A multivalent glycopeptide and a preparation method and use thereof
A one-step reaction between a polypeptide containing multiple cysteine residues and a glycosyl sulfinate is used to prepare multivalent glycopeptides, which solves the problems of complex synthesis and insufficient liver-targeting ability of existing technologies, and realizes a simple and efficient preparation of liver-targeting drugs.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Tianfu Jincheng Laboratory (Frontier Medical Center)
- Filing Date
- 2026-03-06
- Publication Date
- 2026-06-16
AI Technical Summary
Existing multivalent glycopeptides have simple structural designs, complicated synthesis steps, and low yields, and their liver-targeting ability needs to be improved.
A multivalent glycopeptide was synthesized in one step by reacting a polypeptide containing multiple cysteine residues with glycosyl sulfinates and an oxidant in a solvent. The multivalent glycosylation modification was carried out using acetylgalactosamine to prepare a multivalent glycopeptide with liver-targeting ability.
This method enables the simplified synthesis of multivalent glycopeptides, improves liver-targeting capabilities, and is suitable for the development of liver-targeting drugs, showing broad application prospects.
Smart Images

Figure CN121800880B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of polypeptide drugs, specifically relating to a multivalent glycopeptide, its preparation method, and its uses. Background Technology
[0002] Multivalent glycopeptides have significant applications in the biomedical field. Their unique structure endows them with a variety of biological functions, such as participating in cell recognition, signal transduction, and immune regulation. In drug development, multivalent glycopeptides can serve as potential drug molecules or drug carriers, enhancing the targeting, stability, and efficacy of drugs.
[0003] However, current structural design approaches for multivalent glycopeptides tend to be simplistic, primarily relying on multi-step solid-phase synthesis, which is cumbersome and yields low results. Therefore, redesigning a simple and easily synthesized multivalent glycopeptide structure is of significant importance. Furthermore, the liver-targeting ability of current glycopeptides needs further improvement. There is a need to research multivalent glycopeptides with superior liver-targeting capabilities. Summary of the Invention
[0004] The purpose of this invention is to provide a multivalent glycopeptide, its preparation method, and its uses. The multivalent glycopeptide of this invention has advantages such as convenient synthesis, controllable sugar number, and strong targeting ability, thus meeting the needs of biomedical research and drug development for multivalent glycopeptides.
[0005] This invention provides a multivalent glycopeptide, the structure of which is shown in Formula I:
[0006]
[0007] Formula I
[0008] in,
[0009] a is an integer selected from 0 to 50;
[0010] b is an integer selected from 1 to 50;
[0011] c is an integer selected from 0 to 50;
[0012] d is an integer selected from 1 to 50;
[0013] e is an integer selected from 1 to 50;
[0014] f is an integer selected from 0 to 50;
[0015] Each X is independently selected from glycine, alanine, valine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine, histidine, selenocysteine, pyrrolidone, or non-natural amino acids.
[0016] n is selected from 0 or 1;
[0017] R is a substituent at any position on the ring, and m is the number of substituents R.
[0018] m is selected from 3 or 4;
[0019] R are selected independently from -L1R X Alternatively, two adjacent R values can be connected to form a loop, with the remaining R values independently selected from -L1R. X The ring is either unreplaced or surrounded by one or two or more -L1R rings. X Replacement ring;
[0020] L1 is selected from none or C. 1~2 Alkylene;
[0021] R x Selected from hydrogen, hydroxyl, C 1~6 Alkyl, -OAc, -OBn, -OR8, -NR9R 10 , Ph, N3, amino , ;
[0022] i is an integer selected from 0 to 6;
[0023] R 11 R 12 R 13 R 14 Each is independently selected from -L2R y ;
[0024] L2 is selected from none or C. 1~2 Alkylene;
[0025] R y Selected from hydrogen, hydroxyl, C 1~6 Alkyl, -OAc, -OBn, -OR8, -NR9R 10 ;
[0026] R8 is selected from C 1~6 alkyl;
[0027] R9 is selected from hydrogen, C 1~6 Alkyl, Ac, Bn ;
[0028] R 10 Selected from hydrogen, C 1~6 Alkyl, Ac, Bn .
[0029] Furthermore, the aforementioned The structure is selected from one of the following structures:
[0030] .
[0031] Furthermore, the structure of the multivalent glycopeptide is selected from one of the following structures:
[0032] .
[0033] The present invention also provides a method for preparing the aforementioned multivalent glycopeptides, comprising the following steps:
[0034] In a solvent, glycosyl sulfinates, polypeptides containing multiple cysteine residues, isothiazolinone compounds, and oxidants react to yield multivalent glycopeptides.
[0035] The polypeptide containing multiple cysteine residues is a polypeptide containing multiple thiol groups or multiple disulfide bonds, and the structure of the polypeptide is shown in Formula II:
[0036]
[0037] Formula II
[0038] in,
[0039] a is an integer selected from 0 to 50;
[0040] b is an integer selected from 1 to 50;
[0041] c is an integer selected from 0 to 50;
[0042] d is an integer selected from 1 to 50;
[0043] e is an integer selected from 1 to 50;
[0044] f is an integer selected from 0 to 50;
[0045] Each X is independently selected from glycine, alanine, valine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine, histidine, selenocysteine, pyrrolidone, or non-natural amino acids.
[0046] The structure of the glycosyl sulfinate is shown in Formula III:
[0047]
[0048] Formula III
[0049] in,
[0050] n is selected from 0 or 1;
[0051] R is a substituent at any position on the ring, and m is the number of substituents R.
