SiRNA for inhibiting DGAT2 as well as modifier and application of siRNA
By designing siRNA with specific nucleotide sequences to inhibit DGAT2, the problems of triglyceride accumulation and inflammatory fibrosis in NASH were solved, achieving effective control of hepatic steatosis and providing a potential treatment for NASH.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SHANGHAI GENEPHARMA CO LTD
- Filing Date
- 2023-12-26
- Publication Date
- 2026-04-10
AI Technical Summary
Existing technologies have not effectively addressed the issues of triglyceride accumulation, inflammation, and fibrosis in non-alcoholic steatohepatitis (NASH), particularly since the role of diacylglycerol O-acyltransferase 2 (DGAT2) in hepatic steatosis has not been effectively inhibited.
A siRNA containing a sense and antisense strand with specific nucleotide sequences was designed. It can efficiently inhibit the expression of DGAT2 through an RNA interference mechanism. The siRNA can be partially or completely complementary and can be modified to enhance its function.
By inhibiting DGAT2, reducing hepatic steatosis, lowering excessive hepatic triglycerides, and preventing inflammation and fibrosis, it offers a potential treatment option for NASH.
Smart Images

Figure CN121825964A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to siRNA for inhibiting DGAT2 and its modifiers and applications, belonging to the field of biotechnology. BACKGROUND
[0002] Nonalcoholic steatohepatitis (NASH) is a severe liver disease characterized by triglyceride accumulation, severe inflammation, and fibrosis. Although the exact molecular mechanism of NASH progression is not yet known, a widely held hypothesis is that fat accumulation is the main driver of the disease. Therefore, diacylglycerol O-acyltransferase 2 (DGAT2), a key enzyme in triglyceride synthesis, has been explored as a NASH target.
[0003] Targeting molecular pathways involved in the early pathogenesis and abnormal accumulation of liver steatosis can prevent inflammation, cell damage, and fibrosis, thus providing a potential treatment for NASH and liver fibrosis patients. Acetyl-CoA carboxylase (ACC) and diacylglycerol acyltransferase 2 (DGAT2) both play a role in liver steatosis. De novo lipogenesis (DNL) is more active in NAFLD patients than in healthy individuals and can lead to excessive liver triglycerides, while ACC is the first committed enzyme in the hepatic DNL pathway. DGAT2 is highly expressed in the liver and adipose tissue and catalyzes the final step of DNL, specifically the esterification of fatty acids with diglycerides to form triglycerides. Independent inhibition of each of these steps has been shown to reduce liver steatosis.
[0004] Small interfering ribonucleic acid (siRNA), usually double-stranded RNA of 20 to 25 nucleotides in length, mainly through the mechanism of RNA interference (RNAi), regulates the expression of genes in a specific manner, achieving the purpose of treating diseases. Therefore, developing an siRNA to inhibit the production of DGAT2 will be an effective way to treat tumors. SUMMARY
[0005] To solve the above problems, the present application provides an siRNA for inhibiting DGAT2, which contains a sense strand and an antisense strand, the sense strand and the antisense strand are at least partially reverse complementary to form a double-stranded region,
[0006] wherein the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID NO. 1 or to the entire nucleotide sequence of SEQ ID NO. 1, and the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID NO. 2 or to the entire nucleotide sequence of SEQ ID NO. 2; or,
[0007] the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID NO. 3 or to the entire nucleotide sequence of SEQ ID NO. 3, and the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID NO. 4 or to the entire nucleotide sequence of SEQ ID NO. 4; or,
[0008] the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID NO. 5 or to the entire nucleotide sequence of SEQ ID NO. 5, and the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID NO. 6 or to the entire nucleotide sequence of SEQ ID NO. 6; or,
[0009] the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID NO. 7 or to the entire nucleotide sequence of SEQ ID NO. 7, and the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID NO. 8 or to the entire nucleotide sequence of SEQ ID NO. 8; or,
[0010] the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID NO. 9 or to the entire nucleotide sequence of SEQ ID NO. 9, and the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID NO. 10 or to the entire nucleotide sequence of SEQ ID NO. 10; or,
[0011] The positive strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 11 or with the complete nucleotide sequence of SEQ ID NO. 11; or,
[0012] The positive strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 13 or the complete nucleotide sequence of SEQ ID NO. 13; the antisense strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 14 or the complete nucleotide sequence of SEQ ID NO. 14; or,
[0013] The positive strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 15 or with the complete nucleotide sequence of SEQ ID NO. 15; the antisense strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 16 or with the complete nucleotide sequence of SEQ ID NO. 16; or,
[0014] The positive strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 17 or the complete nucleotide sequence of SEQ ID NO. 17; the antisense strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 18 or the complete nucleotide sequence of SEQ ID NO. 18; or,
[0015] The positive strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 19 or with the complete nucleotide sequence of SEQ ID NO. 19; the antisense strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 20 or with the complete nucleotide sequence of SEQ ID NO. 20; or,
[0016] The positive strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 21 or with the complete nucleotide sequence of SEQ ID NO. 21; or,
[0017] The positive strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 23 or with the complete nucleotide sequence of SEQ ID NO. 23; the antisense strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 24 or with the complete nucleotide sequence of SEQ ID NO. 24; or,
[0018] The positive strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 25 or with the complete nucleotide sequence of SEQ ID NO. 25; the antisense strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 26 or with the complete nucleotide sequence of SEQ ID NO. 26; or,
[0019] The positive strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 27 or the complete nucleotide sequence of SEQ ID NO. 27; the antisense strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 28 or the complete nucleotide sequence of SEQ ID NO. 28; or,
[0020] The positive strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 29 or with the complete nucleotide sequence of SEQ ID NO. 29; the antisense strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 30 or with the complete nucleotide sequence of SEQ ID NO. 30; or,
[0021] The positive strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 31 or the complete nucleotide sequence of SEQ ID NO. 31; the antisense strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 32 or the complete nucleotide sequence of SEQ ID NO. 32; or,
[0022] The positive strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 33 or the complete nucleotide sequence of SEQ ID NO. 33; the antisense strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 34 or the complete nucleotide sequence of SEQ ID NO. 34; or,
[0023] The sense strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 35 or with the complete nucleotide sequence of SEQ ID NO. 35, and the antisense strand comprises a nucleotide sequence containing at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity with a portion of the nucleotide sequence of SEQ ID NO. 36 or with the complete nucleotide sequence of SEQ ID NO. 36.
[0024] In one embodiment of the present invention, the sense strand comprises: a nucleotide sequence as shown in SEQ ID NO.1 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO.1 and retaining the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO.2 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO.2 and retaining the biological function of the sequence from which it is derived; or,
[0025] The positive strand comprises: a nucleotide sequence as shown in SEQ ID NO. 3 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 3 and retaining the biological function of its derived sequence; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO. 4 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 4 and retaining the biological function of its derived sequence; or,
[0026] The positive strand comprises: a nucleotide sequence as shown in SEQ ID NO. 5 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 5 and retaining the biological function of its derived sequence; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO. 6 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 6 and retaining the biological function of its derived sequence; or,
[0027] The positive strand comprises: a nucleotide sequence as shown in SEQ ID NO. 7 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 7 and retaining the biological function of its derived sequence; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO. 8 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 8 and retaining the biological function of its derived sequence; or,
[0028] The positive strand comprises: a nucleotide sequence as shown in SEQ ID NO. 9 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 9 and retaining the biological function of its derived sequence; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO. 10 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 10 and retaining the biological function of its derived sequence; or,
[0029] The positive strand comprises: a nucleotide sequence as shown in SEQ ID NO. 11 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 11 and retaining the biological function of its derived sequence; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO. 12 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 12 and retaining the biological function of its derived sequence; or,
[0030] The positive strand comprises: a nucleotide sequence as shown in SEQ ID NO. 13 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 13 and retaining the biological function of its derived sequence; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO. 14 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 14 and retaining the biological function of its derived sequence; or,
[0031] The positive strand comprises: a nucleotide sequence as shown in SEQ ID NO. 15 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 15 and retaining the biological function of its derived sequence; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO. 16 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 16 and retaining the biological function of its derived sequence; or,
[0032] The positive strand comprises: a nucleotide sequence as shown in SEQ ID NO. 17 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 17 and retaining the biological function of its derived sequence; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO. 18 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 18 and retaining the biological function of its derived sequence; or,
[0033] The positive strand comprises: a nucleotide sequence as shown in SEQ ID NO. 19 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 19 and retaining the biological function of its derived sequence; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO. 20 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 20 and retaining the biological function of its derived sequence; or,
[0034] The positive strand comprises: a nucleotide sequence as shown in SEQ ID NO. 21 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 21 and retaining the biological function of its derived sequence; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO. 22 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 22 and retaining the biological function of its derived sequence; or,
[0035] The positive strand comprises: a nucleotide sequence as shown in SEQ ID NO. 23 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 23 and retaining the biological function of its derived sequence; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO. 24 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 24 and retaining the biological function of its derived sequence; or,
[0036] The positive strand comprises: a nucleotide sequence as shown in SEQ ID NO. 25 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 25 and retaining the biological function of its derived sequence; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO. 26 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 26 and retaining the biological function of its derived sequence; or,
[0037] The positive strand comprises: a nucleotide sequence as shown in SEQ ID NO. 27 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 27 and retaining the biological function of its derived sequence; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO. 28 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 28 and retaining the biological function of its derived sequence; or,
[0038] The positive strand comprises: a nucleotide sequence as shown in SEQ ID NO. 29 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 29 and retaining the biological function of its derived sequence; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO. 30 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 30 and retaining the biological function of its derived sequence; or,
[0039] The positive strand comprises: a nucleotide sequence as shown in SEQ ID NO. 31 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 31 and retaining the biological function of its derived sequence; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO. 32 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 32 and retaining the biological function of its derived sequence; or,
[0040] The positive strand comprises: a nucleotide sequence as shown in SEQ ID NO. 33 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 33 and retaining the biological function of its derived sequence; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO. 34 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 34 and retaining the biological function of its derived sequence; or,
[0041] The positive strand comprises: a nucleotide sequence as shown in SEQ ID NO. 35 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 35 and retaining the biological function of the sequence from which it is derived; the antisense strand comprises: a nucleotide sequence as shown in SEQ ID NO. 36 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence as shown in SEQ ID NO. 36 and retaining the biological function of the sequence from which it is derived.
