Influenza A virus Vero cell cold adapted strain Vca-CPD and application thereof

Abstract

The invention discloses an influenza A virus Vero cell cold adapted strain Vca-CPD and application thereof, and relates to the field of biotechnology and vaccinology. The preservation number of the Vca-CPD provided by the invention is CCTCC (China Center For Type Culture Collection) NO: V202585. The strain is mainly obtained by performing codon pair optimization on PB2, PA and NP genes. In-vivo and in-vitro experiments prove that the replication ability of the strain in human cells and mammal models is obviously weakened, and the safety is improved; meanwhile, an organism can be induced to generate high-level and specific serum protective antibodies and respiratory mucosa sIgA antibodies. In addition, the virus yield of the strain in production of stromal cells is equivalent to that of a parent strain, and the strain shows good production applicability.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology and vaccinology, and more particularly to a cold-adapted Vero cell strain of influenza A virus Vca-CPD and its application. BACKGROUND

[0002] Influenza, also known as flu, is an acute respiratory infectious disease caused by influenza virus, which has a wide range of transmission and strong pathogenicity. Vaccination is the most effective means of preventing influenza. Currently, the influenza vaccines used in clinical practice mainly include inactivated vaccines and attenuated live vaccines. Among them, attenuated live vaccines (LAIV) can induce broad systemic and mucosal immunity by nasal inoculation, which simulates natural infection, and have the advantages of convenient inoculation, high efficiency of immunity, and long-lasting protection.

[0003] Traditional attenuated live vaccine strains mainly rely on cold adaptation (Ca) technology, that is, by continuously passing the virus under low temperature conditions to screen for strains with attenuated phenotypes. However, this method has obvious limitations: first, the attenuation process is long, and the attenuated mutations obtained are random, and their phenotypes are often maintained by individual amino acid mutations, resulting in insufficient genetic stability and a high risk of virulence recovery. For example, the attenuated phenotype of A / Ann Arbor / 6 / 60 ca strain is highly dependent on the PB2-N265S single site, and the recovery mutation of this site can directly lead to virulence recovery. Second, due to the difficulty in accurately controlling the degree of attenuation, some cold-adapted strains still retain strong replication capacity in the human body, causing adverse reactions such as high fever, so their inoculation population is usually limited to healthy individuals aged 2-49 years, and cannot cover infants, the elderly population, and high-risk populations with asthma, immune suppression, and other underlying diseases.

[0004] Therefore, there is an urgent need in the art to develop a new attenuated influenza virus vaccine strain. The strain should have a clear and stable attenuated genetic basis, achieve sufficient attenuation to ensure high safety while still being able to stimulate effective immune protection; and as a vaccine seed strain, the virus yield in the production matrix needs to meet the requirements of industrialized expansion. SUMMARY

[0005] Therefore, the present application provides a cold-adapted Vero cell strain of influenza A virus Vca-CPD and its application.

[0006] To solve the above technical problems, the present application adopts the following technical solutions:

[0007] A cold-adapted Vero cell strain of influenza A virus, Vca-CPD, with accession number CCTCCNO:V202585, was deposited on November 20, 2025, at the China Center for Type Culture Collection, Wuhan University, Wuhan, China, and is classified and named as Influenza A virus Vca-CPD.

[0008] Preferably, the Vca-CPD is a recombinant virus, obtained by rescuing recombinant plasmids pHW2000-PB2-CPD, pHW2000-PA-CPD, pHW2000-NP-CPD, pHW2000-PB1, pHW2000-M, pHW2000-NS, pHW2000-HA, and pHW2000-NA using an 8-plasmid reverse genetics system; The nucleotide sequence of PB2-CPD in pHW2000-PB2-CPD is shown in SEQ ID NO.1, the nucleotide sequence of PA-CPD in pHW2000-PA-CPD is shown in SEQ ID NO.2, and the nucleotide sequence of NP-CPD in pHW2000-NP-CPD is shown in SEQ ID NO.3.

[0009] Another object of the present invention is to provide the application of the above-mentioned Vca-CPD strain of influenza A virus Vero cell cold-adapted in the preparation of a vaccine for the prevention of influenza A virus.

[0010] Preferably, the vaccine is a live attenuated vaccine.

[0011] Another object of the present invention is to provide the application of the above-mentioned cold-adapted Vca-CPD strain of influenza A virus in Vero cells as a primary vaccine donor virus.

