transformation. The resulting transgenic tomatoes exhibit high resistance to TOBRFV and have significant application value in screening resistant tomato varieties and in tomato breeding. Attached Figure Description

[0017] Figure 1 for ShRDR1Gene expression in transgenic lines. A represents Flag- ShRDR1 The diagram shows the vector construction, where Hyg (Hygromycin) is the hygromycin resistance gene, and the 35S promoter is the cauliflower mosaic virus 35S promoter; B shows the electrophoresis results of the Flag-ShRDR1 recombinant plasmid in the transgenic lines detected by PCR, M: DNA Maker (2K Plus II), Ntc: No Template Control; P: Plasmid; H: H2O; C shows the expression of the Flag-ShRDR1 fusion protein in the transgenic lines detected by Western blot, with the fusion protein size being approximately 124 kDa.

[0018] Figure 2 for ShRDR1 Expression in T3 generation transgenic plants, A represents qRT-PCR analysis. ShRDR1 Expression in transgenic lines, error bars represent the standard deviation of three biological replicates, asterisks indicate statistically significant differences (*p<0.05); B represents the expression of Flag-ShRDR1 fusion protein in T3 generation plants of transgenic lines detected by Western blot.

[0019] Figure 3 for ShRDR1 Identification of viral disease resistance in transgenic tomato plants: A shows the symptoms of different genotypes of tomatoes inoculated with TOBRFV 30 days later, with MOCK representing the control treated with immersion buffer; B shows the expression of the TOBRFV virus CP gene in inoculated tomatoes by qRT-PCR, with the error bar representing the standard deviation of three biological replicates, and an asterisk indicating statistical significance (*p<0.05); C shows the expression of TOBRFV CP protein in plants detected by Western blot. Detailed Implementation

[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0021] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that the upper and lower limits of the range and each intermediate value between them are specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, are also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0022] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0023] Application of anti-tomato brown wrinkled fruit virus One aspect of the present invention provides the use of isolated ShRDR1 protein or its encoding gene in resistance to tomato brown wrinkle virus, wherein the protein is selected from at least one of the following: (1) A protein having the amino acid sequence shown in SEQ ID No. 4; (2) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence of (1). (3) Proteins that have more than 80% identity with the amino acid sequence in (1) or (2) and have the same function; (4) In (1) The fusion protein obtained by attaching a tag to the end of any of the proteins described in (3).

[0024] The term "isolated" as used in this invention does not necessarily refer to the purity of the protein or its encoding nucleic acid molecule of this invention, but rather to a protein or nucleic acid molecule that has been separated from its natural environment or from the components of the environment in which it was produced.

[0025] One aspect of the present invention provides the use of a substance regulating the ShRDR1 protein or its encoding gene in resistance to tomato brown wrinkle virus, wherein the protein is selected from at least one of the following: (1) A protein having the amino acid sequence shown in SEQ ID No. 4; (2) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence of (1). (3) Proteins that have more than 80% identity with the amino acid sequence in (1) or (2) and have the same function; (4) In (1) The fusion protein obtained by attaching a tag to the end of any of the proteins described in (3).

[0026] The inventor studied ShRDR Family genes play a role in regulating plant antiviral resistance, and it has been discovered that... ShRDRFamily genes play an antiviral role, and key regulatory genes within them have been screened and identified. ShRDR1 (Genes). Further research revealed that overexpression ShRDR1 It can significantly enhance the resistance of tomatoes to TOBRFV.

[0027] Based on this, those skilled in the art should understand that, without being bound by any theory, the "substance" in this invention refers to any substance capable of regulating the ShRDR1 protein or its encoding gene, including but not limited to nucleic acids, proteins, antibodies or fragments thereof, polypeptides, enzymes, sugars, small molecule compounds (e.g., esters, ketones, aldehydes), gene editing tools, etc.

[0028] In a preferred embodiment, the substance regulating the ShRDR1 protein or its encoding gene includes substances capable of increasing the amount of ShRDR1 protein or promoting... ShRDR1 Any substance that expresses a gene. Examples of such substances include, but are not limited to, agonists, promoters, or activators of the ShRDR1 protein, or enhancers, agonists, promoters, or activators for the expression of that gene.