[0052] m is selected from 3 or 4;
[0053] R are selected independently from -L1R X Alternatively, two adjacent R values can be connected to form a loop, with the remaining R values independently selected from -L1R. X The ring is either unreplaced or surrounded by one or two or more -L1R rings. X Replacement ring;
[0054] L1 is selected from none or C. 1~2 Alkylene;
[0055] R x Selected from hydrogen, hydroxyl, C 1~6 Alkyl, -OAc, -OBn, -OR8, -NR9R 10 , Ph, N3, amino , ;
[0056] i is an integer selected from 0 to 6;
[0057] R 11 R 12 R 13 R 14 Each is independently selected from -L2R y ;
[0058] L2 is selected from none or C. 1~2 Alkylene;
[0059] R y Selected from hydrogen, hydroxyl, C 1~6 Alkyl, -OAc, -OBn, -OR8, -NR9R10 ;
[0060] R8 is selected from C 1~6 alkyl;
[0061] R9 is selected from hydrogen, C 1~6 Alkyl, Ac, Bn ;
[0062] R 10 Selected from hydrogen, C 1~6 Alkyl, Ac, Bn ;
[0063] j is 1 or 2;
[0064] M j+ It is a j-valent cation.
[0065] Furthermore,
[0066] The oxidant is selected from one or more of hydrogen peroxide, tert-butanol peroxide, potassium persulfate, oxygen, and tert-butyl peroxide;
[0067] And / or, the solvent is an aqueous solution;
[0068] And / or, the reaction is carried out at room temperature;
[0069] And / or, the reaction is carried out in an inert gas atmosphere.
[0070] Preferably, the solvent is water, a buffer solution, or a mixture of water and acetonitrile.
[0071] More preferably, the volume ratio of water to acetonitrile is 1:1.
[0072] Furthermore, the polypeptide containing multiple cysteine residues is a polypeptide containing multiple thiol groups, and the number of amino acid residues in the polypeptide is 2-200.
[0073] The preparation method includes the following steps: first, a polypeptide containing multiple thiol groups and isothiazolinone compound A are used as raw materials to carry out a first-step reaction in a solvent; then, glycosyl sulfinate and an oxidant are added to carry out a second-step reaction to obtain a glycosylated modified peptide; the structure of compound A is as follows:
[0074]
[0075] Rz is selected from hydrogen or C. 1-8 alkyl.
[0076] Preferably, Rz is selected from hydrogen.
[0077] Furthermore, the molar ratio of cysteine, isothiazolinone compound A, glycosyl sulfinate, and oxidant in the polypeptide containing multiple thiol groups is 1:(1-10):(3-20):(3-20).
[0078] And / or, the ratio of the polypeptide containing multiple thiol groups to the solvent is (0.01-0.5) mmol: 1 mL;
[0079] And / or, the reaction time of the first step is 5-20 minutes; the reaction time of the second step is 0.5-1.5 hours.
[0080] Preferably,
[0081] The molar ratio of cysteine, isothiazolinone compound A, glycosyl sulfinate, and oxidant in the polypeptide containing multiple sulfhydryl groups is 1:1.23:3.7:3.7.
[0082] And / or, the ratio of the polypeptide containing multiple thiol groups to the solvent is 0.015 mmol: 1 mL;
[0083] And / or, the first step reaction takes 10 minutes; the second step reaction takes 1 hour.
[0084] Furthermore, the structure of the glycosyl sulfinate is selected from:
[0085] .
[0086] This invention also provides the use of the aforementioned multivalent glycopeptides in the preparation of liver-targeting drugs.
[0087] Furthermore, the liver-targeting drug is a drug obtained by linking the aforementioned multivalent glycopeptide with fluorescein, radionuclide, oncology drug, or small nucleic acid.
[0088] In this invention, -OBn is a benzyloxy group, and its structure is as follows: Ph represents phenyl; Bn represents benzyl; Ac represents acetyl, and the structure is as follows: .
[0089] In this invention, a polypeptide refers to a short chain of amino acids linked by peptide bonds. Polypeptides belong to a broad chemical category of biopolymers and oligomers. Polypeptides are naturally occurring small biomolecules, substances intermediate between amino acids and proteins. Since amino acids are the smallest molecules and proteins are the largest, peptides are short chains composed of amino acid monomers linked by peptide (amide) bonds. This covalent chemical bond is formed when the carboxyl group of one amino acid reacts with the amino group of another amino acid. A dipeptide is a protein fragment composed of two amino acids. Two or more amino acids undergo dehydration condensation to form several peptide bonds, thus forming a peptide. Multiple peptides undergo multilevel folding to form a protein molecule.
[0090] An amino acid residue refers to the portion of an amino acid that remains after it has lost water, as the amino acids linked by peptide bonds are dehydrated. When amino acids that make up proteins or polypeptides combine with each other, some of their groups participate in the formation of peptide bonds and lose a water molecule. Therefore, the amino acid units in a polypeptide are called amino acid residues.
[0091] The thiol group refers to the -SH group on cysteine, and the disulfide bond refers to the -SS- group formed by two cysteine groups in a covalent bond.
[0092] The polyvalent glycopeptides of the present invention are obtained by a one-step reaction using cysteine polypeptides and glycosyl sulfinates as raw materials. The raw materials are readily available, the reaction conditions are mild, the reaction time is short, the reaction process is controllable, and the resulting polyvalent glycopeptides have high yield and high purity.
[0093] This invention uses a cysteine peptide chain as the main chain and glycosyl sulfinates as raw materials for polyvalent glycosylation modification to obtain novel polyvalent glycopeptides. These polyvalent glycopeptides have various potential applications. When polyvalent glycosylation modification is performed using acetylgalactosamine, the resulting acetylgalactosamine polyvalent glycopeptide exhibits excellent liver-targeting ability, which is higher than that of Alnalym's traditional commercial tripeptide. This design can meet the needs of biomedical research and drug development for polyvalent glycopeptides.