[0012] Another object of the present invention is to provide a method for constructing the above-mentioned cold-adapted strain of influenza A virus on Vero cells, Vca-CPD, comprising the following steps: S1: Based on the parental strain A / Yunnan / 1 / 2005Vca (H3N2), the PB2, PA, and NP genes were de-optimized according to the codon pair bias of the human genome to obtain PB2-CPD, PA-CPD, and NP-CPD. S2: The whole genomes of PB2-CPD, PA-CPD and NP-CPD were synthesized and cloned into the pHW2000 vector to obtain recombinant plasmids pHW2000-PB2-CPD, pHW2000-PA-CPD and pHW2000-NP-CPD. S3: Based on the parent strain A / Yunnan / 1 / 2005Vca (H3N2), the PB1 gene, M gene and NS gene were amplified and cloned into the pHW2000 vector to obtain recombinant plasmids pHW2000-PB1, pHW2000-M and pHW2000-NS; S4: Based on the vaccine strain A / Darwin / 9 / 2021 (H3N2), the HA gene and NA gene were obtained using the method of step S3 to obtain recombinant plasmids pHW2000-HA and pHW2000-NA; S5: The recombinant plasmids pHW2000-PB2-CPD, pHW2000-PA-CPD and pHW2000-NP-CPD obtained in step S2, the recombinant plasmids pHW2000-PB1, pHW2000-M and pHW2000-NS obtained in step S3, and the recombinant plasmids pHW2000-HA and pHW2000-NA obtained in step S4 were co-transfected into Vero cells, and the cell supernatant was collected to obtain the influenza A vaccine.

[0013] Another object of the present application is to provide an influenza A vaccine, comprising the influenza A virus Vero cell cold-adapted strain Vca-CPD described above.

[0014] Preferably, the vaccine further comprises an adjuvant.

[0015] Another object of the present application is to provide a kit, comprising the influenza A vaccine described above.

[0016] Preferably, the kit further comprises a tool for vaccination.

[0017] Through the technical solution described above, compared with the prior art, the present application has the following beneficial effects: Based on the reported influenza virus Vero cell cold-adapted strain, the present application further adopts codon pair de-optimization technology to realize rationalization and precision attenuation based on double mechanisms. This strategy introduces a large number of synonymous mutations, significantly improves the genetic stability of the virus strain without changing the amino acid sequence, and fundamentally reduces the risk of virulence recovery. The new strain obtained in the present application shows significantly reduced replication capacity in in vivo and in vitro experiments, has high safety, can induce strong immune response in the body, and maintains high virus yield in the vaccine production substrate. The strain can be used as a stable vaccine master donor virus, and can be quickly recombined with epidemic strains to construct a safe and efficient influenza attenuated live vaccine, providing a new technical path and solution for influenza prevention and control. BRIEF DESCRIPTION OF DRAWINGS

[0018] In order to make the technical solutions in the embodiments of the present application or the prior art clearer, the accompanying drawings needed in the embodiments or the prior art description will be briefly introduced. Obviously, the accompanying drawings in the following description only aim to explain part of the embodiments of the present application, and all other embodiments obtained by a person of ordinary skill in the art without creative effort based on the provided accompanying drawings also belong to the protection scope of the present application.

[0019] Figure 1 Structure diagram of de-optimized genes PB2-CPD, PA-CPD and NP-CPD; Figure 2 Hemagglutination titer diagram of recombinant virus Vca-CPD; Figure 3 Virus load in the nasal concha and lung tissue of mice infected by Vca-CPD and Vca-WT viruses; Figure 4 Replication growth curves of viruses Vca-CPD and Vca-WT in KMB17 and MDCK cells; Figure 5 Virus yield changes of viruses Vca-CPD and Vca-WT in Vero and MDCK cells; Figure 6 Hemagglutination inhibition antibody and neutralizing antibody levels of mice immunized by viruses Vca-CPD and Vca-WT; Figure 7 Mucosal sIgA antibody levels of mice immunized by viruses Vca-CPD and Vca-WT; DETAILED DESCRIPTION The technical solutions in the embodiments of the present application will be described clearly and completely below with reference to the accompanying drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by a person of ordinary skill in the art without creative effort belong to the protection scope of the present application.

[0020] The experimental methods in the following embodiments are all conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents and the like used in the following embodiments can be obtained from commercial channels, unless otherwise specified.

[0021] Example 1 Construction and rescue of recombinant virus Vca-CPD The present embodiment relates to a recombinant virus Vca-CPD, which is obtained by Codon Pair Deoptimization (CPD) technology and reverse genetics system rescue. The CPD effectively reduces the replication ability of the virus in the human body by increasing the proportion of low-frequency codon pairs in the viral genome without changing the amino acid sequence and RNA spatial structure of the virus, thereby achieving the attenuation effect.

[0022] The specific steps are as follows: 1. Gene deoptimization design of recombinant virus Vca-CPD Taking influenza virus strain A / Yunnan / 1 / 2005 Vca (H3N2) as a model, the codon pair deoptimization design is performed on part of the polymerase protein gene PB2, PA and nucleoprotein gene NP.

[0023] By accurately setting the codon pair deoptimization region in the middle segment of the gene, the packaging signal region at both ends of the open reading frame (ORF) is completely retained, thereby ensuring that the deoptimized gene can be correctly packaged into the viral genome (see Table 1 and Figure 1 ).