[0029] In this invention, the term "substitution" refers to the replacement of one or more amino acids with different amino acids. "Deletion" refers to the reduction of one or more amino acids in the amino acid sequence. "Addition" refers to a change in the amino acid sequence resulting in an increase of one or more amino acids compared to the naturally occurring molecule. It should be noted that the protein obtained by substitution essentially has the same function or activity as the protein with the amino acid sequence shown in SEQ ID No. 4, that is, the variant protein retains or has enhanced function or activity against tomato brown wrinkle virus.

[0030] In this invention, conserved amino acid substitutions are preferred, and these conserved variant proteins are preferably produced by amino acid substitutions according to Table 1: Table 1 In this invention, the terms "identity" and "homology" are used interchangeably. Homologous sequences include those that are at least 80%, 85%, 90%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identical to the sequences mentioned in this invention. Similarly, proteins with the above-mentioned homology are essentially functionally or activity-like with the protein of the amino acid sequence shown in SEQ ID No. 4; that is, proteins with the above-mentioned homology retain or have enhanced function or activity against tomato brown wrinkle virus. To determine sequence identity, sequence alignment can be performed, which can be done in various ways known to those skilled in the art, for example, using BLAST, BLAST... 2. Software such as ALIGN, NEEDLE, or Megalign (DNASTAR). Those skilled in the art can determine the appropriate parameters for alignment, including any algorithm required to achieve optimal alignment across the full-length sequences being compared.

[0031] In this invention, "tag" refers to a tagged protein, examples of which include, but are not limited to: GST (glutathione thiotransferase) tagged protein, His6 tagged protein (His... Tag, MBP (maltose-binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tag protein, etc.

[0032] Furthermore, it should be understood that resistance to tomato brown wrinkle virus includes, but is not limited to, at least one of the following: (1) Inhibit the accumulation of viral RNA or reduce the amount of viral RNA; (2) Improve leaf appearance, including but not limited to improving the narrow mosaic pattern with mottling, dark green protrusions, yellowing or necrosis of leaf veins caused by the virus; (3) Improve fruit appearance, including but not limited to improving symptoms such as brown spots, rough surface, abnormal growth, or necrosis of inflorescence stalks, calyxes, and petioles caused by the virus.

[0033] Methods to improve the resistance of tomatoes to tomato brown wrinkle virus One aspect of the present invention provides a method for improving the resistance of tomatoes to tomato brown wrinkle virus, comprising promoting ShRDR1 The steps involved in gene expression or increasing the amount of ShRDR1 protein. Unbound by any theory, any... ShRDR1 Methods for overexpressing the gene or increasing the amount of ShRDR1 protein to improve the resistance of tomatoes to tomato brown wrinkle virus are all within the scope of protection of this invention.

[0034] In a preferred embodiment of a method for improving the resistance of tomatoes to tomato brown wrinkle virus, the method includes the step of using any of the following substances, said substances comprising: (a) A nucleic acid molecule expressing the protein described in this invention; (b) An expression cassette containing the nucleic acid molecule described in (a); (c) A recombinant vector containing the nucleic acid molecule described in (a) or a recombinant vector containing the expression cassette described in (b); (d) A recombinant microorganism containing the nucleic acid molecule described in (a), or a recombinant microorganism containing the expression cassette described in (b), or a recombinant microorganism containing the recombinant vector described in (c); (e) A transgenic plant cell line containing the nucleic acid molecule described in (a) or a transgenic plant cell line containing the expression cassette described in (b); (f) Transgenic plant tissue containing the nucleic acid molecule described in (a), or transgenic plant tissue containing the expression cassette described in (b); (g) A transgenic plant organ containing the nucleic acid molecule described in (a) or a transgenic plant organ containing the expression cassette described in (b).

[0035] In this invention, (a) the nucleic acid molecule can be any of the following DNA molecules: (a1) The nucleotide sequence contains the DNA molecule shown in SEQ ID NO.3; (a2) has 80%, preferably 90% or more, identity with the nucleotide sequence defined in (a1), and is derived from tomato and encodes the protein in a DNA molecule. (a3) A DNA molecule that hybridizes under strict conditions with the nucleotide sequence defined in (a1) and encodes the protein described above.

