Brown planthopper chitin deacetylase CDA and application thereof

Abstract

The invention provides application of brown planthopper chitin deacetylase CDA, and belongs to the field of gene engineering. According to the dsRNA preparation of the NlCDA gene provided by the invention, the dsRNA preparation is introduced into a brown planthopper body, so that the brown planthopper can be effectively killed and prevented from damaging rice. The nilaparvata lugens insecticide is specifically used for nilaparvata lugens, is harmless to mammals, fishes and shrimps, natural enemy insects and pollination insects, and has the advantages of quick effect, high fatality rate, environment friendliness and the like.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering, specifically to the control and application of chitin deacetylase (CDA) genes associated with brown planthoppers. More specifically, this invention relates to a double-stranded RNA (dsRNA) for synthesizing a specific inhibitor of the brown planthopper chitin deacetylase CDA, and a method for introducing the dsRNA into the brown planthopper. Furthermore, this invention also relates to the application of the CDA gene in the prevention and control of brown planthopper-related diseases and pests. Background Technology

[0002] Brown planthopper ( Nilaparvata lugens Brown planthoppers are common piercing-sucking pests on rice plants. They are monophagous, sucking sap from the phloem of rice plants to obtain nutrients. Continuous feeding by brown planthoppers leaves brown scars and spots on rice plants, and in severe cases, can cause plant death and lodging, leading to significant yield reduction or even crop failure. Furthermore, brown planthoppers can transmit various viruses, exacerbating the spread of crop diseases. Currently, chemical pesticides are widely used for the control of brown planthoppers. However, the long-term and excessive use of chemical pesticides has caused environmental problems, led to pesticide resistance in brown planthoppers, weakened the effectiveness of traditional control methods, and hindered sustainable agricultural development. Therefore, it is essential to develop new brown planthopper control technologies to address the problems caused by the current overuse of chemical pesticides.

[0003] In recent years, RNA interference (RNAi) technology has attracted much attention in life science research. This technology introduces small double-stranded RNA to specifically degrade or inhibit the mRNA expression of target genes, thereby suppressing or shutting down specific genes. RNAi technology boasts advantages such as high specificity, high efficiency, and ease of operation. Currently, this technology is widely used in the control of various agricultural pests, where specific dsRNAs are introduced into insects to disable specific functions, thus controlling pests. In the case of brown planthoppers, researchers have already used RNAi technology to conduct related functional studies. For example, Gao et al. (2023) studied the regulatory role of the brown planthopper salivary protein NlG14 in oviposition and the insulin signaling pathway. Additionally, Jiang et al. (2023) found that the estrogen-related receptor gene is highly expressed in the midgut of brown planthoppers, and that downregulating this gene through RNAi interference leads to dysregulation of juvenile hormone and ecdysone signaling. However, most of these studies remain at the stage of mechanistic exploration, and their applications are still insufficient. Currently, there is a lack of more effective and environmentally friendly technologies for the control of brown planthopper pests. The inventors have for the first time determined that feeding on plants containing insect-resistant genes... Bph1The brown planthopper transcriptome (WAN et al, 2021), the present application identifies the CDA gene of the brown planthopper on this basis, and provides sequence and data basis for the control of the brown planthopper by establishing the RNA interference system of the brown planthopper and the mutant of the CDA gene of the brown planthopper. SUMMARY

[0004] The present application clones part of the sequence of the chitin deacetylase of the brown planthopper, obtains the dsRNA of the NlCDA gene by the in vitro synthesis method, and introduces it into the body of the brown planthopper. Interfering with the NlCDA gene can significantly reduce the survival rate of the brown planthopper on the rice plant, so as to achieve the purpose of preventing and controlling the brown planthopper. NlCDA

[0005] In one aspect, the present application relates to a chitin deacetylase gene of the brown planthopper, the nucleotide sequence of which is as shown in SEQ ID NO. 1 or a nucleotide having at least 75% sequence identity with SEQ ID NO: 1 or consisting of the same; NlCDA

[0006] In another aspect, the present application relates to a chitin deacetylase gene of the brown planthopper, the amino acid sequence of which is the amino acid encoded by SEQ ID NO. 1 or an amino acid having at least 75% sequence identity with the amino acid encoded by SEQ ID NO: 1 or consisting of the same; NlCDA