[0024] Table 1. Distribution of mutation regions of PB2, PA and NP genes

[0025] Based on the codon pair bias preference data of the human genome (GRCh38.P14 version), the following steps are completed according to the codon pair deoptimization algorithm reported by Coleman et al. (Virus attenuation by genome-scale changes in codon pair bias. Science. 2008 Jun 27;320(5884):1784-7. doi: 10.1126 / science.1155761): ① Calculate the codon pair bias score of the wild-type genes PB2, PA and NP; ② As the goal of reducing the codon pair bias score, a series of candidate sequences with different degrees of reduction in codon pair bias preference are generated, which are consistent with the wild-type amino acid sequence; ③ From the candidate sequences, the sequence with the lowest codon pair bias score is selected as the final deoptimized gene PB2-CPD, PA-CPD and NP-CPD (sequences are shown in SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3, wherein the underlined part represents the CPD region).

[0026] The PB2-CPD gene sequence of the recombinant virus Vca-CPD is as follows: GGGAGCAAAAGCAGGTCAATTATATTCAATATGGAAAGAATAAAAGAACTAAGAAATCTAATGTCGCAGTCTCGCACCCGCGAGATACTCACAAAAACCACCGTGGACCATATGGCCATAATCAAGAAGTACACATCAGGAAGACAGGAGAAGAACCCAGCACTTAGGATGAAATGGATGATGGCAATGAAATATCCAATTACAGCAGACAAGAGGATAACGGAAATGATTCCTGAGAGAAATGAGCAAGGACAAACTTTATGGAGTAAAATGAATGATGCCGGATCAGACCGAGTGATGGTATCACCTCTGGCTGTGACATGGTGGAATAGGAATGGACCAATAACAAATACAGTTCATTATCCAAAAATCTACAAAACTTATTTTGAAAGAGTCGAAAGGCTAAAGCATGGAACCTTTGGCCCTGTCCATTTTAGAAACCAAGTCAAAATACGTCGGAGAGTTGACATAAATCCTGGTCATGCA GATCTGTCAGCGAAGGAAGCGCAAGATGTGATAATGGA GGTGGTATTCCCTAACGAGGTAGGCGCACGCATTCTAACTAGCGAATCGCAACTAACCATTACGAAAGAGAAAAAA GAGGAACTGCAAGATTGCAAAATCAGTCCGCTTATGGTCGCTTATATGTTAGAGCGCGAGCTCGTTCGTAAGACTA GATTCTTGCCCGTAGCCGGCGGTACGTCTAGCGTGTATATTGAGGTGCTTCACTTAACCCAGGGAACTTGTTGGGA ACAGATGTATACACCCGGGGGGGAGGTACGAAATGACGACGTAGACCAATCTTTGATCATTGCAGCTAGGAATATC GTACGGCGCGCAGCAGTGTCCGCCGATCCCCTTGCCTCGTTGCTCGAAATGTGCCACTCAACGCAAATTGGCGGGA TTCGGATGGTTGACATCTTACGCCAAAATCCTACGGAGGAACAGGCCGTCGACATATGTAAAGCCGCAATGGGTCT TAGAATTAGCTCTAGTTTCTCATTCGGAGGGTTCACATTCAAACGGACGAGCGGTAGTAGCGTGAAACGTGAGGAA GAAGTGCTTACGGGTAACCTTCAGACACTGAAGATCAGGGTGCACGAAGGATACGAGGAATTTACGATGGTCGGTC GCAGGGCAACCGCGATACTCCGCAAGGCGACACGACGTCTAATCCAACTTATCGTATCGGGACGTGATGAACAGTC GATCGCCGAAGCGATAATCGTGGCTATGGTATTCTCTCAGGAGGATTGTATGATTAAGGCCGTACGGGGTGATCTG AATTTCGTAAACCGCGCAAATCAGAGACTCAACCCTATGCATCAATTGCTACGCCACTTTCAAAAGGACGCAAAGG TACTTTTCCAGAATTGGGGGGTTGAGCCGATAGATAATGTTATGGGGATGATAGGGATCTTACCCGATATGACACC TAGCATCGAAATGAGCATGCGAGGCGTTCGTATAAGTAAGATGGGGGTCGACGAGTATTCTTCTACAGAGCGCGTC GTCGTCAGTATAGATCGCTTTCTCCGCATTAGAGACCAACGGGGCAACGTGTTACTATCTCCCGAAGAGGTTTCCG AGACGCAAGGGACAGAAAAGCTTACGATTACGTACTCTTCAAGCATGATGTGGGAAATTAACGGGCCTGAATCCGT ACTGGTTAACACATATCAATGGATCATTCGAAATTGGGAAACTGTCAAAATCCAATGGAGTCAAAATCCGACTATG CTATACAATAAGATGGAATTCGAACCCTTTCAATCACTAGTACCTAAGGCTATTCGCGGACAATACTCAGGTTTTG TGCGAACACTATTCCAGCAAATGAGAGACGTATTGGGAACGTTTGATACGGCGCAAATTATAAAACTTCTTCCCTTCGCAGCCGCTCCACCAAAGCAAAGTAGAATGCAGTTCTCCTCATTTACTGTGAATGTGAGGGGATCAGGAATGAGAATACTTGTAAGGGGCAATTCTCCTGTATTCAACTATAACAAGGCCACGAAGAGACTCACAGTTCTCGGAAAGGATGCTGGCACTTTAACTGAAGACCCAGATGAAGGCACAGCTGGAGTGGAGTCCGCTGTTCTGAGGGGATTCCTCATTCTGGGCAAAGAAGACAAGAGATATGGGCCAGCACTAAGCATCAATGAACTGAGCAACCTTGCGAAAGGAGAGAAGGCTAATGTGCTAATTGGGCAAGGAGACGTGGTGTTGGTAATGAAACGGAAACGGGACTCTAGCATACTTACTGACAGCCAGACAGCGACCAAAAGAATTCGGATGGCCATCAATTAGTGTCGAATAGTTTAAAAACGACCTTGTTTCTACT, SEQ ID NO. 1.