[0036] In a preferred embodiment of a method for improving the resistance of tomatoes to tomato brown wrinkle virus, the following is used: ShRDR1 Gene overexpression recombinant expression vector was used to transform tomatoes, thereby improving the resistance of tomatoes to tomato brown wrinkle virus.

[0037] The vectors described herein are known to those skilled in the art and include, but are not limited to: plasmids (e.g., pFGC5941, pTRV1, pTRV2, etc.), bacteriophages (e.g., λ phage or M13 filamentous phage, etc.), granules (i.e., Cosmids), Ti plasmids, or viral vectors.

[0038] It should be understood that existing plant expression vectors can be used to construct structures containing... ShRDR1 Recombinant gene expression vectors. These plant expression vectors include, but are not limited to, binary Agrobacterium vectors and vectors suitable for plant gene gun methods. The plant expression vectors may also contain the 3' untranslated region of a foreign gene, such as a polyadenylated signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylated signal can guide the addition of polyadenylated acid to the 3' end of the mRNA precursor; similar functions exist for the untranslated regions transcribed at the 3' end of Agrobacterium crown gall tumor-inducing (Ti) plasmid genes (such as the Nos gene for lipase synthesis) and plant genes (such as the soybean storage protein gene).

[0039] use ShRDR1 When constructing recombinant plant expression vectors, any type of enhancing promoter or constitutive promoter can be added before the transcription initiation nucleotide, including but not limited to the cauliflower mosaic virus (CAMV) 35S promoter and the maize ubiquitin promoter. These can be used alone or in combination with other plant promoters. Furthermore, when constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they need to be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.

[0040] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS gene, luciferase gene, etc.), antibiotic resistance markers (gentamicin marker, kanamycin marker, etc.), or chemical reagent resistance marker genes.

[0041] Methods for preparing genetically modified tomatoes One aspect of the present invention provides a method for preparing transgenic tomatoes with resistance to tomato brown wrinkle virus, comprising the following steps: 1) Construction ShRDR1 Recombinant expression vectors for gene overexpression; 2) The recombinant expression vector was transformed into tomato to obtain transgenic tomatoes with resistance to tomato brown wrinkle virus.

[0042] In this invention, the overexpression vector used in the gene overexpression process contains... ShRDR1 Gene expression vectors.

[0043] It should be understood that any vector capable of guiding the expression of exogenous genes in plants can be used to deliver the gene provided by this invention. ShRDR1 Genes or gene fragments are introduced into plant cells or recipient plants to obtain transgenic cell lines and transgenic plants resistant to tomato brown wrinkle virus. ShRDR1 Gene expression vectors can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, gene guns, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants.

[0044] In one specific embodiment, the preparation method of the present invention includes: (1) Construction of overexpression recombinant plasmid: Insert the gene with the nucleotide sequence shown in SEQ ID NO.3 into the vector to obtain the overexpression recombinant plasmid; (2) Preparation of Agrobacterium overexpression: The above-mentioned overexpression recombinant plasmid was transformed into Agrobacterium to obtain overexpression Agrobacterium carrying the recombinant plasmid; (3) Breeding transgenic tomato lines: Tomatoes were infected with the above-mentioned Agrobacterium overexpression to obtain tomato lines with high expression of tomato antiviral related genes; after self-pollination and selection, lines with stable high expression of the gene were obtained, which are transgenic tomato lines with resistance to tomato brown wrinkle virus.

[0045] In a preferred embodiment, the overexpression recombinant plasmid is pCAMBIA1300, and the overexpressing Agrobacterium is strain EHA105.

[0046] Genetically modified tomatoes The present invention also provides a transgenic tomato with resistance to tomato brown wrinkle virus, wherein the genome of the transgenic tomato contains a stable integration of the exogenous coding gene of said ShRDR1.

[0047] The transgenic tomatoes of this invention exhibit significantly enhanced resistance to tomato brown wrinkle virus compared to non-transgenic wild-type plants.

[0048] The specific type of tomato is not particularly limited in this invention. In one specific embodiment, the tomato is the Moneymaker tomato.

[0049] Screening of resistant tomato varieties or application in tomato breeding In one aspect, the present invention also provides the application of the above-described method in the screening of resistant tomato varieties or in tomato breeding, wherein, ShRDR1 Increased gene expression or an increase in the amount of ShRDR1 protein can be used for screening resistant tomato varieties or for tomato breeding.