[0094] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0095] This invention provides a multivalent glycopeptide with excellent liver-targeting activity, directly targeting the hepatic ASGPR receptor. This multivalent glycopeptide can be linked with fluorescein, radionuclides, oncology drugs, small nucleic acids, etc., to obtain a series of liver-targeting drugs. The multivalent glycopeptide of this invention has broad application prospects.
[0096] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.
[0097] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following embodiments. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description
[0098] Figure 1 This is a schematic diagram of the reaction process of the method for glycosylation modification of polypeptides containing multiple disulfide bonds or cysteine residues according to the present invention.
[0099] Figure 2 The high-performance liquid chromatogram of the polyvalent glycopeptide-linked fluorescein product (glycopeptide 1-Cy5) obtained in Example 4 is shown.
[0100] Figure 3 The figure shows the results of the in vitro endocytosis efficiency experiment of the polyvalent glycopeptide-linked fluorescein product obtained in Example 4 in liver cancer cells.
[0101] Figure 4 The figure shows the endosome escape efficiency of the polyvalent glycopeptide-linked fluorescein product obtained in Example 4 in liver cancer cells.
[0102] Figure 5 Figure 4 shows the in vivo hepatocyte fluorescence experiment animal organ imaging and data characterization results of the polyvalent glycopeptide-linked fluorescein product obtained in Example 4.
[0103] Figure 6 This is the mass spectrum of the positive strand of the multivalent glycopeptide 1-siRNA product.
[0104] Figure 7 This is the mass spectrum of the multivalent glycopeptide 1-siRNA product.
[0105] Figure 8 This is a figure showing the characterization results of the in vitro primary hepatocyte gene inhibition experiment of the multivalent glycopeptide-linked small nucleic acid drug in Example 5. Detailed Implementation
[0106] The raw materials and equipment used in this invention are all known products, obtained by purchasing commercially available products.
[0107] In this invention, room temperature refers to 20~40℃.
[0108] Glycosyl sulfinates were prepared according to the following method:
[0109] (a) Preparation of glycosyl sulfinates 1
[0110]
[0111] The specific steps are as follows:
[0112] Step 1: To a 100 mL round-bottom flask containing SI-1 (3.9 g, 10 mmol, 1.0 equiv) and 25 mL CH2Cl2, methyl 3-mercaptopropionate (1.3 mL, 12 mmol, 1.2 equiv) and BF3•Et2O (2.5 mL, 20 mmol, 2.0 equiv) were added sequentially. The reaction solution was stirred at room temperature for 1 h until TLC monitoring showed complete consumption of SI-1. The mixture was then washed with saturated NaHCO3 solution until neutral. The organic layer was separated, washed with saturated sodium chloride aqueous solution, dried over anhydrous sodium sulfate, and concentrated to obtain SI-2, which could be used directly in the next step without purification.
[0113] Step 2: Dissolve SI-2 in 20 mL of CH2Cl2 and cool at 0°C. While stirring, m -CPBA (m-chloroperoxybenzoic acid, 6 g, 30 mmol, 3 equiv) was slowly added to the reaction solution. The mixture was stirred at room temperature for 1 hour and then filtered. The filtrate was washed with saturated NaHCO3 solution until neutral, dried over anhydrous sodium sulfate, concentrated, and methyl tert-butyl ether was added. A solid precipitated and was filtered to obtain a white solid, SI-3.
[0114] Step 3: Dissolve SI-3 in 20 mL of MeOH at 0°C, add MeONa (540 mg, 10 mmol, 1.0 equiv), stir at 0°C for 2 hours, and concentrate after TLC monitoring shows complete consumption of SI-3. Wash with anhydrous ethanol and filter to obtain a white solid, namely glycosyl sulfinate 1. The overall yield of the three steps is 85%.
[0115] (II) Preparation of glycosyl sulfinates 2-24
[0116] Referring to the preparation method of sodium glycosyl sulfinate 1 described above, the only difference is that raw material SI-1 is replaced with the corresponding raw material to prepare glycosyl sulfinates 2-24 respectively.
[0117] The structure and structural characterization data of glycosyl sulfinates 1-24 are shown in Table 1. The total yield and purity of glycosyl sulfinates 1-24 after three steps are shown in Table 2.
[0118] Table 1. Structural and structural characterization data of glycosylsulfinates 1-24
[0119]
[0120] Table 2. Overall yield and purity of glycosyl sulfinates 1-24 after three steps
[0121]
[0122] Figure 1 This is a schematic diagram of the reaction process of the method for glycosylation modification of polypeptides containing multiple disulfide bonds or cysteine residues according to the present invention.
[0123] Example 1: Method for preparing multivalent glycopeptides from polypeptides containing two pairs of disulfide bonds.
[0124]
[0125] Following the above route, a polypeptide containing two disulfide bonds (with cysteine residues at positions 2 and 4 forming a disulfide bond, and cysteine residues at positions 8 and 10 forming a disulfide bond) was glycosylated to synthesize a tetravalent glycopeptide compound. Specifically, 0.12 mmol of sodium glycosyl sulfinate, 0.01 mmol of the solid-phase synthesized polypeptide containing two disulfide bonds, 0.12 mmol of peroxide tert-butanol, and 1 mL of pure water were weighed and mixed into a screw-cap vial. The vial was filled with N2 and sealed with a Teflon-lined cap. The reaction was allowed to stand at room temperature for 1 hour until completion.
[0126] The aforementioned polypeptide containing two pairs of disulfide bonds was commissioned to a polypeptide synthesis company and prepared using conventional solid-phase synthesis techniques in the field. The structure of the polypeptide is as follows:
[0127]
[0128] After the reaction, the reaction solution was separated and purified by reversed-phase high-performance liquid chromatography (RP-HPLC) using a C18 column and gradient elution with acetonitrile and water (both containing 0.1% trifluoroacetic acid) as the mobile phase (acetonitrile volume percentage gradually increased from 5% to 95%). The target product peak was collected and freeze-dried to obtain a multivalent glycopeptide. The structure of the product was further confirmed by nuclear magnetic resonance (NMR), which determined the linkage mode between the glycosyl group and the peptide and the glycosylation site. 11 mg of product was obtained, with a yield of 61% and a purity of 98%. Mass spectrometry (MS) analysis of the product showed that the molecular weight of the product was consistent with the theoretically calculated molecular weight of the multivalent glycosylated peptide.