[0007] In another aspect, the present application further relates to a cloning method of the gene, the steps of which comprise: NlCDA

[0008] (1) Taking the nymph or adult of the brown planthopper, extracting the total RNA by the Trizol method, and synthesizing the first strand of cDNA by using the total RNA of the brown planthopper as the template;

[0009] (2) Taking the first strand of cDNA of the brown planthopper as the template, performing PCR amplification by using the upstream primer with the sequence as shown in SEQ ID NO. 2 and the downstream primer with the sequence as shown in SEQ ID NO. 3, and obtaining the PCR amplification product containing the gene fragment sequence as shown in SEQ ID NO: 4;

[0010] (3) Connecting the gene fragment obtained by the above amplification to the cloning vector, and then transforming into the E. coli TG1, culturing on the LB solid culture medium containing ampicillin, and obtaining the single clone colony containing the target gene;

[0011] (4) Transferring the single clone colony to the LB liquid culture medium containing ampicillin for large-scale culture, and then extracting the plasmid containing the target gene;

[0012] ​​​​(5) using the plasmid as a template, using an upstream primer with a sequence as shown in SEQ ID NO. 5 and a downstream primer with a sequence as shown in SEQ ID NO. 6 to perform PCR amplification, to obtain a large amount of single gene fragment containing a T7 promoter;

[0013] In another aspect, the present application relates to a dsRNA synthesis method of the CDA gene, and the specific steps include:

[0014] (1) using the gene fragment obtained by PCR amplification as a DNA template to synically dsRNA, and the reaction system is: 2 μl ATP solution, 2 μl UTP solution, 2 μl CTP solution, 2 μl GTP solution, 2 μl T7 enzyme mix, 1 μg DNA template, and the rest is filled with RNase-free water to 20 μl. After mixing, centrifuging slightly, and placing in a PCR instrument, 37℃ reaction overnight;

[0015] (2) adding 5 μl 10×T7 Reaction Buffer, 2 μl DNase, 2 μl RNase to the reaction system, and filling the rest with RNase-free water to 50 μl, to eliminate DNA in the reaction system;

[0016] (3) denaturing the sample after reaction at 65℃ for 5 min, and then centrifuging at 12,000 rpm for 5 min at 4℃ to remove impurities;

[0017] (4) using a Nanodrop instrument to determine the concentration of dsRNA, and determining the quality of dsRNA by performing 1% agarose gel electrophoresis.

[0018] In another aspect, the present application also relates to a method for introducing dsNlCDA into the brown planthopper, comprising:

[0019] (1) loading the prepared dsNlCDA into a glass capillary tube;

[0020] (2) using a microinjection method to introduce the dsNlCDA into the brown planthopper;

[0021] (3) after the brown planthopper wakes up, transferring it to a cage planted with rice plants.

[0022] In another aspect, the present application also relates to a method for detecting the silencing efficiency of the NlCDA gene, and the specific steps include:

[0023] (1) extracting RNA from the brown planthopper treated with dsRNA, and then performing reverse transcription to obtain cDNA of the brown planthopper;

[0024] (2) The expression level of the NlCDA gene in the sample was detected using quantitative PCR.

[0025] (3) Utilize 2 -ΔΔCt The relative expression level of the CDA gene in brown planthoppers was calculated using a method to compare the differences between different treatment groups.

[0026] On the other hand, the present invention also relates to a dsRNA that specifically inhibits CDA gene expression, which is synthesized by the aforementioned method;

[0027] In some embodiments, the present invention also relates to an in vitro cell containing the dsRNA;

[0028] In some embodiments, the present invention also relates to a pharmaceutical composition comprising the dsRNA and a pharmaceutically acceptable carrier;

[0029] In some embodiments, the present invention also relates to the use of the dsRNA and related pharmaceutical compositions for the preparation of insecticides;

[0030] On the other hand, the present invention also relates to a method for controlling brown planthoppers, characterized in that the dsRNA or a pharmaceutical composition or insecticide containing dsRNA is delivered into the brown planthopper.