[0027] The PA-CPD gene sequence of the recombinant virus Vca-CPD is as follows: GGGAGCAAAAGCAGGTACTGATCTAAAATGGAAGATTTTGTGCGACAATGCTTCAATCCGATGATTGTCGAGCTTGCGGAAAAAACAATGAAAGAGTATGGGGAGGACCTGAAAATCGAAACAAACAAATTTGCAGCAATATGCACTCACTTGGAAGTATGCTTCATGTATTCAGATTTTCACTTCATCAATGAGCAAGGCGAGTCAATAATCGTAGAACTTGGTGATCCAAATGCACTTTTGAAGCACAGATTTGAAATAATCGAGGGAAGAGATCGCACGATGGCCTGGACAGTAGTAAACAGTATTTGCAACACTACAGGGGCTGAGAAACCAAAGTTTCTACCAGATTTGTATGATTACAAGGAGAATAGATTCATCGAAATTGGAGTAACAAGGAGAGAAGTTCACATATACTATCTGGAAAAG GCGAACAAAATCAAGTCGG AAAAGACGCATATACATATTTTCTCGTTCACCGGGGAAGAGATGGCCACTAAAGCGGATTATACACTCGATGAGGAAAGTCGGGCTAGGATTAAGACACGTCTATTCACAATAAGACAGGAGATGGCTAGCCGGGGGCTATGGGATAGTTTT AGGCAATCTGAACGAGGAGAGGAAACGATCGAGGAACGTTTCGAAATAACCGGGACAATGCGAAAGTTGGCCGATC AATCCTTACCGCCTAACTTTTCATCACTCGAGAACTTTCGGGCTTACGTCGACGGGTTTGAACCGAACGGATACAT AGAGGGTAAACTCTCGCAAATGAGCAAGGAAGTTAATGCTAGGATCGAACCGTTCTTGAAGACGACCCCTAGACCA TTACGGTTGCCGAACGGACCGCCATGCTCGCAAAGATCCAAATTCTTACTTATGGACGCGTTGAAACTTAGCATAG AAGACCCATCGCATGAGGGCGAAGGCATACCCTTATACGATGCAATCAAATGCATGCGGACATTCTTCGGTTGGAA AGAACCGAACGTAGTTAAGCCGCATGAAAAGGGTATCAATCCGAATTACCTACTCAGTTGGAAACAGGTACTCGCC GAGTTGCAAGATTCTGAGAATGAGGAAAAGATTCCAAAAACGAAAAATATGAAAAAGACATCCCAATTGAAATGGG CACTGGGCGAAAATATGGCTCCGGAAAAGGTTGACTTCGACGATTGTAAGGACGTCGGCGACTTAAAACAGTACGA TTCCGATGAACCTGAGTTGAGATCGCTCGCAAGTTGGATCCAAAACGAATTTAACAAGGCTTGCGAATTAACCGAT AGCTCTTGGATCGAACTCGATGAGATAGGTGAGGACGTTGCACCCATAGAGCACATAGCTAGTATGCGTCGTAATT ATTTCACATCCGAAGTCTCGCATTGTCGAGCAACTGAATACATTATGAAGGGAGTATACATAAACACCGCTCTTCT GAACGCATCATGTGCCGCGATGGACGATTTCCAGTTAATACCAATGATCAGTAAGTGTCGGACTAAGGAGGGACGA CGAAAGACTAACTTATACGGCTTTATAATTAAAGGAAGGTCGCACCTTAGGAACGATACCGATGTAGTGAATTTCG TTAGCATGGAATTTAGTTTAACGGATCCGAGGTTGGAACCTCATAAGTGGGAAAAGTATTGCGTGCTCGAAATCGG AGATATGTTAATCCGATCCGCTATAGGTCAGGTATCTCGACCTATGTTCCTGTACGTACGGACTAACGGTACAAGT AAAATTAAGATGAAATGGGGGATGGAAATGAGACGATGCCTTTTGCAATCA CTTCAACAAATTGAGAGTATGATTGAAGCTGAGTCCTCTGTCAAAGAGAAAGACATGACCAAAGAGTTCTTTGAGAACAAATCAGAAACATGGCCCATTGGAGAGTCCCCCAAAGGAGTGGAGGAAAGTTCCATTGGGAAGGTCTGCAGGACTTTATTAGCAAAGTCGGTATTCAACAGCTTGTATGCATCTCCACAACTAGAAGGATTTTCAGCTGAATCAAGAAAACTGCTTCTTATCGTTCAGGCTCTTAGGGACAACCTGGAACCTGGGACCTTTGATCTTGGGGGGCTATATGAAGCAATTGAGGAGTGCCTGATTAATGATCCCTGGGTTTTGCTTAATGCTTCTTGGTTCAACTCCTTCCTTACACATGCATTGAGTTAGTTGTGGCAGTGCTACTATTTGCTATCCATACTGTCCAAAAAAGTACCTTGTTTCTACT, SEQ ID NO.2.