[0129] The multivalent glycopeptide prepared in Example 1 was prepared by linking glucose (Glu) to the cysteine residue in the polypeptide.
[0130] The NMR data of the multivalent glycopeptide prepared in Example 1 are as follows:
[0131] 1 H NMR (800 MHz, D2O): δ 7.37 (t, J = 7.4 Hz, 2H), 7.32 (t, J = 7.3 Hz, 1H), 7.27 (d, J = 7.4 Hz, 2H), 5.51 (d, J = 5.3 Hz, 1H), 5.50 (d, J = 5.0 Hz, 1H), 5.48 (d, J = 5.6 Hz, 1H), 5.47 (d, J = 5.5 Hz, 1H), 4.72 (dd, J = 12.6, 4.9 Hz, 1H), 4.65 (dd, J = 8.4, 6.6 Hz, 1H), 4.63 (dd, J = 12.4, 6.1 Hz, 1H), 4.56 (dd, J =9.1, 5.0 Hz, 1H), 4.61 (dd, J = 8.1, 5.5 Hz, 1H), 4.56 (dd, J = 9.1, 5.0 Hz, 1H), 4.35 (dd, J = 9.1, 5.3 Hz, 1H), 4.15 (q, J = 7.1 Hz, 1H), 3.98 (s, 2H), 3.97 (td, J = 4.7, 2.4 Hz, 1H), 3.95 (dd, J = 7.4, 2.3 Hz, 1H), 3.95–3.92 (m, 1H), 3.91(ddd, J = 9.5, 4.5, 2.4 Hz, 1H), 3.88 (dd, J = 12.3, 2.5 Hz, 1H), 3.86–3.83 (m,5H), 3.82 (dd, J = 4.7, 1.9 Hz, 2H), 3.81–3.80 (m, 1H), 3.80 (dd, J= 5.1, 2.5Hz, 2H), 3.77 (dd, J = 12.3, 5.3 Hz, 2H), 3.58–3.52 (m, 4H), 3.43 (ddd, J = 18.8,9.3, 9.3 Hz, 4H), 3.19 (dd, J = 13.6, 6.6 Hz, 2H), 3.18–3.13 (m, 2H), 3.12 (t, J = 7.1 Hz, 1H), 3.10–3.06 (m, 4H), 3.04 (dd, J = 14.5, 6.3 Hz, 2H), 3.03–2.98(m, 2H), 2.88 (t, J = 6.0 Hz, 1H), 2.86 (t, J = 5.9 Hz, 1H), 2.81 (ddd, J = 16.9,16.9, 7.4 Hz, 2H), 1.92–1.87 (m, 1H), 1.84–1.76 (m, 1H), 1.71–1.59 (m, 2H),1.56 (d, J = 7.1 Hz, 3H), 1.43–1.38 (m, 1H), and 1.28 (t, J = 7.3 Hz, 1H);
[0132] The mass spectrometry data of the multivalent glycopeptide prepared in Example 1 are as follows:
[0133] [M+2H] 2+ C66H106N14O36S4 2+ : 899.2889, get: 899.2854.
[0134] Example 2: Method for preparing polyvalent acetaminogalactopeptide (glycopeptide 1) from a polypeptide containing four thiol groups.
[0135]
[0136] Following the above route, a polypeptide containing four thiol groups was glycosylated to synthesize a tetravalent glycopeptide compound. Specifically, the polypeptide containing four thiol groups (15 μmol) was first reacted with isothiazol[4,5-] b ]Pyridine-3(2 HThe 74 μmol ketone was mixed with a mixed solvent (water:acetonitrile = 1:1, volume ratio, 1 mL). After standing at room temperature for 10 minutes, sodium acetaminophen sulfinate (21, 222 μmol glycosyl sulfinate) and peroxytert-butanol (222 μmol) were weighed and placed into a screw-cap vial. The vial was filled with N2 and sealed with a Teflon-lined cap. The reaction was then allowed to stand at room temperature for 1 hour to complete.
[0137] The aforementioned polypeptide containing four thiol groups was custom-made by a polypeptide synthesis company and prepared using conventional solid-phase synthesis techniques in the field. The structure of the polypeptide is as follows:
[0138]
[0139] After the reaction, the reaction solution was separated and purified by reversed-phase high-performance liquid chromatography (RP-HPLC) using a C18 column and gradient elution with acetonitrile and water (both containing 0.1% trifluoroacetic acid) as the mobile phase (acetonitrile volume percentage gradually increased from 5% to 95%). The target product peak was collected and freeze-dried to obtain a multivalent glycopeptide. The structure of the product was further confirmed by nuclear magnetic resonance (NMR), which determined the linkage mode between the glycosyl group and the peptide and the glycosylation site. 12 mg of product was obtained, with a yield of 52% and a purity of 96%. Mass spectrometry (MS) analysis of the product showed that the molecular weight of the product was consistent with the theoretically calculated molecular weight of the multivalent glycosylated peptide.
[0140] The multivalent glycopeptide (glycopeptide 1) prepared in Example 2 is a polypeptide in which acetylgalactosamine (GalNAc) is linked to a cysteine residue.