[0042] In one embodiment of the present invention, the sense strand comprises a nucleotide sequence as shown in SEQ ID NO.1, and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO.2; or,
[0043] The sense strand consists of a nucleotide sequence as shown in SEQ ID NO. 3, and the antisense strand consists of a nucleotide sequence as shown in SEQ ID NO. 4; or,
[0044] The sense strand consists of a nucleotide sequence as shown in SEQ ID NO. 5, and the antisense strand consists of a nucleotide sequence as shown in SEQ ID NO. 6; or,
[0045] The sense strand consists of a nucleotide sequence as shown in SEQ ID NO. 7, and the antisense strand consists of a nucleotide sequence as shown in SEQ ID NO. 8; or,
[0046] The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 9, and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 10; or,
[0047] The sense strand consists of a nucleotide sequence as shown in SEQ ID NO. 11, and the antisense strand consists of a nucleotide sequence as shown in SEQ ID NO. 12; or,
[0048] The sense strand consists of a nucleotide sequence as shown in SEQ ID NO. 13, and the antisense strand consists of a nucleotide sequence as shown in SEQ ID NO. 14; or,
[0049] The sense strand consists of a nucleotide sequence as shown in SEQ ID NO. 15, and the antisense strand consists of a nucleotide sequence as shown in SEQ ID NO. 16; or,
[0050] The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 17, and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 18; or,
[0051] The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 19, and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 20; or,
[0052] The sense strand consists of a nucleotide sequence as shown in SEQ ID NO. 21, and the antisense strand consists of a nucleotide sequence as shown in SEQ ID NO. 22; or,
[0053] The sense strand consists of a nucleotide sequence as shown in SEQ ID NO. 23, and the antisense strand consists of a nucleotide sequence as shown in SEQ ID NO. 24; or,
[0054] The sense strand consists of a nucleotide sequence as shown in SEQ ID NO. 25, and the antisense strand consists of a nucleotide sequence as shown in SEQ ID NO. 26; or,
[0055] The sense strand consists of a nucleotide sequence as shown in SEQ ID NO. 27, and the antisense strand consists of a nucleotide sequence as shown in SEQ ID NO. 28; or,
[0056] The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 29, and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 30; or,
[0057] The sense strand consists of a nucleotide sequence as shown in SEQ ID NO. 31, and the antisense strand consists of a nucleotide sequence as shown in SEQ ID NO. 32; or,
[0058] The sense strand consists of a nucleotide sequence as shown in SEQ ID NO. 33, and the antisense strand consists of a nucleotide sequence as shown in SEQ ID NO. 34; or,
[0059] The sense strand consists of a nucleotide sequence as shown in SEQ ID NO. 35, and the antisense strand consists of a nucleotide sequence as shown in SEQ ID NO. 36.
[0060] In one embodiment of the present invention, the siRNA is prepared by solid-phase synthesis or liquid-phase synthesis.
[0061] In one embodiment of the present invention, the nucleotides in the siRNA are each independently modified or unmodified nucleotides.
[0062] In one embodiment of the present invention, each nucleotide in the siRNA is an unmodified nucleotide.
[0063] In one embodiment of the present invention, some or all of the nucleotides in the siRNA are modified nucleotides, and these modifications on the nucleotide groups do not cause a significant weakening or loss of the function of the siRNA disclosed herein in inhibiting the expression of the DGAT2 gene.
[0064] In one embodiment of the present invention, at least one nucleotide in the sense strand or antisense strand of the siRNA is a modified nucleotide.
[0065] In one embodiment of the present invention, at least one phosphate group in the sense or antisense strand of the siRNA is a phosphate group with a modifying group.
[0066] In one embodiment of the present invention, at least a portion of the phosphate ester groups and / or ribosomes in the phosphate-sugar backbone of at least one single strand of the sense and antisense strands of the siRNA are phosphate ester groups and / or ribosomes with modifying groups.
[0067] In one embodiment of the present invention, all nucleotides in the sense strand and / or antisense strand of the siRNA are modified nucleotides, and these modifications on the nucleotide groups do not cause a significant weakening or loss of the function of the siRNA disclosed herein in inhibiting the expression of the DGAT2 gene.
[0068] In one embodiment of the present invention, each nucleotide in the sense and antisense strands of the siRNA is independently a fluorinated nucleotide or a non-fluorinated nucleotide.
[0069] In one embodiment of the present invention, the modification is a chemical modification, which is selected from one or more of methoxy modification, fluorination modification, or thiophosphate linkage.
[0070] In one embodiment of the present invention, a "fluorinated nucleotide" refers to a nucleotide formed by replacing the hydroxyl group at the 2' position of the ribosyl group with fluorine, having the structure shown in formula (1). The non-fluorinated nucleotide is independently selected from nucleotides or nucleotide analogs formed by replacing the hydroxyl group at the 2' position of the ribosyl group with a non-fluorinated group.
[0071] In one embodiment of the present invention, the nucleotide formed by replacing the hydroxyl group at the 2' position of the ribosome with a non-fluorinated group is well known to those skilled in the art, and these nucleotides may be selected from one of 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'-substituted amino modified nucleotides, and 2'-deoxynucleotides.
[0072] In one embodiment of the present invention, the 2'-alkoxy modified nucleotide is a 2'-methoxy (2'-OMe) modified nucleotide, as shown in formula (2); the 2'-substituted alkoxy modified nucleotide may be, for example, a 2'-O-methoxyethyl (2'-MOE) modified nucleotide, as shown in formula (3); the 2'-amino (2'-NH2) modified nucleotide is shown in formula (4); and the 2'-deoxynucleotide (DNA) is shown in formula (5).
[0073]
[0074] In one embodiment of the present invention, the fluorinated nucleotides are located in the antisense and sense strands of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 9, 10, and 11 of the sense strand are fluorinated nucleotides, and at least the nucleotides at positions 2, 6, 14, and 16 of the antisense strand are fluorinated nucleotides.
[0075] In one embodiment of the present invention, the fluorinated nucleotides are located in the antisense and sense strands of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the 7th, 8th, and 9th nucleotides of the sense strand are fluorinated nucleotides, and at least the 2nd, 6th, 14th, and 16th nucleotides of the antisense strand are fluorinated nucleotides.
[0076] In one embodiment of the present invention, the fluorinated nucleotides are located in the sense strand and the antisense strand. The sense strand contains no more than five fluorinated nucleotides, and at least the 7th, 8th, and 9th nucleotides of the sense strand are fluorinated nucleotides in the direction from the 5' end to the 3' end. The antisense strand contains no more than seven fluorinated nucleotides, and at least the 2nd, 6th, 14th, and 16th nucleotides of the antisense strand are fluorinated nucleotides.