[0028] The NP-CPD gene sequence of recombinant virus Vca-CPD is shown below: GGGAGCAAAAGCAGGGTAGATAATCACTCACTGAGTGACATCAAAGTCATGGCGTCCCAAGGCACCAAACGGTCTTACGAACAAATGGAGACTGATGGGGAACGCCAGAATGCAACTGAAATCAGAGCATCCGTCGGAAAAATGATTGGTGGAATTGGGCGGTTCTACATCCAAATGTGCACCGAGCTTAAACTCAATGATTATGAGGGAAGACTGATCCAGAACAGCTTAACAATAGAGAGAATG GTACTGTCCGCCTTCGATGAACGTCGTAATAAATACCTCGAAGAACACCCTAGTGCAGGAAAAGACCCTAAGAAAACGGGCGGACCTATCTACAAACGAGTGAACGGTAAATGGGTACGCGAACTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GGGAATGCGGAGGGAAGAACATCAGACATGAGGGCAGAAATCATAAAGATGATGGAAAGTGCAAGACCAGAAGAAGTGTCCTTCCAGGGGAGGGGAGTCTTCGAGCTCTCGGACGAAAGGGCAACGAACCCGATCGTGCCCTCCTTTGACATGAGTAATGAAGGATCTTATTTCTTCGGAGACAATGCAGAGGAGTACGACAATTAATGAAAAATACCCTTGTTTCTACT, SEQ ID NO. 3.

[0029] After de-optimization design, the codon pair bias (CPB) scores of PB2-CPD, PA-CPD and NP-CPD genes were reduced by 0.271, 0.291 and 0.398, respectively (see Table 2). Compared with the wild-type nucleotide sequence, PB2-CPD, PA-CPD and NP-CPD genes had 375, 351 and 293 base site mutations, respectively, and the sequence homologies were 73.21%, 74.44% and 73.32%, respectively.

[0030] Table 2. Comparison of codon pair bias (CPB) of PB2, PA and NP genes before and after de-optimization

[0031] The designed PB2-CPD, PA-CPD and NP-CPD gene sequences were entrusted to Shanghai Jet Bioengineering Co., Ltd. for whole gene synthesis, and were cloned into PUC57 vector to obtain recombinant plasmids pUC57-PB2-CPD, pUC57-PA-CPD and pUC57-NP-CPD. Sanger sequencing verification showed that the inserted sequences in all plasmids were completely consistent with the design, and no unexpected mutations occurred.

[0032] 2. Rescue and verification of recombinant virus Vca-CPD (1) Construction of pHW2000 recombinant plasmid: The PB2-CPD, PA-CPD and NP-CPD gene fragments with homologous arms at both ends were obtained by polymerase chain reaction (PCR) amplification using the synthesized pUC57-PB2-CPD, pUC57-PA-CPD and pUC57-NP-CPD recombinant plasmids as templates. After agarose gel electrophoresis analysis, the correct size target band was recovered and purified. The purified product was connected with the linearized pHW2000 vector through homologous recombination. The recombinant product was transformed into DH5a competent cells, spread on LB plates containing ampicillin for selection. After single colony selection and expansion, the plasmid was extracted, and the correct sequence was verified by DNA sequencing. The plasmids were named as pHW2000-PB2-CPD, pHW2000-PA-CPD and pHW2000-NP-CPD, respectively, and stored at -80°C for future use.

[0033] (2) Virus rescue and amplification: The 8-plasmid reverse genetics system was used for virus rescue. The three recombinant plasmids (pHW2000-PB2-CPD, pHW2000-PA-CPD, pHW2000-NP-CPD) constructed above, together with the plasmids (pHW2000-PB1, pHW2000-M, pHW2000-NS) constructed from the remaining three internal genes of the parent strain A / Yunnan / 1 / 2005Vca (H3N2) and the plasmids (pHW2000-HA, pHW2000-NA) constructed from the two surface genes of the WHO recommended vaccine strain A / Darwin / 9 / 2021 (H3N2) were co-transfected into Vero cells, which were cultured at 37°C, 5% CO2 for 72 hours. The cell supernatant was collected and inoculated into 10-day-old SPF chicken embryos at a dose of 0.8 mL / embryo, which were then cultured at 34°C, 70% RH for 72 hours to amplify the virus. Finally, the chicken embryo allantoic fluid was harvested under sterile conditions, centrifuged, filtered, aliquoted, and stored at -80°C.