[0141] The NMR data of the multivalent glycopeptide (glycopeptide 1) prepared in Example 2 are as follows:
[0142] 1H NMR (800 MHz, D2O): δ 5.62 (d, J = 5.5 Hz, 1H), 5.59 (m, 3H), 4.72 (dd, J = 7.4, 5.0 Hz, 1H), 4.68 (dd, J = 8.0, 5.2 Hz, 1H), 4.64 (dd, J = 7.7,5.4 Hz, 1H), 4.57 (dd, J = 9.5, 4.5 Hz, 1H), 4.43 (dd, J = 6.5, 4.9 Hz, 1H), 4.38 (td, J = 12.7, 11.6, 5.5 Hz, 4H), 4.31 – 4.26 (m, 4H), 4.15 (d, J = 17.0Hz, 1H), 4.07 – 4.03 (m, 3H), 4.03 – 4.00 (m, 6H), 3.97 (dd, J = 16.9, 6.6Hz, 2H), 3.86 – 3.83 (m, 5H), 3.82 (d, J = 4.2 Hz, 2H), 3.80 (dd, J = 7.3, 2.8 Hz, 5H), 3.49 (dt, J = 12.1, 5.9 Hz, 1H), 3.40 (ddd, J = 12.9, 8.4, 5.6Hz, 1H), 3.31 (dd, J = 15.2, 6.7 Hz, 1H), 3.24 (dd, J = 15.2, 4.8 Hz, 1H), 3.14 (dd, J = 15.2, 7.7 Hz, 2H), 3.12 – 3.07 (m, 4H), 2.22 – 2.18 (m, 1H), and 2.07 – 2.04 (m, 12H).
[0143] The mass spectrometry data of the multivalent glycopeptide (glycopeptide 1) prepared in Example 2 are as follows:
[0144] [M+2H] 2+ C56H94N16O30S4 2+ : 799.2597, got: 799.2607.
[0145] Example 3: Preparation of other polyvalent acetaminogalactopeptides
[0146] Following the method described in Example 2, glycopeptide 1, glycopeptide 2, glycopeptide 3, and glycopeptide 4 were obtained by using sodium acetaminophen galactosyl sulfinate (glycosyl sulfinate 21) and different polypeptides (custom-made by a polypeptide synthesis company), with Alnylam commercial polysaccharide used as a positive control. Their structures are shown below.
[0147] Structure of glycopeptide 1:
[0148]
[0149] Characterization data for glycopeptide 1 are shown in Example 2.
[0150] Structure of glycopeptide 2:
[0151]
[0152] The NMR data of the glycopeptide 2 prepared in Example 3 are as follows:
[0153] 1 H NMR (800 MHz, D2O): δ 8.68–8.63 (m, 4H), 7.33 (m, 4H), 5.61 (d, J =5.6 Hz, 1H), 5.59 (dd, J = 5.4 Hz, 2H), 5.56 (d, J = 5.6 Hz, 1H), 4.57 (dd, J =8.0, 5.1 Hz, 3H), 4.53 (dd, J = 9.3, 4.7 Hz, 1H), 4.36 (td, J = 9.8, 8.5, 4.3 Hz,4H), 4.34 – 4.32 (m, 1H), 4.25 (dd, J = 8.5, 3.9 Hz, 1H), 4.14 (dt, J = 10.8, 6.2Hz, 3H), 3.99 (dd, J = 13.2, 3.4 Hz, 4H), 3.78 (ddt, J = 19.2, 8.6, 6.3 Hz, 13H),3.47 (dt, J = 12.1, 5.9 Hz, 1H), 3.38 (ddd, J = 13.4, 8.5, 5.6 Hz, 1H), 3.28(ddd, J= 13.3, 8.5, 5.0 Hz, 5H), 3.24 – 3.14 (m, 6H), 3.14 – 2.98 (m, 6H), 2.20 – 2.14 (m, 1H), 2.09 – 2.01 (m, 18H), 1.97 (ddt, J = 14.9, 10.2, 5.7 Hz, 1H).
[0154] The mass spectrometry data of the glycopeptide 2 prepared in Example 3 are as follows:
[0155] [M+2H] 2+ C72H110N24O30S4 2+ : 953.3346, get: 953.3332.
[0156] Structure of glycopeptide 3:
[0157]
[0158] The NMR data of the glycopeptide 3 prepared in Example 3 are as follows:
[0159] 1 H NMR (800 MHz, D2O): δ 5.67 (d, J = 5.3 Hz, 1H), 5.65 (d, J = 5.3 Hz, 1H), 5.64 (d, J = 5.3 Hz, 1H), 5.61 (d, J = 5.3 Hz, 1H), 4.61–4.52 (m, 2H), 4.46–4.38 (m, 5H), 4.38–4.32 (m, 4H), 4.31–4.27 (m, 1H), 4.27–4.20 (m, 3H), 4.09–4.00 (m, 4H), 3.88–3.61 (m, 12H), 3.56–3.46 (m, 1H), 3.41 (dd, J= 11.9, 5.4Hz, 1H), 3.30–3.16 (m, 2H), 3.13–3.06 (m, 6H), 3.06–3.00 (m, 9H), 2.28–2.11(m, 1H), 2.11–2.03 (m, 12H), 2.03–1.94 (m, 1H), 1.91–1.82 (m, 3H), 1.82–1.75 (m, 4H), 1.75–1.66 (m, 9H), and 1.58–1.30 (m, 9H).
[0160] The mass spectrometry data of the glycopeptide 3 prepared in Example 3 are as follows:
[0161] [M+2H] 2+ C72H130N20O30S4 2+ : 941.4067, got: 941.4059.
