Molecular marker associated with egg size trait in hens and reagent and application thereof

Abstract

The application discloses a molecular marker related to a hen distance long trait, a detection reagent and application thereof, and belongs to the technical field of molecular genetics. DIS3L2 Five SNP sites significantly associated with the hen distance long trait are identified in the 13th intron of the chicken gene, and based on the SNP sites, a molecular marker related to the distance long trait and a detection reagent are designed, which can be used for early screening of hens with the long distance trait, and have important application value for improving poultry breeding benefits.

Description

Technical Field

[0001] This invention relates to the field of molecular genetics, specifically to a molecular marker related to the spur length trait in hens, its detection reagents, and applications. Background Technology

[0002] The spur is a distinctive toe-like structure located on the inner side of the ankle of a chicken, composed of the cuticle of the epidermis and the ossified core of the dermis. While spurs are generally considered a male-specific secondary sexual characteristic, domestic and international studies have indicated that some chicken breeds exhibit long spurs in hens. Furthermore, spurred hens outperform spurless hens in terms of weight, shank length, and body length. For local breeds, spurred hens not only show superior growth performance but also demonstrate better environmental adaptability. The offspring of long-spurred hens often exhibit early spur development in roosters, suggesting a possible maternal genetic basis for this trait. In actual production, the developmental level of the spur is often used as an important auxiliary tool to aid in selective breeding. During the poultry market, spur length is often considered related to the length of the rearing period, thus possessing certain economic benefits, and the selection of individuals with longer spurs is receiving increasing attention. However, the specific genetic mechanisms, related molecular markers, and breeding potential of the long-spur trait in hens (i.e., the phenomenon of hens exhibiting longer spurs) are still under investigation.

[0003] The DIS3-like 3'-5' exoribonuclease 2 gene (DIS3L2) is an RNA-binding protein that encodes a highly conserved 3'-5' exonuclease. It possesses 3'-5' exonuclease activity and plays a role in maintaining cell proliferation and tissue growth. Currently, in chickens... DIS3L2 There is relatively little research on genes; patent CN 118222719A discloses chickens DIS3L2 The presence of a SNP locus associated with egg length diameter within intron 6 of the gene is beneficial for improving egg length diameter. However, no evidence of this has been found in chickens. DIS3L2 Reports on the correlation between genes and the spur length trait in hens. Summary of the Invention

[0004] In view of the above-mentioned prior art, the purpose of this invention is to provide a molecular marker related to the spur length trait of hens, as well as its detection reagents and applications.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] In a first aspect, the present invention provides a molecular marker related to the spur length trait of hens, the nucleotide sequence of which is shown in SEQ ID NO.1, comprising SNP1, SNP2, SNP3, SNP4, and SNP5 sites. The 70th base of the sequence shown in SEQ ID NO.1 is the SNP1 site, and its base is a or g; the 141st base of the sequence shown in SEQ ID NO.1 is the SNP2 site, and its base is a or g; the 451st base of the sequence shown in SEQ ID NO.1 is the SNP3 site, and its base is g or t; the 539th base of the sequence shown in SEQ ID NO.1 is the SNP4 site, and its base is g or t; and the 547th base of the sequence shown in SEQ ID NO.1 is the SNP5 site, and its base is c or t.

[0007] The specific nucleotides marked with molecular markers are as follows:

[0008] aaggactggttaggaacacgcaagtaagcctggagccaagagcttttggtcagggtcctctcttgcttga / g(SNP1)aagaaacaatctgttcataaactacttttggaaatcagactttcattttgaaatcatgcagagcttacatacata / g(SNP2)aaactttttaggaacag aggttcacctcattgatgttcatcatgcagtggctaataagctgggcttttgtttccaagcacgctgagtgctagagaaacgcagtttgcattacacaagtcattacacaagcttagtgttgtgctgaacagacaccctatgtgcttgactttagtacctgttatcaaactaacc tcagcatacgttttaaaacgcttgtgacattttaaatgggaggatttggccagggaaagcatcctgttccagtgataccccataacagattagcggtgttttattttgctctgtgctg / t(SNP3)ttgtggaggagccatgaaagagaaggtattgaagcatcacttgtgtgagat ttgagttaaaaacctcttctgcttctactttcaaagggg / t(SNP4)ctggttcc / t(SNP5)cagtcagcctgcttcctaggtggtgtgatgaagtgggttatgcttcacaagaggcatttcacactgtacggaatctgtctcccctggcaaaagtgtcagggtgaaagtaat.