[0034] The nucleotide sequences of the PB1, M and NS genes of the parent virus A / Yunnan / 1 / 2005Vca (H3N2) are referred to in the doctoral thesis of Yang Jinghui (Yang Jinghui. Research on the attenuation characteristics of Vero cell cold-adapted strains of H3N2 subtype influenza virus and evaluation of neutralizing antibodies of pseudovirus [D]. Beijing Union Medical College, 2014.).

[0035] The nucleotide sequences of the HA and NA genes of the vaccine virus A / Darwin / 9 / 2021 (H3N2) are referred to in the accession numbers OR567121.1 and OR567258.1 in the GenBank database.

[0036] (3) Virus identification and naming: The harvested allantoic fluid was subjected to hemagglutination test to detect the survival of the virus. In a U-bottom 96-well plate, the virus liquid was subjected to 2-fold serial dilution, mixed with an equal volume of 1% guinea pig red blood cell suspension, incubated at room temperature for 1 h, and observed for red blood cell agglutination. The results showed that the harvested chicken embryo allantoic fluid could induce agglutination of guinea pig red blood cells, with a hemagglutination titer of 1:1024, which preliminarily confirmed that the infectious virus particles were successfully rescued and effectively amplified (see GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG ). At the same time, Sanger sequencing of the PB2, PA and NP gene fragments of the rescued virus showed that the virus genome stably carried the expected de-optimized sequence, without reverse mutation or other unexpected variation.

[0037] In summary, the successfully rescued recombinant virus was named Vca-CPD.

[0038] Vca-CPD was deposited at the China Center for Type Culture Collection on November 20, 2025, with the address of Wuhan University, Wuhan, China, and the deposit number of CCTCC NO: V202585, and the classification name of Influenza A virus Vca-CPD.

[0039] Example 2 Evaluation of the attenuation characteristics of recombinant virus Vca-CPD The parent virus A / Yunnan / 1 / 2005 Vca (H3N2) (Patent No: CN103898066B, Deposit No: CCTCC NO. V201253) is a reported cold-adapted attenuated strain of influenza virus. The recombinant virus Vca-CPD is constructed based on the retention of its entire amino acid sequence, which should theoretically inherit its cold-adapted characteristics. To systematically verify whether Vca-CPD has the core phenotype as a candidate attenuated vaccine strain, this example comprehensively evaluates its temperature sensitivity (ts), cold adaptation (ca), and attenuation characteristics (att) in animal models.

[0040] The recombinant virus Vca-CPD obtained in Example 1 was used as the experimental virus; the virus rescued from the internal genes (PB1, PB2, PA, NP, M, NS) of the parent strain and the same HA and NA genes under the same experimental conditions (named Vca-WT) was used as the control virus.

[0041] Vca-CPD and Vca-WT viruses were diluted 10-fold serially with multiplicity of infection (MOI) = 1, and inoculated into 96-well plates with MDCK cells that had been cultured into a dense monolayer within 24 hours. There were 11 gradients in total, and each gradient had 8 repeated wells. The virus maintenance solution was a DMEM / F12 solution containing 2.0 μg / ml TPCK-trypsin. The inoculated cell culture plates were placed in parallel at 25°C (cold adaptation condition), 33°C (permissive temperature) and 39°C (restrictive temperature) respectively. After 72 hours, the cytopathic effect was observed, and the supernatant was collected. The number of positive wells was counted by hemagglutination test, and finally the TCID 50 titer of the viruses was calculated by the Spearman-Kärber method. The results are shown in Table 3.

[0042] Table 3. Infectivity titers and phenotype analysis of Vca-CPD and Vca-WT viruses at different temperatures

[0043] A 4-6 week old female BALB / c mouse was used to establish an infection model. The mice were randomly divided into 3 groups (6 mice in each group), namely the Vca-CPD experimental group, the Vca-WT control group and the PBS blank control group. The mice were inoculated with 10 7 PFU of the corresponding virus or an equal volume of sterile PBS by intranasal route. On the 1st day and the 3rd day after infection, the lung tissue of the mice was collected, and the viral load in the lungs was determined by the TCID 50 method described above. The results are shown in GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG .

[0044] According to Table 3 and GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG the results, the recombinant virus Vca-CPD has the temperature-sensitive (ts), cold-adapted (ca) and (attenuated) att phenotypes. Specifically, the virus titer at 39°C restrictive temperature is reduced by ≥2.0 Log 10 compared with that at 33°C permissive temperature, which meets the ts phenotype determination standard; the virus titer at 25°C low-temperature adaptation condition is reduced by ≤2.0 Log 10 compared with that at 33°C, which meets the ca phenotype requirement; the replication of the virus in the lower respiratory tract (lungs) of the mice is inhibited, and the virus can effectively replicate in the upper respiratory tract (nasal turbinates), which shows a good att phenotype. It is worth noting that, compared with the parent strain, the Vca-CPD has stronger colonization and replication ability in the nasal mucosa of the mice, and the duration is longer, which is the key to its ability to induce a more persistent immune response.