[0077] In one embodiment of the present invention, in the positive strand, the nucleotides at positions 7, 8, and 9, or positions 5, 7, 8, and 9, are fluorinated nucleotides, and the nucleotides at the remaining positions in the positive strand are non-fluorinated nucleotides, following the direction from the 5' end to the 3' end. In the negative strand, the nucleotides at positions 2, 6, 14, and 16, or positions 2, 6, 8, 9, 14, and 16, are fluorinated nucleotides, and the nucleotides at the remaining positions in the negative strand are non-fluorinated nucleotides.
[0078] In one embodiment of the present invention, the methoxy-modified nucleotides are located in the antisense and sense strands of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 2, 3, 4, 5, 6, 7, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 of the sense strand are methoxy-modified nucleotides, and at least the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, 23, and 24 of the antisense strand are methoxy-modified nucleotides.
[0079] In one embodiment of the present invention, the methoxy-modified nucleotides are located in the antisense and sense strands of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 1, 2, 3, 4, 5, 6, 7, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 of the sense strand are methoxy-modified nucleotides, and at least the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, 23, and 24 of the antisense strand are methoxy-modified nucleotides.
[0080] In one embodiment of the present invention, the methoxy-modified nucleotides are located in the antisense and sense strands of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 1, 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 of the sense strand are methoxy-modified nucleotides, and at least the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 of the antisense strand are methoxy-modified nucleotides.
[0081] In one embodiment of the invention, the methoxyethyl-modified nucleotide is located in the positive strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the first nucleotide of the positive strand is a methoxyethyl-modified nucleotide.
[0082] In one embodiment of the present invention, the nucleotide analogue refers to a group that can replace a nucleotide in nucleic acids, but whose structure is different from that of adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide.
[0083] In one embodiment of the present invention, the nucleotide analog may be a heteronucleotide, a bridged nucleotide, or an acyclic nucleotide.
[0084] In one embodiment of the invention, the bridged nucleotide (BNA) refers to a restricted or inaccessible nucleotide. The BNA may contain a bridging structure with a "fixed" C3'-endoglucan condensation of a five-membered ring, a six-membered ring, or a seven-membered ring. Typically, the bridge is incorporated into the 2'-, 4'-position of the ribose to provide a 2',4'-BNA nucleotide.
[0085] In one embodiment of the present invention, the BNA may be LNA, ENA, cET BNA, etc., wherein LNA is as shown in formula (6), ENA is as shown in formula (7), and cET BNA is as shown in formula (8):
[0086]
[0087] In one embodiment of the present invention, the LNA-modified nucleotide is located in the positive strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the first nucleotide of the positive strand is an LNA-modified nucleotide.
[0088] In one embodiment of the present invention, at least a portion of the phosphate ester groups in the phosphate-sugar backbone of at least one single strand of the sense and antisense strands of the siRNA are phosphate ester groups with modifying groups.
[0089] In one embodiment of the present invention, the phosphate ester group with the modifying group is a thiophosphate ester group formed by replacing at least one oxygen atom in the phosphate diester bond of the phosphate ester group with a sulfur atom.
[0090] In one embodiment of the present invention, the phosphate group having the modifying group is a thiophosphate group having the structure shown in formula (9):
[0091]
[0092] In one embodiment of the invention, the thiophosphate group linkage is present at least at one of the following positions: between the first and second nucleotides at either end of the sense or antisense strand; between the second and third nucleotides at either end of the sense or antisense strand; or any combination thereof.
[0093] In one embodiment of the invention, the thiophosphate group linkage is present at all of the above-mentioned positions except for the end of the positive chain 5'.
[0094] In one embodiment of the invention, the thiophosphate group linkage is present at all of the above-mentioned positions except for the end of the positive chain 3'.
[0095] In one embodiment of the invention, the thiophosphate group is present at at least one of the following positions:
[0096] Between the first and second nucleotides at the 5' end of the positive strand;
[0097] Between the second and third nucleotides at the 5' end of the positive strand;
[0098] Between the first and second nucleotides at the 3' end of the positive strand;
[0099] Between the second and third nucleotides at the 3' end of the positive strand;
[0100] Between the first and second nucleotides at the 5' end of the antisense strand;
[0101] Between the second and third nucleotides at the 5' end of the antisense strand;
[0102] Between the first and second nucleotides at the 3' end of the antisense strand; and
[0103] Between the second and third nucleotides at the 3' end of the antisense strand.
[0104] In one embodiment of the present invention, the nucleotides linked by the thiophosphate group are located in the antisense and sense strands of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the first and second positions, and the second and third positions of the sense strand are nucleotides linked by the thiophosphate group; and, in the direction from the 5' end to the 3' end, at least the first and second positions, the second and third positions, the 21st and 22nd positions, and the 22nd and 23rd positions of the antisense strand are nucleotides linked by the thiophosphate group.
[0105] In one embodiment of the present invention, the nucleotide linked by the thiophosphate group is located in the antisense and sense strands of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the 1st and 2nd positions, and the 2nd and 3rd positions of the sense strand are nucleotides linked by the thiophosphate group; and, in the direction from the 5' end to the 3' end, at least the 1st and 2nd positions, the 2nd and 3rd positions, the 19th and 20th positions, and the 20th and 21st positions of the antisense strand are nucleotides linked by the thiophosphate group.
[0106] In one embodiment of the present invention, the siRNA introduces modified nucleotides by using nucleotide monomers with corresponding modifications.
[0107] The present invention also provides a product for inhibiting DGAT2, the product comprising an active ingredient and a pharmaceutically acceptable carrier, wherein the active ingredient is the aforementioned siRNA or the aforementioned modified siRNA.
[0108] In one embodiment of the present invention, the product is a pharmaceutical composition or a kit.
[0109] In one embodiment of the present invention, the product is a pharmaceutical composition, and the pharmaceutically acceptable carrier can be a carrier conventionally used in the field of siRNA delivery, such as, but not limited to, magnetic nanoparticles (e.g., Fe3O4 or Fe2O3-based nanoparticles), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethylenimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine) (PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly(D&L-lactic / glycolic acid) copolymer (PLGA), and poly(2-aminoethyl ethylene) phosphate. One or more of the following: phosphate), PPEEA, and poly(2-dimethylaminoethylmethacrylate), PDMAEMA, and their derivatives.
[0110] In one embodiment of the present invention, there are no special requirements for the content of siRNA and pharmaceutically acceptable carrier; the content of each component can be the conventional content.
[0111] In one embodiment of the present invention, the weight ratio of the active ingredient to the pharmaceutically acceptable carrier in the pharmaceutical composition is 1:(1-500).
[0112] In one embodiment of the present invention, the weight ratio of the active ingredient to the pharmaceutically acceptable carrier in the pharmaceutical composition is 1:(1-50).
[0113] In one embodiment of the invention, the pharmaceutical composition may further contain other pharmaceutically acceptable excipients, which may be one or more of various formulations or compounds conventionally used in the art.
[0114] In one embodiment of the invention, the other pharmaceutically acceptable excipients may include at least one of pH buffers, protectants, and osmotic pressure regulators.
[0115] In one embodiment of the present invention, the pH buffer may be a tris(hydroxymethyl)aminomethane hydrochloride buffer with a pH of 7.5 to 8.5 and / or a phosphate buffer with a pH of 5.5 to 8.5.
[0116] In one embodiment of the present invention, the protective agent may be at least one selected from inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose, and glucose.
[0117] In one embodiment of the present invention, the content of the protective agent may be 0.01 to 30% by weight, based on the total weight of the pharmaceutical composition.
[0118] In one embodiment of the present invention, the osmotic pressure regulator may be sodium chloride and / or potassium chloride.
[0119] In one embodiment of the present invention, the content of the osmotic pressure regulator is such that the osmotic pressure of the pharmaceutical composition is 200 to 700 mOSM / L. The content of the osmotic pressure regulator can be easily determined by those skilled in the art based on the required osmotic pressure.
[0120] In one embodiment of the present invention, the pharmaceutical composition may be a liquid formulation, such as an injection; or it may be a lyophilized powder for injection, which is mixed with liquid excipients to form a liquid formulation when administered.
[0121] In one embodiment of the present invention, the liquid formulation may be used, but is not limited to, for subcutaneous, intramuscular or intravenous administration, or may be administered to the lungs via spray, or to other organs or tissues (such as the liver) via spray through the lungs.