[0050] The present invention therefore also provides a kit for screening resistant tomato lines, the kit comprising a detection reagent for the ShRDR1 protein or its encoding gene, and the kit further comprising instructions for screening for resistance to tomato brown wrinkle virus, wherein... ShRDR1 Increased gene expression or elevated levels of ShRDR1 protein are used to indicate that the tomato being screened is a resistant tomato variety. Examples of detection reagents include, but are not limited to, ShRDR1 protein-related detection antibodies and reagents used for amplification. ShRDR1 Primers and detection probes are required. Commercially available antibodies can be used for detection. The specific sequences of primers and probes are not particularly limited and can be designed and synthesized based on publicly available gene and protein databases.

[0051] The present invention also provides a kit for tomato breeding, the kit comprising components capable of increasing the amount of ShRDR1 protein or promoting… ShRDR1 A substance for gene expression, said substance comprising at least one of the following: (a) A nucleic acid molecule expressing the protein; (b) An expression cassette containing the nucleic acid molecule described in (a); (c) A recombinant vector containing the nucleic acid molecule described in (a) or a recombinant vector containing the expression cassette described in (b); (d) A recombinant microorganism containing the nucleic acid molecule described in (a), or a recombinant microorganism containing the expression cassette described in (b), or a recombinant microorganism containing the recombinant vector described in (c); (e) A transgenic plant cell line containing the nucleic acid molecule described in (a) or a transgenic plant cell line containing the expression cassette described in (b); (f) Transgenic plant tissue containing the nucleic acid molecule described in (a), or transgenic plant tissue containing the expression cassette described in (b); (g) A transgenic plant organ containing the nucleic acid molecule described in (a) or a transgenic plant organ containing the expression cassette described in (b).

[0052] In a preferred embodiment, the kit includes ShRDR1 Recombinant expression vectors for gene overexpression.

[0053] The materials used in the following examples—Agrobacterium invasive clone of tomato brown wrinkle virus, hairy tomato LA1777, and tomato variety Moneymaker—are available to the public from the Biotechnology Laboratory of the Institute of Economic Crops, Hebei Academy of Agricultural and Forestry Sciences, to replicate this experiment.

[0054] The cloning vector pEASY-Blunt Simple Cloning Kit was a product of TransGen Biotech (Beijing), catalog number CB111-01. The vector pCAMBIA1300 was a product of Cambia. The plant total RNA extraction kit was the Transzol Up Plant Total RNA Extraction Kit (TransGen Biotech (Beijing), catalog number ET111). The cDNA first-strand synthesis kit was the PrimeScript™ RTreagent Kit (catalog number: RR037A) from Takara.

[0055] Example This embodiment illustrates ShRDR1 Application in regulating resistance to brown wrinkled fruit virus disease in tomatoes.

[0056] 1. Hairy tomatoes ShRDR1 Acquisition of genes ShRDR1 The steps to obtain genes are as follows: 1) Obtaining the template Total RNA was extracted from young leaves of hairy tomato LA1777 using the Transzol Up plant total RNA extraction kit, and the total RNA was reverse transcribed into first-strand cDNA using the PrimeScript™ RT reagent Kit.

[0057] 2) Using the cDNA obtained in step 1 as a template, based on the genomes collected in the hairy tomato genome database... ShRDR1 ( Shab05g002220.1 Full-length sequence was amplified using primer pairs ShRDR1-F and ShRDR1-R, as shown in SEQ ID NO:1-SEQ ID NO:2. After PCR amplification, the target fragment was recovered, ligated into a sequencing vector, and transformed into *E. coli*. Single colonies of *E. coli* were selected for routine PCR detection, and colonies with the correct band size were sent to Sangon Biotech Co., Ltd. for sequencing. The sequences were then assembled to obtain a 3345 bp sequence. ShRDR1 The CDS sequence is shown in SEQ ID NO:3. It encodes the protein ShRDR1, or protein ShRDR1, with the amino acid sequence shown in SEQ ID NO:4.

[0058] 2. Recombinant plasmid pCAMBIA- ShRDR1 Construction The nucleotide sequence shown in SEQ ID NO.3 was obtained by homologous recombination. ShRDR1 The gene was constructed into the pCAMBIA-1300 vector with a Flag tag, resulting in pCAMBIA-Flag- ShRDR1 The recombinant plasmid is shown in the schematic diagram below. Figure 1 As shown in Figure A.