[0031] The present invention has achieved at least the following beneficial effects:

[0032] This invention identifies the CDA gene for the first time, verifies its function through experimental evidence, and obtains the dsRNA of the NlCDA gene. Introducing this dsRNA into the brown planthopper to silence the NlCDA gene significantly reduces the survival rate of the brown planthopper on rice plants. This invention clarifies the important role of the NlCDA gene in the basic life activities of the brown planthopper, providing a theoretical basis and practical strategies for the control of the brown planthopper and the breeding of insect-resistant rice varieties. Attached Figure Description

[0033] Figure 1 Experimental results of PCR amplification of NlCDA fragment (2865bp).

[0034] Figure 2 Experimental results of NlCDA gene dsRNA synthesis.

[0035] Figure 3 Results of experiments on the silencing efficiency of introducing dsRNA of the NlCDA gene into brown planthopper.

[0036] Figure 4 Survival data of NlCDA gene dsRNA introduced into brown planthopper.

[0037] Example 1: Cloning of the NlCDA gene fragment of the brown planthopper.

[0038] 1. Amplification of the NlCDA gene fragment in the brown planthopper

[0039] (1) Take adult or nymph brown planthoppers and grind them thoroughly in 1 ml Trizol (Invitrogen); then add 400 µl chloroform and mix vigorously, centrifuge at 12,000 rpm at 4℃ for 15 min, carefully aspirate the top aqueous phase and transfer it to a new centrifuge tube; add an equal volume of isopropanol, mix well and let stand at room temperature for 10 min; then centrifuge at 12,000 rpm for 10 min, discard the supernatant and add 1 ml of 75% ethanol to the precipitate; centrifuge at 9600 rpm at 4℃ for 5 min and discard the supernatant, and add an appropriate amount of RNase-free water to the precipitate; determine the RNA concentration using NanoDrop;

[0040] (2) Reverse transcription of total RNA extracted from brown planthoppers was performed using the ReverTra Ace kit: First, the total RNA and Oligo(dT) were mixed. 20 Mix well, denature at 65°C for 5 min, and immediately place on ice; add 5 µl 5×RT buffer, 2 µl dNTP mixture, 1 µl RNase inhibitor, and 1 µl ReverTra Ace to the denatured RNA solution, and bring the volume to 20 µl with RNase-free water; mix well and incubate at 42°C for 20 min, and finally denature at 99°C for 5 min to inactivate reverse transcriptase and obtain brown planthopper cDNA;

[0041] (3) Primers were designed based on the full-length NlCDA gene sequence as shown in Table 1. The primers were synthesized by Hangzhou Youkang Biotechnology Co., Ltd.

[0042] Table 1

[0043] surface Primer Primer sequence NlCAD-F CGTGCGGTCGCTCAGTGT SEQ ID NO. 2 NlCAD-F ATCGCTCTAAGCCGTACC SEQ ID NO. 3

[0044] (4) Using brown planthopper cDNA as a template, the target gene was amplified by PCR using the primers shown in Table 1. The specific amplification system was as follows: 25 µl KOD One PCR Master Mix, 1.5 µl each of upstream and downstream primers, 2 µl brown planthopper cDNA template, and finally, ddH2O was added to bring the total volume to 50 µl. The PCR amplification conditions were: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 15 s, 58℃ annealing for 5 s, 72℃ extension for 40 s; 72℃ for 10 min. The denaturation, annealing, and extension programs were repeated 35 times.

[0045] 2. Obtaining monoclonal strains of the NlCDA gene from brown planthoppers.

[0046] (1) Separation of PCR products using 1% agarose gel electrophoresis ( Figure 1 ), and cut the desired segment with a blade;

[0047] (2) DNA was recovered using a DNA agarose gel extraction kit (Shanghai Sangon Biotech, catalog number: SK8131): the agarose containing the target fragment was cut from the agarose gel and placed in a centrifuge tube; 5 volumes of gel dissolving buffer B2 were added and the mixture was incubated at 70°C for 10 min; the dissolved gel solution was added to the adsorption column and centrifuged at 8,000g for 30 s, and the waste liquid was discarded; 500 µl of wash solution was added and centrifuged at 9,000g for 30 s, and the waste liquid was discarded; the empty adsorption column was centrifuged at 9,000g for 1 min; the adsorption column was placed in a new centrifuge tube and 30 µl of ddH2O was added to the center of the adsorption column; the column was centrifuged at 10,000g for 2 min, and the purified NlCDA gene DNA fragment of the brown planthopper was finally obtained.