[0122] In one embodiment of the present invention, the pharmaceutical composition is used for intravenous administration.
[0123] In one embodiment of the present invention, the pharmaceutical composition may be in the form of a liposome formulation.
[0124] In one embodiment of the invention, the pharmaceutically acceptable carrier used in the liposome formulation comprises an amine-containing transfection compound (hereinafter also referred to as an organic amine), an auxiliary lipid, and / or a polyethylene glycol-modified lipid.
[0125] In one embodiment of the present invention, the organic amine, the auxiliary lipid, and the polyethylene glycol-modified lipid may be selected from one or more of the amine-containing transfection compounds or their pharmaceutically acceptable salts or derivatives, auxiliary lipids, and polyethylene glycol-modified lipids described in CN108220295B (which is incorporated herein by reference in its entirety).
[0126] In one embodiment of the present invention, the pharmaceutically acceptable targeting group in the siRNA conjugate may be galactose or N-acetylgalgactosamine (GalNAc). N-acetylgalgactosamine is a ligand that binds to the asialoglycoprotein receptor (ASGPR) on the liver surface. The ASGPR is an endocytic receptor specifically expressed by hepatocytes. N-acetylgalgactosamine serves as a targeting molecule to deliver small RNA to the liver.
[0127] In one embodiment of the present invention, the galactose or N-acetylgalactosamine molecule can be monovalent, divalent, trivalent, or tetravalent; the monovalent, divalent, trivalent, and tetravalent respectively refer to the siRNA molecule forming an siRNA conjugate with a coupling group containing a galactose or N-acetylgalactosamine molecule as a targeting group, wherein the molar ratio of the siRNA molecule to the galactose or N-acetylgalactosamine molecule in the siRNA conjugate is 1:1, 1:2, 1:3, or 1:4.
[0128] In one embodiment of the present invention, when siRNA is coupled to a coupling group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent or tetravalent.
[0129] In one embodiment of the present invention, when siRNA is coupled to a coupling group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent.
[0130] In one embodiment of the present invention, the targeting group can be linked to the siRNA molecule via a suitable adapter, and those skilled in the art can select a suitable adapter according to the specific type of the targeting group.
[0131] In one embodiment of the present invention, the types of adapters, targeting groups, and the method of connection with siRNA can be found in the disclosure of WO2015006740A2, the entire contents of which are incorporated herein by reference.
[0132] In one embodiment of the present invention, the siRNA conjugate formed by GalNAc and siRNA molecules has the structure shown in formula (10):
[0133]
[0134] In one embodiment of the invention, the kit further comprises a pharmaceutically acceptable carrier and / or excipients.
[0135] In one embodiment of the invention, the siRNA, pharmaceutically acceptable carrier, and / or excipients in the kit may be present individually, in a mixture of two or more of them, or in the form of a final pharmaceutical composition.
[0136] In one embodiment of the present invention, the pharmaceutically acceptable carrier in the kit is an amine-containing compound, an auxiliary lipid, or a polyethylene glycol-modified lipid.
[0137] In one embodiment of the invention, the pharmaceutically acceptable carrier in the kit is either a mixture or exists independently.
[0138] In one embodiment of the invention, the siRNA, pharmaceutically acceptable carrier, and / or excipients in the kit are provided in liquid, dry, or lyophilized form.
[0139] In one embodiment of the invention, the siRNA, pharmaceutically acceptable carriers, and / or excipients in the kit are substantially pure and / or sterile.
[0140] In one embodiment of the invention, the kit includes a container for providing siRNA, one or more containers for providing amine-containing compounds, auxiliary lipids, and polyethylene glycol-modified lipids, and optionally, a container for providing excipients.
[0141] In one embodiment of the invention, the kit further comprises one or more components necessary or beneficial for a particular application, the components being selected from:
[0142] One or more components for achieving the desired cell transfection;
[0143] One or more components used to diagnose, treat, or prevent a specific disease or physical disorder;
[0144] One or more buffers;
[0145] Positive or negative control samples;
[0146] Excipients, stabilizers, or preservatives.
[0147] In one embodiment of the invention, the one or more components for diagnosing, treating or preventing a specific disease or physical disorder are one or more additional therapeutic compounds or compositions, or one or more diagnostic reagents.
[0148] In one embodiment of the present invention, the kit further comprises one or more of sterile water, physiological saline, and PBS.
[0149] The present invention also provides the use of the above-mentioned siRNA or the above-mentioned product in the preparation of products for the prevention, diagnosis and / or treatment of pathological conditions or diseases caused by DGAT2.
[0150] In one embodiment of the present invention, the disease caused by DGAT2 is cancer.
[0151] In one embodiment of the present invention, the cancer is non-small cell lung cancer.
[0152] The technical solution of this invention has the following advantages:
[0153] This invention provides siRNA for inhibiting DGAT2, wherein the sense strand of the siRNA is as shown in SEQ ID NO. 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33 or 35, and the antisense strand is as shown in SEQ ID NO. 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34 or 36, and is processed using psiCHECK. TM -2 Plasmid construction and detection were performed to determine the targeting relationship between siRNA and the target gene fragment. All 18 siRNAs showed high inhibitory activity.
[0154] This invention provides modified siRNA for inhibiting DGAT2, the modifications including methoxy modification, fluorination modification, thiophosphate linkage, LNA modification, and methoxyethyl modification, using psiCHECK. TM-2 Plasmid construction and detection: The plasmid was tested and the targeting relationship between the modified siRNA obtained by chemical modification of the sense strand as shown in SEQ ID NO. 7, 9, 15, 17, 21 or 23 and the antisense strand as shown in SEQ ID NO. 8, 10, 16, 18, 22 or 23 and the target gene fragment was determined. It also showed good DGAT2 inhibition at a concentration of 1 nM. After GalNAc conjugation, in mice after a single dose, the modified siRNA obtained by chemical modification of the sense strand as shown in SEQ ID NO. 7 and the antisense strand as shown in SEQ ID NO. 8, as well as the modified siRNA obtained by chemical modification of the sense strand as shown in SEQ ID NO. 21 and the antisense strand as shown in SEQ ID NO. 22, showed a very significant inhibitory effect (inhibition rate greater than 80%) at a dose of 3 mg / kg. At a dose of 3 mg / kg, the modified siRNA obtained by chemical modification of the sense strand as shown in SEQ ID NO. 7 or 21 and the antisense strand as shown in SEQ ID NO. 22 showed a very significant inhibitory effect (inhibition rate greater than 80%). The modified siRNA obtained after chemically modifying the antisense strand shown in IDNO.8 or 22 still has a very prominent inhibitory effect (RD34DG011 still has a very prominent inhibitory effect (inhibition rate greater than 90% after 10 days, and still maintains greater than 60% inhibition effect after 17 days). Attached Figure Description
[0155] Figure 1 Results of single-dose (3 mg / kg) qPCR assays in mice of modified siRNA conjugates (RD34DG004G, RD34DG008G, RD34DG009G, RD34DG011G and RD34DG012G) used to inhibit DGAT2.
[0156] Figure 2 Results of single-dose (3 mg / kg) qPCR assays of modified siRNA conjugates (RD34DG004G, RD34DG004LNA1G and RD34DG004MOE1G) for inhibiting DGAT2 in mice.
[0157] Figure 3 Results of single-dose (3 mg / kg) qPCR assays in mice of modified siRNA conjugates (RD34DG011G, RD34DG011LNA1G and RD34DG011MOE1G) used to inhibit DGAT2. Detailed Implementation
[0158] The following embodiments are provided to better understand the present invention and are not limited to the preferred embodiments described. They do not constitute a limitation on the content and scope of protection of the present invention. Any product that is the same as or similar to the present invention, derived by any person under the guidance of the present invention or by combining the features of the present invention with other prior art, falls within the protection scope of the present invention.
[0159] In the following embodiments, DGAT2 mRNA refers to mRNA having the sequence shown in GeneBank registration numbers NM_032564.5, NM_026384.3, or XM_005579118.3. Further, unless otherwise specified, the term "target gene" as used in this disclosure refers to the gene that transcribes the above-mentioned DGAT2 mRNA, and the term "target mRNA" refers to the above-mentioned DGAT2 mRNA.
[0160] For any experimental steps or conditions not specified in the following examples, the procedures or conditions described in the literature in this field can be followed. Reagents or instruments whose manufacturers are not specified are all commercially available products.