[0009] Note: The nucleotides in bold shaded areas in the sequence are SNP sites, which are represented in the sequence listing as corresponding degenerate bases.

[0010] This invention is in chicken DIS3L2 Five SNP sites that were significantly associated with the spur length trait in hens were found in the 13th intron region of the gene (GenBank No: NC_052540.1, Gene ID: 424934).

[0011] The physical locations corresponding to the above 5 SNP sites are as follows:

[0012] The physical location of SNP1 is 9_15670285; its base polymorphism is a or g, and the dominant allele associated with the distance trait is a;

[0013] The physical location of SNP2 is 9_15670356; its base polymorphism is a or g, and the dominant allele associated with the distance trait is a;

[0014] The physical location of SNP3 is 9_15670666; its base polymorphism is g or t, and the dominant allele associated with the distance trait is g;

[0015] The physical location of SNP4 is 9_15670754; its base polymorphism is g or t, and the dominant allele associated with the distance trait is g;

[0016] The physical location of SNP5 is 9_15670762; its base polymorphism is c or t, and the dominant allele associated with the distance trait is c.

[0017] The reference genome for the above physical location is GRCg6a.

[0018] Based on these 5 SNP sites, this invention developed molecular markers associated with the spur length trait in hens for use in the breeding of hens with the spur length trait.

[0019] A second aspect of the present invention provides a detection reagent for the above-mentioned molecular marker, comprising: the primer pair shown in SEQ ID NO.2 and SEQ ID NO.3; specifically as follows:

[0020] DIS3L2 -F:5'-AAGGACTGGTTAGGAACACG-3'; (SEQ ID NO.2)

[0021] DIS3L2 -R:5'-CCATTACTTTCACCCTGACA-3'. (SEQ ID NO.3)

[0022] Preferably, the detection reagent is a PCR sequencing kit or a KASP typing kit.

[0023] A third aspect of the present invention provides the application of the above-mentioned molecular markers in the selection of hens with long-spur traits.

[0024] A fourth aspect of the present invention provides the use of the above-described detection reagent in the following (1) or (2):

[0025] (1) Identify the spur length trait of hens;

[0026] (2) Selecting and breeding hens with long spurs;

[0027] In the above applications, the distance length includes: 130d distance length, 240d distance length and 360d distance length.

[0028] In the above applications, the method for selecting hens with the long spur trait is as follows:

[0029] Using the genomic DNA of the hen to be tested as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain the amplification products; the amplification products were sequenced, and the spur length trait of the hen was identified based on the sequencing results, and hens with the spur length trait were selected for breeding.

[0030] Specifically, if the sequencing results of the amplified product correspond to the sequence shown in SEQ ID NO.1, the 70th base is the aa genotype, the 141st base is the aa genotype, the 451st base is the gg genotype, the 539th base is the gg genotype, and the 547th base is the cc genotype, then it is identified as having the long-range trait.

[0031] Alternatively, based on the sequencing results of the amplified products, determine the bases of the five SNP sites in the above molecular markers, construct a diploid, and select individuals with the diploid type H1H1 to breed long-distance offspring.

[0032] The bases corresponding to the double form H1H1 at the SNP1-SNP5 sites are: aaggc / aaggc.

[0033] Preferably, the PCR amplification system is: 10 μL of 2×Phanta Max Master Mix. DIS3L2 -F 0.8 μL, DIS3L2 -R 0.8 μL, cDNA template 1.0 μL, ddH2O 7.4 μL.