[0059] 3. ShRDR1 Obtaining transgenic positive tomato plants 1) The recombinant plasmid pCAMBIA-Flag-ShRDR1 was transformed into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium EHA105 / pCAMBIA-Flag- ShRDR1 .

[0060] 2) Activate the above-mentioned Agrobacterium on antibiotic-resistant plates, pick a single colony and inoculate it into LB liquid medium containing the corresponding antibiotic, and culture overnight at 28°C with shaking at 200 rpm. Centrifuge at 5000 rpm and discard the supernatant. Resuspend the bacterial cells in liquid MS medium containing 200 μmol / L AS. The OD600 of the resuspended culture is approximately 0.6. After mixing, let stand for about 1 hour to infect the pre-cultured leaves.

[0061] 3) Callus tissue was obtained through co-culture, and after differentiation culture, it was induced to sprout and grow into seedlings. After rooting culture in rooting medium, it was transferred to a greenhouse for further culture.

[0062] 4) After the transgenic seedlings have stabilized, total RNA is extracted from young leaves and reverse transcribed. Primers for identification of Flag-ShRDR1 are designed for PCR amplification. Figure 1 As shown in Figure B, a band of approximately 3436 bp was amplified from five transgenic plants, and the amplified products were confirmed by sequencing.

[0063] 5) Total protein was extracted from the above-mentioned positive plants, and SDS-PAGE gel electrophoresis was performed. Western blot detection was conducted using Flag antibody to confirm the expression of Flag-ShRDR1 fusion protein in the tissue culture seedlings. The results are as follows: Figure 1 As shown in C, a specific band of approximately 124 kDa was detected in all of the above plants, which is consistent with the size of the Flag-ShRDR1 fusion protein, indicating that the Flag-ShRDR1 fusion protein is normally expressed in transgenic tomato plants.

[0064] 6) The above-mentioned transgenic plants were further cultured and individual plants were harvested for propagation. The segregation ratio of the T2 generation was statistically analyzed and its phenotype was observed. Lines meeting a 1:3 segregation ratio were retained for propagation. Two plants, ShRDR1-OE#1 and ShRDR1-OE#2, were selected from the T3 generation for subsequent experiments. Primers ShRDR1-YF: TTCGGCTTGGTACCACGTT, SEQ ID NO:5; and ShRDR1-YR: TGAGAACTGGCCTGTTACGT, SEQ ID NO:6 were designed for qRT-PCR detection. It was found that the mRNA expression level of ShRDR1 in the transgenic plants was significantly increased and stably high. Quantitative results are shown in […]. Figure 2 As shown in Figure A; Western blot analysis revealed specific bands of approximately 124 kDa in all samples. The results are shown in Figure A. Figure 2 As shown in Figure B, the Flag-ShRDR1 fusion protein was obtained to demonstrate that the introduced ShRDR1 was normally expressed in the transgenic plants. The size of the specific band was consistent with the size of the Flag-ShRDR1 fusion protein, indicating that the Flag-ShRDR1 fusion protein was normally expressed in the transgenic tomato plants.

[0065] 4. ShRDR1 Identification of resistance to brown wrinkled fruit virus in transgenic tomato plants Will ShRDR1-OE The T3 generation was used to inoculate the TOBRFV virus, observe its symptoms, and utilize Western spectroscopy. Blot analysis of viral accumulation. Tomato phenotype as follows: Figure 3 As shown in Figure A, TOBRFV infection caused leaf curling and narrowing in MM plants, with dark green protrusions on the leaves; only the tips of the young leaves in the transgenic plants became thin and elongated, with MOCK serving as a control of healthy tomatoes treated with immersion buffer. Further analysis of the differences in TOBRFV virus accumulation among infected plants was conducted using primers ToBRFV-CP-F: TGTTAGGTTTCCTGACAGTG, SEQ ID NO:7; and ToBRFV-CP-R: CACCGTTGCGTCATCTACTCTAC, SEQ ID NO:8, to detect the expression level of the TOBRFV CP gene using qRT-PCR. Figure 3 As shown in B and 3C, the accumulation of viral RNA in TOBRFV-infected MM plants is significantly higher than that in transgenic plants. These results indicate that... ShRDR1 Overexpression of transgenic plants can significantly inhibit the accumulation of TOBRFV virus in plants.