[0045] Example 3 Replication kinetics evaluation of the recombinant virus Vca-CPD This example aims to evaluate the replication ability of recombinant virus Vca-CPD in human embryonic lung diploid cells (KMB17) and canine kidney cells (MDCK) at 25°C and 33°C, to clarify the replication restriction and cold adaptation characteristics of the virus in the cell model.

[0046] Vca-CPD and Vca-WT virus were inoculated into KMB17 and MDCK cells that had formed a dense monolayer within 24 hours at a multiplicity of infection (MOI) of 1. After 3 hours of adsorption, the residual virus solution was removed and virus maintenance solution was added. The infected cells were cultured at 25°C and 33°C, respectively, and sampled at different time points until the cells were completely pathogenic. The samples were collected to extract viral RNA, and the viral copy number was detected by real-time fluorescent quantitative PCR, from which the one-step growth curve of the virus was plotted, as shown in GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG

[0047] The results show that the replication ability of recombinant virus Vca-CPD in the two cell lines and at two temperature conditions is significantly reduced. In human KMB17 cells, Vca-CPD not only shows significant temperature sensitivity (replication is severely inhibited at 33°C), but also has a much lower overall replication level than Vca-WT virus, with the most obvious attenuation phenotype. In MDCK cells, the replication efficiency of Vca-CPD throughout the replication cycle is also consistently lower than that of Vca-WT virus.

[0048] Example 4 Evaluation of viral yield of recombinant virus Vca-CPD This example aims to evaluate the viral yield and dynamic accumulation process of recombinant virus Vca-CPD in Vero cells (new culture medium) and MDCK cells (standard culture medium) at 25°C and 33°C, to provide a reference for optimizing the vaccine production process.

[0049] Vca-CPD and Vca-WT virus were inoculated into Vero cells and MDCK cells that had formed a dense monolayer within 24 hours at a multiplicity of infection (MOI) of 1. After 3 hours of adsorption, the residual virus solution was removed and virus maintenance solution was added. The infected cells were cultured at 25°C and 33°C, respectively, and sampled at different time points until the cells were completely pathogenic. The samples were collected for hemagglutination test, and the reciprocal of the highest dilution factor of the sample that could cause complete agglutination was taken as the hemagglutination titer (expressed in hemagglutination units / 50μl), as shown in GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG

[0050] The results show that recombinant virus Vca-CPD has stable virion production capacity. Under 25°C or 33°C culture conditions, Vca-CPD can reach a hemagglutination titer peak comparable to that of Vca-WT virus in Vero and MDCK cells.

[0051] ​​Example 5 Evaluation of the immunogenicity of recombinant virus Vca-CPD This example aims to evaluate the strength of the immune response induced by the recombinant virus Vca-CPD in order to determine its potential as a live attenuated vaccine to trigger systemic and mucosal immunity.

[0052] BALB / c mice aged 4-6 weeks were selected and randomly divided into 3 groups (8 mice per group), namely the Vca-CPD experimental group, the Vca-WT control group and the PBS blank control group. Each group was intranasally inoculated with 10 7 PFU of the corresponding virus or an equal volume of sterile PBS for the first immunization; 21 days later, the serum, nasal lavage fluid and lung lavage fluid of the mice in each group were collected for the second immunization; 42 days later, the above samples were collected again.

[0053] The specific hemagglutination inhibition antibody level in the serum was detected by hemagglutination inhibition test. The specific method includes: the serum sample was treated with receptor destroying enzyme, heat inactivated and adsorbed with guinea pig red blood cells to remove non-specific inhibitors, then mixed with 8 hemagglutination units of virus antigen after 2-fold serial dilution, 1% guinea pig red blood cell suspension was added, and the reciprocal of the highest dilution of serum that could completely inhibit hemagglutination was determined as the HI antibody titer, and the results are shown in GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG .

[0054] The neutralizing antibody level in the serum was detected by virus micro-neutralization test. The specific method includes: after the serum was treated with receptor destroying enzyme and heat inactivated, it was diluted by 2-fold serial dilution, and then co-incubated with 100 TCID 50 / 50μl of A / Darwin / 9 / 2021 (H3N2) live virus, followed by the addition of MDCK cells, which were cultured at 37℃ for 72h, then the neutralizing antibody titer was calculated by observing the cytopathic effect combined with the supernatant hemagglutination titer determination, and the results are shown in GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG .

[0055] The virus-specific sIgA antibody level in the nasal lavage fluid and lung lavage fluid was detected by enzyme-linked immunosorbent assay (ELISA). The specific method includes: the recombinant HA protein (catalog number 40859-V08B) of A / Darwin / 9 / 2021 (H3N2) virus was coated on the enzyme-labeled plate, the sample was added after 2-fold serial dilution, and then biotin-labeled mouse anti-IgA antibody, streptavidin-HRP and substrate were added in turn for color development. Finally, the concentration of sIgA in the sample was calculated according to the standard curve, and the results are shown in GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG GCGTTCCTCGCAAGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCT .

[0056] The results showed that the recombinant virus Vca-CPD could effectively induce systemic and mucosal immune responses. Serological detection showed that protective hemagglutination inhibition antibodies and neutralizing antibodies were elicited after the primary and secondary immunization, and the antibody levels were significantly improved after the secondary immunization, indicating that it could form good immune memory. Notably, the level of neutralizing antibodies was always higher than that of hemagglutination inhibition antibodies, suggesting that the antibody response induced by Vca-CPD had a wider range of functionality and potential protection. In terms of mucosal immunity, the levels of sIgA antibodies in the upper and lower respiratory tracts were significantly increased after the secondary immunization, and the response in the upper respiratory tract was stronger than that in the lower respiratory tract, which was consistent with the characteristics of the attenuated strain in the limited replication in the upper respiratory tract and effective stimulation of local immunity. The above results showed that Vca-CPD had good potential in inducing high-quality humoral immunity and effective mucosal immunity.

[0057] The various embodiments in the specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the embodiments can be referred to each other.

[0058] The above description of disclosed embodiments enables a person skilled in the art to implement or use the present application. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present application. Therefore, the present application will not be limited to these embodiments shown herein, but will conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A Vero cell-cold-adapted strain of influenza A virus, Vca-CPD, characterized in that, The accession number of the Vca-CPD is CCTCC NO:V202585.

2. The Vca-CPD strain of influenza A virus Vero cell cold-adapted according to claim 1, characterized in that, The Vca-CPD is a recombinant virus, which was rescued from recombinant plasmids pHW2000-PB2-CPD, pHW2000-PA-CPD, pHW2000-NP-CPD, pHW2000-PB1, pHW2000-M, pHW2000-NS, pHW2000-HA and pHW2000-NA using an 8-plasmid reverse genetics system. The nucleotide sequence of PB2-CPD in pHW2000-PB2-CPD is shown in SEQ ID NO.1, the nucleotide sequence of PA-CPD in pHW2000-PA-CPD is shown in SEQ ID NO.2, and the nucleotide sequence of NP-CPD in pHW2000-NP-CPD is shown in SEQ ID NO.

3.

3. The use of the Vca-CPD strain of influenza A virus Vero cell cold-adapted as described in claim 1 or 2 in the preparation of a vaccine for the prevention of influenza A virus.

4. The application of the Vca-CPD strain of influenza A virus Vero cell cold-adapted according to claim 3 in the preparation of a vaccine for the prevention of influenza A virus, characterized in that, The vaccine in question is a live attenuated vaccine.

5. The use of the Vca-CPD strain of influenza A virus Vero cell cold-adapted as described in claim 1 or 2 as a primary donor virus for vaccines.

6. The method for constructing the Vca-CPD strain of influenza A virus Vero cell cold-adapted as described in claim 1 or 2, characterized in that, Includes the following steps: S1: Based on the parental strain A / Yunnan / 1 / 2005Vca, the PB2, PA, and NP genes were de-optimized according to the codon pair bias of the human genome to obtain PB2-CPD, PA-CPD, and NP-CPD. S2: The PB2-CPD, PA-CPD and NP-CPD were synthesized in their entirety and cloned into the pHW2000 vector to obtain recombinant plasmids pHW2000-PB2-CPD, pHW2000-PA-CPD and pHW2000-NP-CPD. S3: Based on the parental strain A / Yunnan / 1 / 2005Vca, its PB1 gene, M gene and NS gene were amplified and cloned into the pHW2000 vector to obtain recombinant plasmids pHW2000-PB1, pHW2000-M and pHW2000-NS. S4: Based on vaccine strain A / Darwin / 9 / 2021, recombinant plasmids pHW2000-HA and pHW2000-NA were obtained from its HA and NA genes using the method in step S3. S5: Co-transfect Vero cells with the recombinant plasmids pHW2000-PB2-CPD, pHW2000-PA-CPD and pHW2000-NP-CPD obtained in step S2, the recombinant plasmids pHW2000-PB1, pHW2000-M and pHW2000-NS obtained in step S3, and the recombinant plasmids pHW2000-HA and pHW2000-NA obtained in step S4, and collect the supernatant.

7. An influenza A vaccine, characterized in that, It includes the Vca-CPD strain of influenza A virus Vero cell cold-adapted as described in claim 1 or 2.

8. The influenza A vaccine according to claim 7, characterized in that, It also includes adjuvants.

9. A reagent kit, characterized in that, It includes the influenza A vaccine as described in claim 7 or 8.

10. The reagent kit according to claim 9, characterized in that, It also includes the tools used for vaccination.

Images