[0034] The PCR amplification program was as follows: 95 ℃ for 3 min; 95 ℃ for 15 s, 56.8 ℃ for 15 s, 72 ℃ for 45 s, 35 cycles; 72 ℃ for 5 min.

[0035] The beneficial effects of this invention are:

[0036] Hens with long spurs generally outperform spurless chickens in terms of weight, shank length, and body oblique length, and their offspring roosters often exhibit early spur development. Furthermore, in the poultry market, spur length is often considered related to the length of the rearing period, thus having certain economic benefits. Therefore, breeding hens with long spurs is of great significance for practical production. This invention is the first of its kind in chickens... DIS3L2Five SNP sites significantly associated with spur length in hens were identified in the 13th intron of the gene. Based on these SNP sites, this invention designs molecular markers and their detection reagents related to spur length traits, which can be used for early screening of hens with long spur traits, and have important application value for improving the efficiency of poultry farming. Attached Figure Description

[0037] Figure 1 GWAS analysis of the distance length trait of Langya hens at 130 days of age: Manhattan plot and QQ-plot; in the figure, A is the Manhattan plot and B is the QQ-plot.

[0038] Figure 2 GWAS analysis of the distance length trait of Langya hens at 240 days of age: Manhattan plot and QQ-plot; in the figure, A is the Manhattan plot and B is the QQ-plot.

[0039] Figure 3 GWAS analysis of the distance length trait of Langya hens at 360 days of age: Manhattan plot and QQ-plot; in the figure, A is the Manhattan plot and B is the QQ-plot.

[0040] Figure 4 LD linkage disequilibrium analysis of significant SNP sites. Detailed Implementation

[0041] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0042] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0043] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions.

[0044] Example 1: Screening, identification, and association analysis of SNP molecular markers associated with spur length in hens.

[0045] 1. Genome-wide association analysis:

[0046] This study used hens from the Langya chicken breeding flock of Shandong Jihua Poultry Breeding Co., Ltd. as the research subjects. These chickens were hatched in the same batch and were raised in the same pens under the same conditions during the brooding and rearing stages, using a uniform lighting regime and feeding management methods. Hens were housed individually, and their spur length (SL) was measured and recorded at 130, 240, and 360 days of age. After the measurements, blood was collected from the subwing vein and anticoagulated with EDTA, then stored at -20℃ for subsequent genomic DNA extraction.

[0047] Genomic DNA was extracted and whole-genome resequencing was performed. Genome-wide association analysis (GWAS) was conducted on the spur length trait of Langya chickens at 130, 240 and 360 days of age.

[0048] Manhattan plot and QQ-plot of GWAS analysis are as follows Figures 1-3 As shown. GWAS analysis revealed strong signals in the 15.55–15.71 Mb region of chromosome 9 at all three stages, containing 113 significant SNP sites, with the most significant SNP site located at... DIS3L2 Gene (GenBank No: NC_052540.1, Gene ID: 424934).

[0049] 2. Chain Disequilibrium (LD) Analysis:

[0050] extract DIS3L2 Linkage disequilibrium (LD) analysis was performed on 37 loci in the Langya chicken population using Haploview software.

[0051] The results of the chain disequilibrium (LD) analysis are as follows: Figure 4 As shown. Five of the most prominent sites were selected, all of which are located in... DIS3L2 In the 13th intron of the gene, the 9_15670666 (G>T) site is located in the non-linked region at the junction of two blocks, the 9_15670285 (A>G) and 9_15670356 (A>G) sites are located in the linked region of the first block, and the 9_15670754 (G>T) and 9_15670762 (C>T) sites are located in the linked region of the second block.

[0052] 3. Association analysis of five SNPs with the spur length trait of Langya hens:

[0053] The correlation analysis between the above 5 SNPs and the spur length trait of Langya hens was carried out, and the results are shown in Table 1.