[0048] (3) The DNA fragment of the NlCDA gene of brown planthopper was ligated into the pEASY-T3 vector using the sticky end cloning kit (Beijing TransGen Biotech Co., Ltd.): 1 µl of the NlCDA gene DNA fragment of brown planthopper and 1 µl of T3 vector were added to a 0.2 ml centrifuge tube in sequence. After mixing the sample, it was reacted at 25 °C for 30 min.

[0049] (4) Add the ligation product to the thawed TransT1 competent cells, gently tap the tube wall with your hand, and incubate on ice for 30 min; transfer the centrifuge tube to a 42℃ water bath for 30 s, remove it and place it on ice for 2 min; add 500 μl of antibiotic-free LB medium to the centrifuge tube, and incubate at 37℃ for 1 hour at 200 rpm; take 100-200 μl of bacterial culture and spread it on LB plates containing ampicillin resistance.

[0050] (5) Pick a single colony and add it to 1 ml of LB liquid medium containing ampicillin resistance. Shake at 200 rpm for 12 hours. Perform colony PCR on the bacterial culture. The reaction system is as follows: 12.5 μl of 2× Max Buffer, 0.5 μl of dNTP Mix (10 mM each), 0.5 μl of Max Super-Fidelity DNA Polymerase, 0.5 μl each of forward and reverse primers, 1 μl of bacterial culture, and finally add ddH2O to make up to 25 μl. The PCR amplification conditions are: 95℃ for 3 min; 95℃ for 15 seconds, 60℃ for 1 min, 35 cycles; 72℃ for 10 min.

[0051] (6) The PCR products were separated by 1% agarose gel electrophoresis, recombinant clones were selected, and sent to Hangzhou Youkang Biotechnology Co., Ltd. for sequencing. A 2,685 bp NlCDA sequence of the brown planthopper was obtained, as shown in SEQ ID NO:4. This sequence is an NlCDA sequence fragment designed based on the full length and has been confirmed by Sanger sequencing. It is used for RNAi template synthesis.

[0052] Example 2: dsRNA synthesis of the NlCDA gene in brown planthopper.

[0053] 1. T7 primer PCR amplification and purification.

[0054] (1) Using recombinant plasmids or bacterial cultures containing the NlCDA gene as templates, the target gene was amplified using primers with the T7 promoter sequence (shown in Table 2). The primers were synthesized by Hangzhou Youkang Biotechnology Co., Ltd. The specific amplification system was as follows: 25 µl KODOne PCR Master Mix, 1.5 µl each of upstream and downstream primers, 2 µl of brown planthopper cDNA template, and finally, ddH2O was added to bring the total volume to 50 µl. The PCR amplification conditions were: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 15 s, 58℃ annealing for 5 s, 72℃ extension for 40 s; 72℃ extension for 10 min. The denaturation, annealing, and extension programs were repeated 35 times.

[0055] Table 2

[0056] surface Primer Primer sequence NlCAD-F TAATACGACTCACTATAGGGAGATTATCGTGTGCACTGTGGGC SEQ ID NO. 5 NlCAD-F TAATACGACTCACTATAGGGAGATCACTGTGGCGCTCTCTATG SEQ ID NO. 6

[0057] (2) The amplification products were separated by agarose gel electrophoresis and recovered by DNA agarose gel recovery kit, finally obtaining a large number of single NlCDA gene fragments containing the T7 promoter.

[0058] 2. Synthesis and purification of dsRNA.

[0059] The dsRNA of the NlCDA gene was synthesized and purified using the Invitrogen MEGAscript RNAi Kit (AM1626), as follows:

[0060] (1) Using the NlCDA gene fragment obtained by PCR amplification as a DNA template, dsRNA was synthesized. The reaction system was: 2 μl 10×T7 Reaction Buffer, 2 μl ATP solution, 2 μl UTP solution, 2 μl CTP solution, 2 μl GTP solution, 2 μl T7 enzyme mix, 1 μg DNA template, and RNase-free water was added to make up to 20 μl. After the reaction system was prepared, it was mixed and reacted overnight at 37°C.