[0162] Structure of glycopeptide 4:
[0163]
[0164] The NMR data of the glycopeptide 4 prepared in Example 3 are as follows:
[0165] 1 H NMR (800 MHz, DMSO): δ 5.46 (d, J = 5.4 Hz, 1H), 5.43 (d, J = 5.3 Hz, 1H), 5.41 (d, J = 5.4 Hz, 1H), 4.44 (t, J = 5.9 Hz, 1H), 4.42 – 4.38 (m, 1H), 4.26 (q, J = 6.9, 6.5 Hz, 2H), 4.18 (ddt, J = 21.0, 14.6, 7.6 Hz, 9H), 4.14 –4.11 (m, 2H), 4.08 (t, J = 5.4 Hz, 2H), 3.99 – 3.94 (m, 5H), 3.91 (d, J = 5.8 Hz, 4H), 3.52 (ddd, J = 33.8, 10.9, 6.2 Hz, 8H), 3.47 – 3.43 (m, 2H), 3.27 (t, J=6.8 Hz, 3H), 3.08 (d, J = 17.7 Hz, 5H), 3.05 (d, J = 7.0 Hz, 3H), 2.90 (s, 2H), 2.86 (d, J = 9.5 Hz, 2H), 2.54 (s, 2H), 2.30 (ddt, J = 33.7, 16.1, 7.4 Hz, 6H),2.22 (dt, J = 16.0, 7.8 Hz, 4H), 2.01 (dq, J = 18.5, 10.9, 9.5 Hz, 3H), 1.93 (tt, J = 18.7, 8.8 Hz, 6H), 1.82 (d, J = 6.7 Hz, 12H), 1.80 (d, J = 8.2 Hz, 6H), 1.79 –1.75 (m, 3H), 1.72 (dd, J = 10.4, 4.9 Hz, 3H), 1.70 (s, 2H), 1.67 (dt, J = 15.9, 7.8 Hz, 5H), 1.63 (d, J = 6.3 Hz, 3H), 1.62 – 1.52 (m, 24H), 1.49 (ddd, J = 23.1,10.8, 5.8 Hz, 9H), 1.39 – 1.33 (m, 3H), 1.20 (d, J = 6.6 Hz, 4H), 0.86 – 0.82(m, 12H), 0.82 – 0.76 (m, 12H).
[0166] The mass spectrometry data of the glycopeptide 4 prepared in Example 3 are as follows:
[0167] [M+2H] 2+ C126H216N37O50S3 3+ : 1047.8214, got: 1047.8155.
[0168] The structure of commercial polysaccharide 1 (positive control) is as follows:
[0169]
[0170] The NMR data for commercial polysaccharide 1 are as follows:
[0171] 1H NMR (400 MHz, MeOD) δ 4.38 (d, J = 8.4 Hz, 3H), 3.97 – 3.87 (m, 9H), 3.77 (dd, J = 6.0, 1.9 Hz, 6H), 3.67 (t, J = 6.2 Hz, 12H), 3.61 (dd, J = 10.7, 3.3Hz, 3H), 3.55 – 3.49 (m, 6H), 3.22 (q, J = 6.7 Hz, 12H), 2.44 (t, J = 6.0 Hz, 6H), 2.21 (q, J = 8.0 Hz, 8H), 2.00 (s, 9H), 1.69 (dt, J = 13.8, 6.9 Hz, 12H), 1.63 – 1.55 (m, 10H), 1.44 – 1.28 (m, 4H).
[0172] The mass spectrometry data of commercial polysaccharide 1 are as follows:
[0173] [M+Na] + C67H119 NaN13O28 + : 1576.8180, got: 1576.8209.
[0174] Previous studies of this invention have shown that multivalent glycopeptides prepared using acetylgalactosamine have better liver targeting and better endosomal escape efficiency compared to multivalent glycopeptides prepared using other sugars.
[0175] Example 4: Preparation of polyacetylgalactopeptide-linked fluorescein and its corresponding cell and mouse fluorescence imaging experiments.
[0176] Synthetic route of polyacetylgalactopeptide-linked fluorescein:
[0177]
[0178] Following the above route, polyvalent acetaminogalactopeptide was fluorescently modified to synthesize a polyvalent glycopeptide-linked fluorescent compound. Specifically, the polyvalent acetaminogalactopeptide (glycopeptide 1 from Example 3, 0.01 mmol, 14 mg), alkynyl fluorescein (0.01 mmol, 7.9 mg), and solvent (water, 1 mL) were mixed and allowed to stand at room temperature for 30 minutes to complete the reaction.
[0179] After the reaction, the reaction solution was separated and purified by reversed-phase high-performance liquid chromatography (RP-HPLC) using a C18 column and gradient elution with acetonitrile and water (both containing 0.1% trifluoroacetic acid) as the mobile phase (acetonitrile volume percentage gradually increased from 5% to 95%). The target product peak was collected and freeze-dried to obtain the multivalent glycopeptide fluorescein product (glycopeptide 1-Cy5). The purity of the product was further confirmed by HPLC, yielding 17 mg of glycopeptide 1-Cy5, with a yield of 78% and a purity of 99%. Mass spectrometry (MS) analysis of the product showed that the molecular weight of the product was consistent with the theoretically calculated molecular weight.
[0180] Its mass spectrometry data are as follows:
[0181] [M+2H] 2+ C106H147N20O38S6 2+ : 1249.9226, Result: 1249.9214;
[0182] The high-performance liquid chromatography (HPLC) of the prepared glycopeptide 1-Cy5 product is as follows: Figure 2 As shown.