[0054] Table 1: Association analysis of five significant SNPs with spur length in the Langya chicken population

[0055]

[0056] Note: The values ​​in the table are the least squares mean ± standard error of the 130d, 240d, and 360d distances. P <0.05 indicates a significant difference; distance is measured in millimeters (mm).

[0057] The results showed that locus 9_15670285 was significantly associated with the 130-day interval (P=0.03) and 360-day interval (P=0.017), with individuals with the dominant allele a, ag, and aa genotypes corresponding to longer intervals; locus 9_15670356 was significantly associated with the 130-day interval (P=0.033) and 360-day interval (P=0.031), with individuals with the dominant allele a, ag, and aa genotypes corresponding to longer intervals; locus 9_15670666 was significantly associated with the 130-day interval (P=0.017) and 240-day interval (P=0.017). The 9_15670754 locus was significantly associated with both the 130-day and 360-day distances (P=0.001), with the dominant allele being g and individuals with the gg genotype corresponding to longer distances. The 9_15670754 locus was significantly associated with both the 130-day and 360-day distances (P=0.017), with the dominant allele being g and individuals with the gt and gg genotypes corresponding to longer distances. The 9_15670762 locus was significantly associated with both the 130-day and 360-day distances (P=0.017), with the dominant allele being c and individuals with the ct and cc genotypes corresponding to longer distances.

[0058] Example 2: Construction of haplotypes and diploids of five SNPs, allele frequency analysis, and trait association analysis based on distance.

[0059] 1. Haplotype construction and allele frequency analysis:

[0060] Three haplotypes were constructed in the Langya chicken population using Haploview V4.2 software for five SNP loci. The results are shown in Table 2. Among them, haplotype H1 had the highest frequency and H3 had the lowest frequency.

[0061] Table 2: Haplotype frequency analysis of 5 SNPs in the Langya chicken population

[0062]

[0063] 2. Construction of diploid types and association analysis with spur traits:

[0064] Based on the three haplotypes constructed, haplotype combinations (diplotypes) were further constructed, resulting in a total of six diplotypes, as shown in Table 3.

[0065] Table 3: Diplotype frequency analysis of 5 SNPs in the Langya chicken population

[0066]

[0067] Further association analysis was conducted between the six constructed diploid types and the distance trait of the Langya chicken population, and the results are shown in Table 4.

[0068] Table 4: Association analysis of diploid types of 5 SNPs with spur length in Langya chicken population

[0069]

[0070] The values ​​in the table are the least squares mean soil standard errors of SL-130d (130-day interval), SL-240d (240-day interval), and SL-360d (360-day interval). P <0.05 indicates a significant difference.

[0071] The results showed that each diploid type was significantly associated with the distance trait at all three time points. Specifically, the H1H1 diploid individuals corresponded to longer distances, while the H3H3 diploid individuals corresponded to shorter distances. In breeding practice, this molecular marker can be used to select homozygous individuals with the H1H1 (aaggc / aaggc) genotype in a population to assist in breeding long-distance progeny.

[0072] Example 3: Design and application verification of molecular markers related to spur length traits in hens.

[0073] 1. Design of molecular markers and detection primers related to spur length traits in hens:

[0074] Based on the five SNP sites significantly associated with spur length traits in hens identified in Example 1, this example designs a molecular marker associated with spur length traits in hens. The nucleotide sequence is shown in SEQ ID NO.1, containing SNP1, SNP2, SNP3, SNP4, and SNP5 sites. The 70th base of the sequence shown in SEQ ID NO.1 is the SNP1 site, and its base is a or g; the 141st base of the sequence shown in SEQ ID NO.1 is the SNP2 site, and its base is a or g; the 451st base of the sequence shown in SEQ ID NO.1 is the SNP3 site, and its base is g or t; the 539th base of the sequence shown in SEQ ID NO.1 is the SNP4 site, and its base is g or t; the 547th base of the sequence shown in SEQ ID NO.1 is the SNP5 site, and its base is c or t.