[0061] (2) Add 5 μl of 10×T7 Reaction Buffe, 2 μl of DNase, and 2 μl of RNase to the reaction system, and make up to 50 μl with RNase-free water to eliminate DNA in the reaction system;

[0062] (3) Place the reaction solution in a centrifuge tube and centrifuge for 2 min, then add 500 μl wash solution and centrifuge for 2 min, then incubate with 50 μl Elution solution at 65℃ for 2 min and centrifuge for 2 min;

[0063] (4) The concentration of dsRNA was determined by Nanodrop, and the quality of dsRNA was determined by 1% agarose gel electrophoresis. Figure 2 );

[0064] (5) Store the dsRNA of the NlCDA gene at 80℃ for later use.

[0065] Example 3: The effect of introducing dsRNA of the NlCDA gene into brown planthopper on insect survival rate.

[0066] The dsRNA of the NlCDA gene was introduced into the brown planthopper using microinjection. The specific method is as follows:

[0067] (1) Collect brown planthopper nymphs. Anesthetize them with CO2 for 10 seconds;

[0068] (2) Use a capillary puller (P-97, Sutter Instrument) to pull the glass capillary (Sarasota) to the appropriate size. The program parameters are set as follows: heat=503, pull=40, vel,35, time=10.

[0069] (3) The dsRNA of the GFP and NlCDA genes were injected into the glass capillary tubes using the micro-pipette (Eppendorf);

[0070] (4) Install the glass capillary tube containing the sample into a microinjector (Eppendorf) and introduce dsRNA into the brown planthopper under a stereomicroscope. The microinjector parameters are set as follows: injection pressure 1300 pah, injection time 0.3s, compensation pressure 10pah.

[0071] (5) Using the same method, the jellyfish green fluorescent protein gene ( Aequorea victoria dsRNA of green fluorescent protein (GFP) was introduced into brown planthoppers as a negative control.

[0072] (6) After the brown planthoppers that have been introduced with dsRNA have recovered, they are transferred to rice plants. 15 brown planthoppers are placed in each group of rice plants, and 6 groups are repeated. The mortality rate is counted daily. The rearing conditions for brown planthoppers are: temperature 28℃±2℃, relative humidity 80%±5%, and photoperiod of 14h:10h (day: night).

[0073] (7) Experimental results are as follows Figure 3 As shown, the survival rate of brown planthoppers (NlCDA) with introduced CDA gene dsRNA was significantly lower than that of the control (dsGFP). p The value <0.01 indicates that the CDA gene is crucial for the survival of the brown planthopper, and related dsRNAs have potential application value in the control of the brown planthopper.

[0074] Example 4: The silencing efficiency of the NlCDA gene by introducing dsRNA into brown planthopper.

[0075] Three days after introducing the dsRNA of the NlCDA gene into brown planthoppers, the planthoppers were collected, and the expression level of the NlCDA gene was measured. The specific method is as follows:

[0076] (1) The collected brown planthoppers were ground, total RNA was extracted using the Trizol method, and cDNA of the brown planthoppers was obtained by reverse transcription using the ReverTra Aceq PCR RTMaster with gDNA remover kit.

[0077] (2) Using Primer Premier 6.0 software, quantitative primers for the NlCDA gene (SEQ ID NO. 7 and SEQ ID NO. 8) and actin gene (SEQ ID NO. 9 and SEQ ID NO. 10) of the brown planthopper were designed, as shown in Table 3. The primers were synthesized by Hangzhou Youkang Biotechnology Co., Ltd.