[0183] The aforementioned glycopeptide 1 was replaced with glycopeptide 2, glycopeptide 3, glycopeptide 4, and commercial polysaccharide 1. A series of glycopeptide-Cy5 products (glycopeptide 1-Cy5, glycopeptide 2-Cy5, glycopeptide 3-Cy5, glycopeptide 4-Cy5) and commercial polysaccharide 1-Cy5 were obtained using the same method. These glycopeptide-Cy5 products and commercial polysaccharide 1-Cy5 were then subjected to endocytosis experiments. A DBCO-Cy5 control group (commercially available product, manufactured by Xi'an Qiyue Biotechnology, catalog number Q-0062789) and a blank control group (Control) were also set up. Specific procedures were as follows: HepG2 liver cancer cells (highly expressing ASGPR receptor) were used as a positive control, and SNU449 liver cancer cells (lowly expressing ASGPR receptor) were used as a negative control. Cells were incubated at 37°C for 2 hours with 10 nM concentrations of multivalent glycopeptides-luciferins (glycopeptide 1-Cy5, glycopeptide 2-Cy5, glycopeptide 3-Cy5, glycopeptide 4-Cy5, commercial polysaccharide 1-Cy5, or DBCO-Cy5), respectively. Cy5 fluorescence intensity was then analyzed by flow cytometry. The endocytosis fluorescence efficiency results for HepG2 and SNU449 cell lines are shown below. Figure 3As shown, at a concentration of 10 nM, the fluorescence intensity of all designed glycopeptides was higher than that of the commercial polysaccharide 1-Cy5 (baseline intensity: 5266). Specifically, glycopeptide 3-Cy5 reached an intensity of 75813 (14.4 times higher, p<0.0001), and glycopeptide 4-Cy5 reached 45584 (8.7 times higher, p<0.0001). Parallel experiments using SNU449 hepatocellular carcinoma cells (ASGPR negative) showed that, compared to DBCO-Cy5, the intracellular fluorescence intensity of all glycopeptide-luciferin conjugates at a concentration of 10 nM was significantly lower, comparable to the blank control. These results indicate that the multivalent glycopeptides prepared in this invention have the advantage of extremely strong liver-targeting ability, 15 times that of the corresponding commercial polysaccharide from Alnylam.
[0184] The aforementioned glycopeptide 1 was replaced with glycopeptide 2, glycopeptide 3, glycopeptide 4, and commercial polysaccharide 1. A series of glycopeptide-Cy5 products (glycopeptide 1-Cy5, glycopeptide 2-Cy5, glycopeptide 3-Cy5, glycopeptide 4-Cy5) and commercial polysaccharide 1-Cy5 were obtained using the same method. Intracellular escape efficiency experiments were conducted on this series of glycopeptide-Cy5 products and commercial polysaccharide 1-Cy5. At the same time, a DBCO-Cy5 (commercially available product, manufactured by Xi'an Qiyue Biotechnology, catalog number Q-0062789) control group and a blank control group (Control) were set up. The specific procedures were as follows: HepG2 liver cancer cells (highly expressing ASGPR receptors) were incubated at 37°C for 16 hours with 1 mM concentrations of multivalent glycopeptides-luciferin (glycopeptide 1-Cy5, glycopeptide 2-Cy5, glycopeptide 3-Cy5, glycopeptide 4-Cy5, commercial polysaccharide 1-Cy5, or DBCO-Cy5). After washing, the cell nuclei and lysosomes were stained, and the fluorescence intensity was analyzed using a laser confocal microscope. The endosome escape efficiency was calculated using the Pearson equation, and the endosome escape efficiency of HepG2 cells was as follows: Figure 4 As shown. Figure 4 The results show that the endosome escape efficiency of all designed glycopeptides is higher than that of the commercial polysaccharide-Cy5. Among them, glycopeptide 3-Cy5 has the strongest endosome escape efficiency. The above results indicate that the multivalent glycopeptides prepared in this invention have the advantage of extremely high endosome escape efficiency, which is twice that of the corresponding commercial polysaccharide from Alnylam.
[0185] The aforementioned glycopeptide 1 was replaced with glycopeptide 2, glycopeptide 3, glycopeptide 4, and commercial polysaccharide 1. A series of glycopeptide-Cy5 products (glycopeptide 1-Cy5, glycopeptide 2-Cy5, glycopeptide 3-Cy5, glycopeptide 4-Cy5) and commercial polysaccharide 1-Cy5 were obtained using the same method. These glycopeptide-Cy5 products and commercial polysaccharide 1-Cy5 were then subjected to mouse fluorescence imaging experiments. A DBCO-Cy5 control group (commercially available product, manufactured by Xi'an Qiyue Biotechnology, catalog number Q-0062789) and a blank control group (Control) were also set up. The specific procedures were as follows: the glycopeptide-Cy5 products, commercial polysaccharide 1-Cy5, and DBCO-Cy5 were administered subcutaneously (200 μg / kg, 50 μL) to female BALB / c mice. Two hours after injection, mice were sacrificed, dissected, and major organs (heart, liver, spleen, lung, and kidney) were collected. In vitro fluorescence imaging was performed using an IVIS system, and fluorescence intensity was quantitatively analyzed. Results are as follows: Figure 5 As shown in the figure. Quantitative analysis revealed that the liver fluorescence intensity of glycopeptides 2-Cy5 and 3-Cy5 was significantly higher than that of the commercial polysaccharide 1-Cy5 (p<0.0001). These results indicate that the multivalent glycopeptides prepared in this invention have the advantage of extremely strong liver targeting, and in the mouse assay, they are twice as potent as the corresponding commercial polysaccharide from Alnylam.
[0186] Example 5: Preparation of polyvalent acetylgalactosyl peptide linked to siRNA from a polypeptide containing four thiol groups and its corresponding cell experiments.
[0187]
[0188] Following the above route, a compound containing a polyvalent glycopeptide and siRNA was synthesized by conjugating the polyvalent acetaminogalactopeptide with siRNA. Specifically, the following steps were performed: 2 mg of polyvalent acetaminogalactopeptide 1, 2 mg of the positive strand of the alkyne siRNA, and 1 mL of water were mixed and allowed to stand at room temperature for 30 minutes, at which point the first step of the reaction was complete. The positive strand sequence (5'->3') is shown in SEQ ID NO.1.
[0189] fA mA fCmAfGmUfGmUfUmCfUmUfGmCfUmCfUmAfUmAfA
[0190] Where f represents 2'-deoxy-2'-fluorine modification, represents a thiophosphate bond, and m represents 2'-O-methyl sugar modification.