[0066] In summary, this invention discloses a hairy tomato. ShRDR1 A novel application of the gene is that its overexpression can inhibit the accumulation of viral RNA in plants and improve the resistance of tomatoes to Tomato Brown Ruffle Virus. This invention also provides a method for preparing transgenic tomato lines resistant to Tomato Brown Ruffle Virus, and the prepared transgenic lines have significant application value in the field of tomato cultivation.

[0067] The sequences involved in this invention are as follows: Table 2 Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. These modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. The application of ShRDR1 protein or its encoding gene in resistance to tomato brown wrinkle virus, characterized in that, The protein is selected from at least one of the following: (1) A protein having the amino acid sequence shown in SEQ ID No. 4; (2) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence of (1). (3) Proteins that have more than 80% identity with the amino acid sequence in (1) or (2) and have the same function; (4) In (1) The fusion protein obtained by attaching a tag to the end of any of the proteins described in (3).

2. The application of substances regulating ShRDR1 protein or its encoding gene in resistance to tomato brown wrinkle virus, characterized in that, The protein is selected from at least one of the following: (1) A protein having the amino acid sequence shown in SEQ ID No. 4; (2) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence of (1). (3) Proteins that have more than 80% identity with the amino acid sequence in (1) or (2) and have the same function; (4) In (1) The fusion protein obtained by attaching a tag to the end of any of the proteins described in (3).

3. The application according to claim 2, characterized in that, The substances include those capable of increasing the amount of ShRDR1 protein or promoting... ShRDR1 The substances that express genes.

4. The application according to claim 2, characterized in that, The substance includes at least one of the following: (a) A nucleic acid molecule expressing the protein of claim 2; (b) An expression cassette containing the nucleic acid molecule described in (a); (c) A recombinant vector containing the nucleic acid molecule described in (a) or a recombinant vector containing the expression cassette described in (b); (d) A recombinant microorganism containing the nucleic acid molecule described in (a), or a recombinant microorganism containing the expression cassette described in (b), or a recombinant microorganism containing the recombinant vector described in (c); (e) A transgenic plant cell line containing the nucleic acid molecule described in (a) or a transgenic plant cell line containing the expression cassette described in (b); (f) Transgenic plant tissue containing the nucleic acid molecule described in (a), or transgenic plant tissue containing the expression cassette described in (b); (g) A transgenic plant organ containing the nucleic acid molecule described in (a) or a transgenic plant organ containing the expression cassette described in (b).

5. The application according to any one of claims 1-4, characterized in that, The ShRDR1 The gene has the coding sequence shown in SEQ ID NO.

3.

6. A method for improving the resistance of tomatoes to tomato brown wrinkle virus, characterized in that, Including promoting ShRDR1 The steps to express the gene or increase the amount of ShRDR1 protein.

7. A method for preparing transgenic tomatoes with resistance to tomato brown wrinkle virus, characterized in that, It includes the following steps: 1) Construction ShRDR1 Recombinant expression vectors for gene overexpression; 2) The recombinant expression vector was transformed into tomato to obtain transgenic tomatoes with resistance to tomato brown wrinkle virus.

8. The method for preparing transgenic tomatoes with resistance to tomato brown wrinkle virus according to claim 7, characterized in that, The ShRDR1 The gene overexpression recombinant expression vector contains the coding sequence shown in SEQ ID 3.

9. A transgenic tomato with resistance to tomato brown wrinkle virus, characterized in that, It is prepared by the method described in claim 7 or 8.

10. The application of the method according to any one of claims 6-8 in the screening of resistant tomato varieties or in tomato breeding.

Citation Information

Patent Citations

  • ToBRFV, TMV, ToMV and ToMMV resistant tomato plants and corresponding resistance genes

    CN116847729A

  • Application of tomato Solyc04g064880 gene in regulation and control of ToBRFV resistance of plants

    CN120519511A

  • Genetic determinants conferring improved ToBRFV resistance

    CN121013646A

  • Tobamovirus-resistant tomato plants

    US20230329170A1