[0075] Based on the above molecular markers, detection primer pairs were designed as follows:

[0076] DIS3L2-F:5'-AAGGACTGGTTAGGAACACG-3'; (SEQ ID NO.2)

[0077] DIS3L2 -R:5'-CCATTACTTTCACCCTGACA-3'. (SEQ ID NO.3)

[0078] 2. Application Validation:

[0079] Another 200 Langya chicken hens with a 360-day distance record were selected as test subjects. Genomic DNA was extracted from the test subjects and PCR amplification was performed using the above-mentioned detection primer pairs. The PCR amplification system is shown in Table 5.

[0080] Table 5: PCR amplification system

[0081]

[0082] The PCR reaction program was as follows: 95 ℃ for 3 min; 95 ℃ for 15 s, 56.8 ℃ for 15 s, 72 ℃ for 45 s, 35 cycles; 72 ℃ for 5 min.

[0083] Sequencing analysis of the amplified products was performed, and the spur length trait in hens was predicted based on the base detection results at five SNP sites in the molecular markers. Specifically:

[0084] Hens with genotypes aa, aa, gg, gg, and cc at SNP1, SNP2, SNP3, SNP4, and SNP5 loci, respectively, have a 360-day distance longer than chickens with genotypes gg, gg, tt, tt, and tt at the corresponding loci.

[0085] Comparing the marker-based predictions with the actual 360-day spur length records of the corresponding hens revealed consistency. This demonstrates that the marker combination of the present invention can be used for predicting spur length traits in hens.

[0086] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. The application of a molecular marker associated with the distance from the hen trait in the selection of Langya hen hens with long distance traits, characterized by, The nucleotide sequence of the molecular marker associated with the spur length trait in hens is shown in SEQ ID NO.1, and includes SNP1, SNP2, SNP3, SNP4 and SNP5 sites; The 70th base of the sequence shown in SEQ ID NO.1 is SNP1, with a or g; the 141st base is SNP2, with a or g; the 451st base is SNP3, with g or t; the 539th base is SNP4, with g or t; and the 547th base is SNP5, with c or t. The sequence shown in SEQ ID NO.1 has the following genotypes: genotype 70 at position 70, genotype 141 at position 141, genotype 451 at position 451, genotype 539 at position 539, and genotype 547 at position 547; therefore, it is identified as having the long-span trait. The long-span trait refers to the Langya chicken having a longer span of 130 days or 360 days.

2. The application of the detection reagent or detection kit in the following (1) or (2): (1) Identify the spur length trait of Langya chicken hens; (2) Select and breed Langya chickens with long spurs; The detection kit comprises detection reagents; the detection reagents comprise: primer pairs for detecting the molecular marker of claim 1, wherein the primer pairs have nucleotide sequences as shown in SEQ ID NO.

2. DIS3L2 -F and SEQ ID NO.3 DIS3L2 -R; The spur length is 130 days or 360 days; the long spur trait is that Langya chickens have a longer 130-day or 360-day spur length. The method for selecting and breeding Langya hens with long spur traits is as follows: Using the genomic DNA of the Langya hen to be tested as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain the amplification products; the amplification products were sequenced, and the spur length trait of the Langya hen was identified based on the sequencing results, and Langya hens with the long spur trait were bred. If the sequencing results of the amplified product correspond to the sequence shown in SEQ ID NO.1, the 70th base is the aa genotype, the 141st base is the aa genotype, the 451st base is the gg genotype, the 539th base is the gg genotype, and the 547th base is the cc genotype, then it is identified as having the long-range trait.

3. The application according to claim 2, characterized in that, The PCR amplification system consisted of: 10 μL of 2×PhantaMax MasterMix. DIS3L2 -F 0.8 μL, DIS3L2 -R 0.8 μL, cDNA template 1.0 μL and ddH2O 7.4 μL; The PCR amplification program was as follows: 95 ℃ for 3 min; 95 ℃ for 15 s, 56.8 ℃ for 15 s, 72 ℃ for 45 s, 35 cycles; 72 ℃ for 5 min.

Images