[0161] In the following examples, uppercase letters C, G, U, and A represent ribonucleotides; lowercase letter m indicates that the nucleotide adjacent to the left of letter m is a methoxy-modified nucleotide; lowercase letter f indicates that the nucleotide adjacent to the left of letter f is a fluorinated nucleotide; and lowercase letter s indicates that the two nucleotides adjacent to the left and right of letter s are modified with thiophosphate groups.
[0162] In the following examples, "modified nucleotide" refers to a nucleotide or nucleotide analog formed by replacing the 2'-hydroxyl group of the ribosyl group with another group, or a nucleotide whose base is a modified base. "Fluorinated nucleotide" refers to a nucleotide formed by replacing the 2'-hydroxyl group of the ribosyl group with fluorine, and "non-fluorinated nucleotide" refers to a nucleotide or nucleotide analog formed by replacing the 2'-hydroxyl group of the ribosyl group with a non-fluorinated group. "Nucleotide analog" refers to a group that can replace a nucleotide in nucleic acids but has a structure different from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. Examples include isonucleotides, bridged nucleic acids (BNA), or acyclic nucleotides. "Methoxylated nucleotide" refers to a nucleotide formed by replacing the 2'-hydroxyl group of the ribosyl group with a methoxy group.
[0163] In the following examples, the terms "complementary" or "reverse complementary" are used interchangeably and have the meaning known to those skilled in the art: in a double-stranded nucleic acid molecule, the bases of one strand are paired complementaryly with the bases of the other strand. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) always pairs with the pyrimidine base cytosine (G). Each base pair consists of one purine and one pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered complementary, and the sequence of the strand can be inferred from the sequence of its complementary strand.
[0164] In the following examples, particularly in describing methods for preparing siRNA, pharmaceutical compositions, or siRNA conjugates of this disclosure, unless otherwise specified, a nucleoside monomer refers to a modified or unmodified RNA phosphoramidites (sometimes also called nucleoside phosphoramidites) used in phosphoramidite solid-phase synthesis, depending on the type and sequence of nucleotides in the siRNA or siRNA conjugate to be prepared. Phosphoramidite solid-phase synthesis is a method known to those skilled in the art for RNA synthesis. All nucleoside monomers used in this disclosure are commercially available.
[0165] In the following embodiments, "coupling" refers to the covalent connection between two or more chemical parts, each with a specific function; correspondingly, "coupling" refers to a compound formed by the covalent connection between these chemical parts. Further, "siRNA conjugate" refers to a compound formed by the covalent attachment of one or more chemical parts with specific functions to siRNA. The term "siRNA conjugate" should be understood, depending on the context, as a collective term for multiple siRNA conjugates or a siRNA conjugate represented by a specific chemical formula. In the context of this disclosure, "coupling molecule" should be understood as a specific compound that can be reactively coupled to siRNA to ultimately form the siRNA conjugate of this disclosure.
[0166] In the following examples, "optional" or "optionally" means that the event or condition described thereafter may or may not occur, and the description includes both the possibility that the event or condition occurs and the possibility that it does not occur. For example, "optionally substituted" "alkyl" includes "alkyl" and "substituted alkyl" as defined below. Those skilled in the art will understand that for any group containing one or more substituents, these groups are not intended to introduce any substitution or substitution pattern that is spatially impractical, synthetically infeasible, and / or inherently unstable.
[0167] In the following embodiments, the terms “treatment,” “relief,” or “improvement” may be used interchangeably herein. These terms refer to methods of achieving beneficial or desired outcomes, including but not limited to therapeutic benefits. A “therapeutic benefit” means the eradication or improvement of the underlying disorder being treated. Furthermore, a therapeutic benefit is achieved by eradicating or improving one or more physical symptoms associated with the underlying disorder, thereby observing improvement in the subject, although the subject may still be suffering from the underlying disorder.
[0168] In the following examples, "prevention" and "protection" are used interchangeably. These terms refer to methods of obtaining a beneficial or desired outcome, including but not limited to preventive benefits. To obtain a "preventive benefit," the composition may be given to a subject at risk of developing a specific disease, or to a subject who reports one or more pathological symptoms of a disease, even if a diagnosis of the disease may not have been made.
[0169] Unless otherwise specified, the reagents and culture media used in the following examples are commercially available products, and the nucleic acid electrophoresis, real-time PCR and other operations used are performed in accordance with the methods described in Molecular Biology (4th Edition) (Alexander McLennan et al., 2019).
[0170] The experimental cells used in the following examples were 293T cells, purchased from the Cell Bank of the Chinese Academy of Sciences;
[0171] The experimental animals were C57BL / 6J black mice, purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd. All animals were housed in the SPF-grade animal facility of Suzhou Jima Gene Co., Ltd. Animals were kept under a 12-hour light-dark cycle, with free access to food and water. Experiments began after one week of acclimatization. The use and handling of the experimental animals complied with the requirements of the Animal Management Committee of Suzhou Jima Gene Co., Ltd. regarding experimental animals and animal welfare.
[0172] The siRNAs involved in the following examples are siRNA sequences synthesized via phosphoramide solid-phase synthesis.
[0173] The inserted sequences used in the following examples are DNA sequences customized from Hongxun Biotechnology Co., Ltd., specifically:
[0174] 5'-TTGGCTGGTGTTTGACTGGAAGCGCTACTTTCGAGACTACTTTCCC AGGAACTATATCTTTGGATACCTAGACTATTTGCTTTTCAAAGAATTGGAGAGAATGAAGTGTACAAGTCCAGAAGAAGTTCCAGAAATACACTTTTTTGCTCTGTAAATTTTGGTGGGTTATTTAAAAGAAATTATAAAGGAAAAAGTCAGTA TTTCAAGTCAGGACCAGTTAGATGATTCACTTTTTGCGAGCAGCAGATTAGTTCCAAAGCCTTGAAAATAAATGAAAGTGA-3' (SEQ ID NO: 37).
[0175] In the examples described below, when transfecting cells with siRNA, siRNA conjugates, or siRNA or siRNA conjugates targeting the DGAT2 gene, Lipofectamine 2000 (purchased from Invitrogen) was used as the transfection reagent, and the specific operation was performed according to the manufacturer's instructions. For qPCR detection, HiScript III RT SuperMix for qPCR (purchased from Vazyme) was used as the reverse transcription reagent, and the specific operation was performed according to the manufacturer's instructions.
[0176] Unless otherwise specified, all reagent ratios provided below are calculated on a volume ratio (v / v).
[0177] Example 1: A siRNA for inhibiting DGAT2
[0178] This embodiment provides an siRNA for inhibiting DGAT2, the nucleotide sequence of which is designed based on the target mRNA, as shown in Table 1.
[0179] Table 1. Nucleotide sequences of siRNAs that inhibit DGAT2
[0180]
[0181]
[0182] Experimental Example 1: Detection of the on-target activity of unmodified siRNA used to inhibit DGAT2
[0183] This experimental example provides an assay for detecting the on-target activity of unmodified siRNA used to inhibit DGAT2. A plasmid vector, psiCHECK2, was constructed for the assay. psiCHECK2 is a plasmid vector that monitors changes in the expression of a target gene fused with a reporter gene. This vector uses Renal luciferase as the primary reporter gene. The target fragment is cloned into the multiple cloning site downstream of the translation stop codon of Renal luciferase. The synthesized siRNA triggers an RNAi process targeting the target gene, leading to the cleavage and subsequent degradation of the fusion mRNA. By detecting changes in Renal luciferase activity, the targeting relationship between the siRNA and the target gene fragment can be determined. The experimental procedure is as follows:
[0184] Step 1: Construct the detection plasmid DGAT2-psiCHECK2
[0185] Using psiCHECK TM -2(Promega TM The plasmid was constructed to detect the insertion sequence as shown in SEQ ID NO: 37. The insertion sequence was obtained by splicing the target sequence, which is completely complementary to all nucleotide sequences of the antisense strand of the siRNA shown in Table 1. A single copy of the spliced sequence was cloned into psiCHECK. TM -2 Xho I / Not I sites of plasmid were used to obtain detection plasmid DGAT2-psiCHECK2;
[0186] Step 2: Cell Culture and Transfection
[0187] Add 5 μL of siRNA to each well of a 96-well plate, 12.5 μL of Opti-MEM containing 20 ng FGL1-psiCHECK2 detection plasmid to each well, 32.5 μL of Opti-MEM (Gibco) to each well, and 0.3 μL of Lipofectamine 2000 (Invitrogen, catalog number 11668-019) to each well. Incubate at room temperature (23°C) for 15 minutes to obtain a mixture. Add 50 μL of siRNA containing 1 × 10⁻⁶ ng FGL1-psiCHECK2 detection plasmid to each well of the above mixture. 4 Two 293T cells were cultured in DMEM complete medium (purchased from Transgen Biotech, catalog number FI101-01) at 37°C for 24 h for subsequent dual-luciferase assays. Single-dose experiments were performed at a final siRNA concentration of 10 nM or 1 nM.