[0078] Table 3

[0079] surface Primer Primer sequence qNlCAD-F AGCCAGACCCACTCTCAAGC SEQ ID NO. 7 qNlCAD-F SEQ ID NO. 8 qNlActin-F CCCCATCGAGCACGGTATCATCA SEQ ID NO. 9 qNlActin-R TCTGGGTCATCTTCTCACGGTTGG SEQ ID NO. 10

[0080] (3) Using cDNA from brown planthopper as a template, the expression level of the NlCDA gene in brown planthopper was determined using SYBR Green Realtime PCR Master Mix (Toyobo Biotechnology Co., Ltd.). The reaction system was prepared as follows: 9.5 μl H2O, 12.5 μl SYBR Green Realtime PCR Master Mix, 2 μl forward primer, 2 μl reverse primer, and 2.5 μl cDNA template. The following program was run on an ABI 7500 Real Time PCR System: 95℃ pre-denaturation for 60 s, 95℃ denaturation for 15 s, 60℃ annealing for 15 s, and 72℃ extension for 45 s, for a total of 40 cycles of denaturation, annealing, and extension; a negative control without RNase water was set up for each primer pair.

[0081] (4) Using the brown planthopper actin gene as an internal reference, 2 -ΔΔCt The expression level of the NlCDA gene in the brown planthopper was calculated using a method (Livak et al., 2001). t - The test is used to determine the significance of differences between different treatment groups;

[0082] (5) Experimental results are as follows Figure 4 As shown, the expression level of the NlCDA gene in brown planthoppers with introduced dsNlCDA was significantly lower than that in the control, indicating that the dsRNA targeting the CDA gene has a high silencing efficiency for the NlCDA gene in brown planthoppers.

[0083] The preferred embodiments of the present invention have been described in detail above. It should be understood that those skilled in the art can make various modifications and variations based on the concept of the present invention without inventive effort. Therefore, any technical solution that can be obtained by those skilled in the art through logical analysis, reasoning, or limited experimentation, as long as it is based on the concept of the present invention and falls within the scope of protection defined by the claims, should be included within the scope of protection of the present invention.

Claims

1. Use of a dsRNA that specifically inhibits the expression of a gene in the manufacture of a pesticide, said dsRNA being obtained by the steps of: a) providing a plant cell expressing a gene; b) isolating the gene from the plant cell; c) synthesizing a dsRNA that specifically inhibits the expression of the gene; and d) formulating the dsRNA into a pesticide. NlCDA ​ (1) Take the brown planthopper nymph, Trizol method to extract total RNA, and use the brown planthopper total RNA as a template to synthesize the first strand of cDNA; (2) Using the brown planthopper cDNA as a template, using the sequence as shown in SEQ ID NO. 2 for the upstream primer and the sequence as shown in SEQ ID NO. 3 for the downstream primer to carry out PCR amplification, to obtain the PCR amplification product containing the gene fragment sequence as shown in SEQ ID NO: 4; (3) The gene fragment obtained by amplification is connected to the cloning vector, transformed into E. coli TG1, and cultured on LB solid medium containing ampicillin to obtain a single colony containing the target gene; (4) The single colony is cultured in LB liquid medium containing ampicillin, and the plasmid containing the target gene is extracted; (5) Using the plasmid as a template, using the sequence as shown in SEQ ID NO. 5 for the upstream primer and the sequence as shown in SEQ ID NO. 6 for the downstream primer to carry out PCR amplification, to obtain a large amount of single gene fragment containing T7 promoter; (6) The gene fragment of step (5) is used as a DNA template to synthesize dsRNA, and the reaction system is: 2 μl 10×ReactionBuffer, 2 μl ATP solution, 2 μl UTP solution, 2 μl CTP solution, 2 μl GTP solution, 2 μl T7 enzyme mix, 1 μg DNA template, and use RNase-free water to make up to 20 μl. After the reaction system is mixed, react at 37℃ overnight; (7) The reaction solution is centrifuged in a centrifuge tube for 2 min, then 500 μl wash solution is added and centrifuged for 2 min; (8) The sample after reaction is denatured at 65℃ for 2 min; (9) Determine the concentration of dsRNA with Nanodrop, and determine the quality of dsRNA by 1% agarose gel electrophoresis.

2. A method for controlling the brown planthopper, characterized by, The dsRNA specifically inhibiting the expression of NlCDA gene is fed to the brown planthopper, and the dsRNA is obtained by steps (1) to (9) of claim 1.

Images