[0191] After the reaction, the reaction solution was separated and purified by reversed-phase high-performance liquid chromatography (RP-HPLC) using a C4 column and gradient elution with acetonitrile and water (both containing 0.1% trifluoroacetic acid) as the mobile phase (acetonitrile volume percentage gradually increased from 5% to 95%). The target product peak was collected and freeze-dried to obtain the positive-strand polyglycopeptide-siRNA product (2 mg). The mass spectrum of the positive-strand polyglycopeptide-siRNA product is shown below. Figure 6 As shown.
[0192] The multivalent glycopeptide-siRNA sense strand product (1.5 mg) was mixed with an equivalent amount of siRNA antisense strand (1.5 mg) and solvent (water, 1 mL). The mixture was heated to 95°C and then allowed to return to room temperature to complete the reaction. The siRNA antisense strand (5'->3') is shown in SEQ ID NO. 2.
[0193] mU fU mAfUmAfGmAfGmCfAmAfGmAfAmCfAmCfUmGfUmU fU mU
[0194] Where f represents 2'-deoxy-2'-fluorine modification, represents a thiophosphate bond, and m represents 2'-O-methyl sugar modification.
[0195] After the reaction, the product was freeze-dried to obtain a multivalent glycopeptide siRNA. The purity of the product was further confirmed by high-performance liquid chromatography (HPLC), yielding 2 mg of glycopeptide 1-siRNA with a yield of 55% and a purity of 99%. Mass spectrometry (MS) analysis showed that the molecular weight of the product was consistent with the theoretically calculated molecular weight. Figure 7 This is the mass spectrum of the multivalent glycopeptide 1-siRNA product.
[0196] Glycopeptide 1 was replaced with glycopeptide 2, glycopeptide 3, glycopeptide 4, commercial polysaccharide (commercial polysaccharide 1 as described in Example 3, and commercial polysaccharide 2 using commercially available GAlNAc-L9 from Alnylam) or DBCO. A series of siRNA products were obtained using the same method described above, and these siRNA products were used for a cytostolic hormone (TSH) gene silencing experiment. The specific procedure was as follows: Commercially available mouse primary hepatocytes (Shanghai Kuisai Biotechnology) were used for a cytostolic gene silencing verification experiment. Cells were incubated with 10 nM siRNA products at 37°C for 24 hours. The cells were then lysed, centrifuged, and RNA was extracted from the mouse primary hepatocytes. RNA was then reverse transcribed into cDNA, and real-time quantitative PCR was performed using the cDNA. The upstream primer sequence was CCTTTGCCTCTGGGAAGACCG (SEQ ID NO. 3), and the downstream primer sequence was TCCAGTACGATTTGGTGTCCAG (SEQ ID NO. 4). The gene silencing effect of each glycopeptide was detected. The results of gene silencing in primary hepatocytes are shown below. Figure 8 As shown in the figure. The results indicate that the IC50 value of commercially available polysaccharide-siRNA is around 70 pM. The IC50 values of polyvalent glycopeptide 3-siRNA and polyvalent glycopeptide 4-siRNA are both below 10 pM. This demonstrates that the gene silencing efficiency of the glycopeptides of this invention is superior to that of commercially available polysaccharides.
[0197] In summary, this invention provides a multivalent glycopeptide with excellent liver-targeting activity, capable of directly targeting the hepatic ASGPR receptor. This multivalent glycopeptide can be linked with fluorescein, radionuclides, oncology drugs, small nucleic acids, etc., to obtain a series of liver-targeting drugs. The multivalent glycopeptide of this invention has broad application prospects.
Claims
1. A multivalent glycopeptide, characterized in that: The structure of the multivalent glycopeptide is selected from one of the following structures: 。 2. A method for preparing the multivalent glycopeptide according to claim 1, characterized in that: Includes the following steps: In a solvent, glycosyl sulfinates, polypeptides containing multiple cysteine residues, isothiazolinone compounds, and oxidants react to yield multivalent glycopeptides. The polypeptide containing multiple cysteine residues is a polypeptide containing multiple thiol groups or multiple disulfide bonds, and the polypeptide is the polypeptide in the polyvalent glycopeptide structure of claim 1. The structure of the glycosyl sulfinate is selected from... .
3. The preparation method according to claim 2, characterized in that: The oxidant is selected from one or more of hydrogen peroxide, tert-butanol peroxide, potassium persulfate, oxygen, and tert-butyl peroxide; And / or, the solvent is an aqueous solution; And / or, the reaction is carried out at room temperature; And / or, the reaction is carried out in an inert gas atmosphere.
4. The preparation method according to claim 2 or 3, characterized in that: The preparation method includes the following steps: first, a polypeptide containing multiple thiol groups and isothiazolinone compound A are used as raw materials to carry out a first-step reaction in a solvent; then, glycosyl sulfinate and an oxidant are added to carry out a second-step reaction to obtain a glycosylated modified peptide; the structure of compound A is as follows: Rz is selected from hydrogen or C. 1-8 alkyl.
5. The preparation method according to claim 4, characterized in that: The molar ratio of cysteine, isothiazolinone compound A, glycosyl sulfinate, and oxidant in the polypeptide containing multiple thiol groups is 1:(1-10):(3-20):(3-20). And / or, the ratio of the polypeptide containing multiple thiol groups to the solvent is (0.01-0.5) mmol: 1 mL; And / or, the reaction time of the first step is 5-20 minutes; the reaction time of the second step is 0.5-1.5 hours.
6. Use of the multivalent glycopeptide according to claim 1 in the preparation of liver-targeting drugs.
7. The use according to claim 6, characterized in that: The liver-targeting drug is the drug obtained by linking the multivalent glycopeptide of claim 1 with fluorescein, radionuclide, tumor drug, or small nucleic acid.