[0188] Step 3: Dual-luciferase assay
[0189] Dilute the 5× lysis buffer in the Dual Luciferase Assay Kit (Promega, catalog number E2940) with water to a final 1× lysis buffer. Take the cells obtained from step two, discard the supernatant, dilute each well with PBS buffer (purchased from Hyclone, catalog number SH30256.01) and wash twice. Add 50 μL of 1× lysis buffer to each well of each cell plate and lyse at room temperature (23℃) for 20 min to obtain lysed cell plates. Take 30 μL / well of lysis buffer from each lysed cell plate and add it to an opaque 96-well detection plate. Take the dual-luciferase assay kit, prepare substrate 1 and substrate 2 according to the instructions, and add 30 μL of each substrate to each well of the opaque 96-well detection plate. After each addition of substrate, use a multi-mode microplate reader to detect the values of firefly luciferase and Renilla luciferase.
[0190] The luminescence ratio of each well in the ELISA plate was calculated as Renilla / Firefly. The luminescence ratio of each test group or control group was the average of the luminescence ratios of the three culture wells. Using the control group's luminescence ratio as a baseline, the luminescence ratios of each test group were normalized to obtain the ratio R of luminescence ratio (test) / luminescence ratio (control), which represents the expression level of the Renilla reporter gene, i.e., its relative residual activity. The inhibition rate of siRNA was (1-R)×100%.
[0191] The NC group consisted of negative control siRNAs that were not related to DGAT2.
[0192] The target activity results of the 18 siRNAs are shown in Table 2, which shows that all 18 siRNAs have high inhibitory activity.
[0193] Table 2. Target activity of siRNA
[0194]
[0195] Example 2: A modified siRNA for inhibiting DGAT2
[0196] This embodiment provides a modified siRNA for inhibiting DGAT2, wherein the modified siRNA includes RD34DG004, RD34DG005, RD34DG008, RD34DG09, RD34DG011 and RD34DG012.
[0197] The sense strands of RD34DG005, RD34DG011, and RD34DG012 were obtained by chemically modifying the sequences shown in SEQ ID NO. 9, SEQ ID NO. 21, and SEQ ID NO. 23, respectively. Following the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and positions 2 and 3, are nucleotides linked by a thiophosphate group; the nucleotides at positions 1, 2, 3, 4, 5, 6, 7, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 are methoxylated nucleotides; and the nucleotides at positions 9, 10, and 11 are fluorinated nucleotides. The antisense strands of RD34DG005, RD34DG011, and RD34DG012 were obtained by chemically modifying the sequences shown in SEQ ID NO. 10, SEQ ID NO. 21, and SEQ ID NO. 23, respectively. The sequence shown in NO.24, after chemical modification, shows that, in the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, 2 and 3, 21 and 22, and 22 and 23 are nucleotides linked by thiophosphate groups; the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, 23, and 24 are methoxylated nucleotides; and the nucleotides at positions 2, 6, 14, and 16 are fluorinated nucleotides; or...
[0198] The sense strands of RD34DG004, RD34DG008, and RD34DG09 are obtained by chemically modifying sequences selected from SEQ ID NO. 7, SEQ ID NO. 15, and SEQ ID NO. 17, respectively. The nucleotides at positions 1 and 2, and positions 2 and 3, are linked by phosphate thioester groups, with positions 1, 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 being methoxylated nucleotides, and positions 7, 8, and 9 being fluorinated nucleotides. The antisense strands of RD34DG004, RD34DG008, and RD34DG09 are obtained by chemically modifying sequences selected from SEQ ID NO. 8, SEQ ID NO. 16, and SEQ ID NO. 17, respectively. The sequence shown in NO.18, after chemical modification, has nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 linked by thiophosphate groups, in the direction from the 5' end to the 3' end. Nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxylated nucleotides, and nucleotides at positions 2, 6, 14, and 16 are fluorinated nucleotides.
[0199] Experimental Example 2: Detection of the on-target activity of modified siRNA used to inhibit DGAT2
[0200] This experimental example provides an on-target activity assay for modified siRNAs used to inhibit DGAT2. Based on Example 1, steps one through three are retained, and the 18 siRNAs described in Example 1 in step two are replaced with the 6 modified siRNAs described in Example 2: the sense strand of RD34DG004 is obtained by chemically modifying the sequence shown in SEQ ID NO.7, and the antisense strand is obtained by chemically modifying the sequence shown in SEQ ID NO.8; the sense strand of RD34DG005 is obtained by chemically modifying the sequence shown in SEQ ID NO.9, and the antisense strand is obtained by chemically modifying the sequence shown in SEQ ID NO.10; the sense strand of RD34DG008 is obtained by chemically modifying the sequence shown in SEQ ID NO.15, and the antisense strand is obtained by chemically modifying the sequence shown in SEQ ID NO.16.
[0201] The positive strand of RD34DG009 was obtained by chemically modifying the sequence shown in SEQ ID NO.17, and the antisense strand was obtained by chemically modifying the sequence shown in SEQ ID NO.18; the positive strand of RD34DG011 was obtained by chemically modifying the sequence shown in SEQ ID NO.21, and the antisense strand was obtained by chemically modifying the sequence shown in SEQ ID NO.22; the positive strand of RD34DG012 was obtained by chemically modifying the sequence shown in SEQ ID NO.23, and the antisense strand was obtained by chemically modifying the sequence shown in SEQ ID NO.24.
[0202] The NC group consisted of a negative control siRNA unrelated to DGAT2, with the following positive strand (5'-3'): CfsAmsCfUmUfAmCfGmCfUmGfAmGfUmAfCmUfUmCfGmAf and the following negative strand (5'-3'): UmsCfsGmAfAmGfUmAfCmUfCmAfGmCfGmUfAmAfGmUfGmsAfsUm.
[0203] The target activity results of the six modified siRNAs are shown in Table 3. It can be seen that the modified siRNAs all have high inhibitory activity, and RD34DG004 has a very good inhibitory effect at a concentration of 1 nM, with an inhibition rate of >90%.
[0204] Table 3. Target activity of modified siRNA
[0205]
[0206]
[0207] Experimental Example 3: Single-dose test of modified siRNA in mice (3 mg / kg)
[0208] This experimental example provides a single-dose trial of modified siRNA in mice at a dose level of 3 mg / kg. The experimental procedure is as follows:
[0209] Alnylam Pharmaceuticals, Inc. first reported the interfering activity of GalNAc-conjugated siRNA in mice (Nair et al., J. Am. Chem. Soc., 2014, 136, 16958-16961). Literature reports that siRNA conjugated to three GalNAc clusters exhibited good delivery activity in both in vivo and in vitro experiments. Following the preparation method described in the aforementioned literature, GalNAc was conjugated with RD34DG004, RD34DG008, RD34DG09, RD34DG011, and RD34DG012 as shown in Example 2 to obtain GalNAc-conjugated siRNAs: RD34DG004G, RD34DG008G, and RD34DG009G. G, RD34DG09G, RD34DG011G, and RD34DG012G were administered subcutaneously in three female C57BL / 6J black mice (4–6 weeks old) at a single dose of 3 mg / kg of GalNAc-conjugated siRNA, saline, or the NC control group. The NC group used a negative control siRNA unrelated to DGAT2, with the sense strand (5'–3') as follows: CfsAmsCfUmUfAmCfGmCfUmGfAmGfUmAfCmUfUmCfGmAf-GalNAc and the antisense strand (5'–3') as follows: UmsCfsGmAfAmGfUmAfCmUfCmAfGmCfGmUfAmAfGmUfGmsAfsUm.
[0210] Application requirements are shown in Table 4.
[0211] Table 4. Administration requirements for a single dose of 3 mg / kg
[0212] Experimental subjects Number of animals (rats) Target gene Dosing amount Dosing frequency Saline 3 DGAT2 3 mg / kg 1 NC 3 DGAT2 3 mg / kg 1 RD34DG004G 3 DGAT2 3 mg / kg 1 RD34DG008G 3 DGAT2 3 mg / kg 1 RD34DG009G 3 DGAT2 3 mg / kg 1 RD34DG011G 3 DGAT2 3 mg / kg 1 RD34DG012G 3 DGAT2 3 mg / kg 1
[0213] On day 7 after administration, mice were sacrificed, liver samples were collected and flash-frozen in liquid nitrogen, liver mRNA was extracted and analyzed by RT-qPCR. The RT-qPCR detection steps are as follows:
[0214] Step 1: RNA extraction
[0215] 1) Take 20 mg of mouse liver tissue, add 1 mL of Trizol Lysis Buffer (purchased from Life Technology, catalog number 410701), grind and lyse the tissue, transfer the completely dissolved mixture to an RNase-free 1.5 mL centrifuge tube; shake vigorously for about 15 seconds to fully lyse the tissue cells, and let stand at room temperature (25℃) for 5 minutes.
[0216] 2) Carefully open the tube cap and add 200 μL of chloroform (purchased from Shanghai Lingfeng Chemical Reagent Co., Ltd., catalog number 20140925); shake vigorously for 20 seconds, let stand at room temperature (25℃) for 3 minutes; centrifuge at 12000×g for 20 minutes at 4℃.
[0217] 3) After centrifugation, carefully remove the centrifuge tubes to the centrifuge tube rack, transfer the supernatant to a new 2.0 mL centrifuge tube, add 1.5 times the volume of anhydrous ethanol (purchased from Jiangsu Qiangsheng Functional Chemical Co., Ltd., product number 20210802) to the supernatant, and mix by inverting.
[0218] 4) Take a purification column with a collection tube (purchased from VWI, catalog number 11822AG0627), add 700 μL of the mixture from step 3), let stand for 2 min; centrifuge at 10000×g for 1 min at 4℃, discard the filtrate; repeat the above steps with the remaining mixture.
[0219] 5) Add 700 μL of 80% (v / v) ethanol to the purification column, centrifuge at 10000×g for 1 min at 4℃, and discard the filtrate;
[0220] 6) Add 700 μL of 80% (v / v) ethanol to the purification column, centrifuge at 10000×g for 1 min at 4℃, and discard the filtrate;
[0221] 7) Centrifuge the purification column at 4℃, 10000×g for 2 min (empty).
[0222] 8) After centrifugation, carefully remove the purification column with the collection tube (if there is liquid in the collection tube, please be careful not to splash the liquid onto the purification column), discard the collection tube, put the purification column into a new 1.5mL centrifuge tube, add 100μL LEPC water to the purification column, let it stand at room temperature (25℃) for 2min; centrifuge at 4℃, 10000×g for 1min.
[0223] 9) Collect the RNA solution from step 8) for subsequent experiments;
[0224] Step 2: RNA reverse transcription
[0225] The experimental procedure was performed using HiScript III RT SuperMix for qPCR (purchased from Novizan, catalog number R323-01) following the product instructions. A 20 μL reverse transcription reaction system was prepared according to the reverse transcription procedure in the kit instructions to reverse transcribe total RNA from cells. The reverse transcription conditions were as follows: the reverse transcription reaction system was incubated at 37°C for 15 min, then at 85°C for 5 s. 80 μL of DEPC water was added to each reverse transcription reaction system to obtain a solution containing cDNA.
[0226] Step 3: Preparation of qPCR reaction system
[0227] For each reverse transcription reaction system, take 4 μL of the above-mentioned cDNA-containing solution as a template. Using the reagents provided in the AceQ Universal SYBR qPCR MasterMix kit (purchased from Vazyme, catalog number Q511-02), prepare a 20 μL qPCR reaction system on an ice box according to Table 5. Primer 1 and Primer 2 are the PCR primer sequences for amplifying the target gene DGAT2 and the internal reference gene GAPDH, respectively (as shown in Table 6). Place each qPCR reaction system in an ABI StepOnePlus Real-Time... Amplification was performed using a three-step method on a PCR instrument. The amplification program was as follows: pre-denaturation at 95℃ for 10 min, followed by denaturation at 95℃ for 30 s, annealing at 60℃ for 30 s, and extension at 72℃ for 30 s. This denaturation, annealing, and extension process was repeated 40 times to obtain product W containing the amplified target gene DGAT2 and the internal reference gene GAPDH. Product W was then incubated sequentially at 95℃ for 15 s, 60℃ for 1 min, and 95℃ for 15 s. The melting curves of the target gene DGAT2 and the internal reference gene GAPDH in product W were collected by a real-time quantitative PCR instrument to obtain the Ct values of the target gene DGAT2 and the internal reference gene GAPDH.
[0228] Table 5. RNA amplification reaction system
[0229]
[0230]
[0231] Table 6. Primer Information
[0232]
[0233] The relative quantification of the target gene DGAT2 in each test group was performed using the comparison Ct(ΔΔCt) method, as follows:
[0234] ΔCt(test group) = Ct(target gene in test group) – Ct(internal reference gene in test group)
[0235] ΔCt(control group) = Ct(target gene in control group) – Ct(internal reference gene in control group)
[0236] ΔCt(test group) = ΔCt(test group) - ΔCt(control group average)
[0237] ΔCt(control group) = ΔCt(control group) - ΔCt(control group average)
[0238] Wherein, ΔCt (control group mean) is the arithmetic mean of ΔCt (control group) of the four samples in the control group; thus, each sample in the test group and the control group corresponds to a ΔCt value.
[0239] Using the control group as a baseline, the expression level of DGAT2 mRNA in the test group was normalized, and the expression level of DGAT2 mRNA in the control group was defined as 100%.
[0240] The relative expression level of DGAT2 mRNA in the test group was 2. -ΔΔCt(测试组) ×100%
[0241] The DGAT2 mRNA level was compared with the internal reference gene GAPDH, and the value was normalized to the mean of the saline control group. The data were expressed as a percentage relative to the saline control group and presented as the mean plus the standard deviation.
[0242] See results Figure 1 In mice with a single dose, RD34DG004G showed greater than 80% inhibition at a dose of 3 mg / kg, and RD34DG011G.2 showed greater than 90% inhibition.
[0243] Example 3: A modified siRNA for inhibiting DGAT2
[0244] This embodiment provides a modified siRNA for inhibiting DGAT2, wherein the modified siRNA includes RD34DG004LNA1, RD34DG004MOE1, RD34DG011LNA1 and RD34DG011MOE1.
[0245] The positive strand of RD34DG011LNA1 was obtained by chemically modifying the sequence shown in SEQ ID NO.21. In the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and positions 2 and 3 are nucleotides linked by a thiophosphate group. The nucleotides at positions 2, 3, 4, 5, 6, 7, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 are methoxylated nucleotides. The nucleotides at positions 9, 10, and 11 are fluorinated nucleotides. The nucleotide at position 1 is an LNA-modified nucleotide. The antisense strands of RD34DG011LNA1 were obtained by chemically modifying the sequence shown in SEQ ID NO.22. Following the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, 2 and 3, 21 and 22, and 22 and 23 are nucleotides linked by a thiophosphate group. The nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, 23, and 24 are methoxylated nucleotides, and the nucleotides at positions 2, 6, 14, and 16 are fluorinated nucleotides.
[0246] The positive strands of RD34DG011MOE1 were obtained by chemically modifying the sequence shown in SEQ ID NO.21. In the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and positions 2 and 3 are nucleotides linked by a thiophosphate group. The nucleotides at positions 2, 3, 4, 5, 6, 7, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides. The nucleotides at positions 9, 10, and 11 are fluorinated nucleotides. The nucleotide at position 1 is a nucleotide modified with 2'-O-methoxyethyl (2'-MOE). The antisense strands of RD34DG011MOE are obtained by chemically modifying the sequence shown in SEQ ID NO.22. Following the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, 2 and 3, 21 and 22, and 22 and 23 are nucleotides linked by a thiophosphate group. The nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, 23, and 24 are methoxylated nucleotides, and the nucleotides at positions 2, 6, 14, and 16 are fluorinated nucleotides.
[0247] The positive strand of RD34DG004LNA1 is obtained by chemically modifying the sequence selected from SEQ ID NO.7. The nucleotides at positions 1 and 2, and positions 2 and 3 are linked by thiophosphate groups in the direction from the 5' end to the 3' end. The nucleotides at positions 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 are methoxylated nucleotides, the nucleotides at positions 7, 8, and 9 are fluorinated nucleotides, and the nucleotide at position 1 is an LNA-modified nucleotide. The antisense strands of RD34DG004LNA1 are obtained by chemically modifying the sequence selected from SEQ ID NO.8. The nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups in the direction from the 5' end to the 3' end. The nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxylated nucleotides, and the nucleotides at positions 2, 6, 14, and 16 are fluorinated nucleotides.
[0248] The positive strand of RD34DG004MOE1 is obtained by chemically modifying the sequence selected from SEQ ID NO.7. The nucleotides at positions 1 and 2, and positions 2 and 3 are linked by thiophosphate groups in the direction from the 5' end to the 3' end. The nucleotides at positions 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 are methoxy-modified nucleotides. The nucleotides at positions 7, 8, and 9 are fluorinated nucleotides. The nucleotide at position 1 is a nucleotide modified with 2'-O-methoxyethyl (2'-MOE). The antisense strands of RD34DG004LNA1 are obtained by chemically modifying the sequence selected from SEQ ID NO.8. The nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups in the direction from the 5' end to the 3' end. The nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxylated nucleotides, and the nucleotides at positions 2, 6, 14, and 16 are fluorinated nucleotides.
[0249] Experimental Example 4: Single-dose test of modified siRNA in mice
[0250] This experimental example provides a single-dose trial of modified siRNA in mice at a dose level of 3 mg / kg. The experimental procedure is as follows:
[0251] Based on the results of Experiment 3, GalNAc-conjugated siRNAs RD34DG004G and RD34DG011G, as shown in Example 2, were obtained by conjugating GalNAc with D34DG004G and RD34DG011G. GalNAc-conjugated siRNAs RD34DG004LNA1, RD34DG004MOE1, RD34DG011LNA1, and RD34DG011MOE1, as shown in Example 3, were obtained by conjugating GalNAc with RD34DG004LNA1, RD34DG004MOE1, and RD34DG011MOE1. GalNAc-conjugated siRNA (3 mg / kg) was administered subcutaneously to three female C57BL / 6J mice (6–8 weeks old) in each group, along with either the control group (saline group) or the control group. On day 10 or 17 after administration, the mice were sacrificed, liver samples were collected and flash-frozen in liquid nitrogen, liver mRNA was extracted and analyzed by RT-qPCR.
[0252] The results are as follows Figure 2 and Figure 3 As shown, RD34DG004 and RD34DG011 both exhibited significant inhibitory effects in mice after a single dose. RD34DG011 showed an inhibition rate greater than 90% on day 10 and maintained an inhibitory effect of greater than 60% after day 17. Furthermore, it was found that adding MOE or LNA modification to the 5' end of the sense strand improved the inhibitory effect to some extent.
[0253] Example 4: A modified siRNA for inhibiting DGAT2
[0254] This embodiment provides a modified siRNA for inhibiting DGAT2, wherein the modified siRNA includes DG1104-3, DG1104-4 and DG1104-5.
[0255] In this embodiment, the positive chain of DG1104-3 is DG-M-SS-3, which is the 3' end of the positive chain of RD34DG004 in Example 2 coupled to UUU, and the other side of UUU is connected to the 5' end of the positive chain of RD34DG011. The negative chain of DG1104-3 is the negative chain of RD34DG004 and the negative chain of RD34DG011 in Example 2.
[0256] The positive chain of DG1104-4 is DG-M-SS-4, which is the 3' end of the positive chain of RD34DG004 in Example 2 coupled to dTdTdT, and the other side of dTdTdT is connected to the 5' end of the positive chain of RD34DG011. The negative chain of DG1104-4 is the negative chain of RD34DG004 and the negative chain of RD34DG011 in Example 2.
[0257] The positive chain of DG1104-5 is DG-M-SS-5, where DG-M-SS-5 is the 3' end of the positive chain of RD34DG004 in Example 2 coupled to dTdTUUUdTdTdT, and the other side of dTdTUUUdTdTdT is connected to the 5' end of the positive chain of RD34DG011. The negative chain of DG1104-5 is the negative chain of RD34DG004 and the negative chain of RD34DG011 in Example 2.
[0258] All of the above siRNAs have GalNAc coupled to the 3' end of the positive strand. The sequences of DG-M-SS-3, DG-M-SS-4, and DG-M-SS-5 are shown in Table 7.
[0259] Table 7. Sequence Information
[0260]
[0261] Experimental Example 5: Experiments with modified siRNA in mice
[0262] This experiment demonstrates a single-dose assay of the modified siRNA in mice at a dose level of 3 mg / kg. The experimental procedures are the same as in Experiments 2 and 4.
[0263] Three female C57BL / 6J mice (6–8 weeks old) in each group were subcutaneously administered a single dose of 3 mg / kg of GalNAc-conjugated siRNA, saline, or NC control. On day 14 after administration, the mice were sacrificed, liver samples were collected and flash-frozen in liquid nitrogen, liver mRNA was extracted and analyzed by RT-qPCR.
[0264] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
Claims
1. A siRNA for inhibiting DGAT2, characterized in that, The siRNA contains a sense strand and an antisense strand, wherein the sense strand is at least partially anti-complementary to the antisense strand to form a double-stranded region. Wherein, the sense strand comprises the nucleotide sequence shown in SEQ ID NO.7, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.8, or, The sense strand comprises a nucleotide sequence as shown in SEQ ID NO.21, and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO.
22.
2. The siRNA as described in claim 1, characterized in that, At least one nucleotide in the sense or antisense strand of the siRNA is a modified nucleotide.
3. The siRNA as described in claim 2, characterized in that, The modification is a chemical modification, and the chemical modification is selected from one or more of the following: methoxy modification, fluorination modification, thiophosphate modification, LNA modification, and methoxyethyl modification.
4. The siRNA according to any one of claims 2 to 3, characterized in that, The fluorinated nucleotides are located in both the antisense and sense strands of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 9, 10, and 11 of the sense strand are fluorinated nucleotides, and at least the nucleotides at positions 2, 6, 14, and 16 of the antisense strand are fluorinated nucleotides; or, The fluorinated nucleotides are located in the antisense and sense strands of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the 7th, 8th, and 9th nucleotides of the sense strand are fluorinated nucleotides, and at least the 2nd, 6th, 14th, and 16th nucleotides of the antisense strand are fluorinated nucleotides.
5. The siRNA according to any one of claims 2 to 3, characterized in that, The methoxylated nucleotides are located in both the antisense and sense strands of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 2, 3, 4, 5, 6, 7, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 of the sense strand are methoxylated nucleotides; and at least the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, and 23 of the antisense strand are methoxylated nucleotides; or, The methoxylated nucleotides are located in the antisense and sense strands of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 of the sense strand are methoxylated nucleotides, and at least the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 of the antisense strand are methoxylated nucleotides.
6. The siRNA according to any one of claims 2 to 3, characterized in that, The phosphate-thioester linked nucleotides are located in both the antisense and sense strands of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 1 and 2, and 2 and 3 of the sense strand are linked by phosphate-thioester groups, and at least the nucleotides at positions 1 and 2, 2 and 3, 21 and 22, and 22 and 23 of the antisense strand are linked by phosphate-thioester groups; or, The nucleotides linked by the thiophosphate group are located in the antisense and sense strands of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 1 and 2, and positions 2 and 3 of the sense strand are linked by thiophosphate groups, and at least the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 of the antisense strand are linked by thiophosphate groups.
7. The siRNA according to any one of claims 2 to 3, characterized in that, The methoxyethyl-modified nucleotide is located in the positive strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the first nucleotide of the positive strand is a methoxyethyl-modified nucleotide.
8. The siRNA according to any one of claims 2 to 3, characterized in that, The LNA-modified nucleotide is located in the positive strand of the nucleotide sequence, and, in the direction from the 5' end to the 3' end, at least the first nucleotide of the positive strand is an LNA-modified nucleotide.
9. The siRNA according to claims 2-3, characterized in that, The siRNA has a ligand coupled to the 3' end of the positive strand, and the ligand is GalNAc.
10. A product for inhibiting DGAT2, characterized in that, The product comprises an active ingredient and a pharmaceutically acceptable carrier, wherein the active ingredient is siRNA as described in any one of claims 1 to 9.
11. The product as described in claim 10, characterized in that, The product is a pharmaceutical composition or a reagent kit.
12. The use of the siRNA of any one of claims 1 to 9 or the product of any one of claims 10 to 11 in the preparation of products for the prevention, diagnosis and / or treatment of pathological conditions or diseases caused by DGAT2.
Citation Information
Patent Citations
PCSK9 iRNA Composition and Its Application Method
CN108220295B
Oligonucleotide-ligand conjugates and process for their preparation
WO2015006740A2