A fritillaria thunbergii cholesterol 22(r)-hydroxylase FcirCYP90B27 gene and application

Abstract

The present application relates to a kind of fritillaria cirrhosa cholesterol 22 (R) -hydroxylase FcirCYP90B27 Gene and application, belong to the field of biotechnology.Fritillaria cirrhosa cholesterol 22 (R) -hydroxylase FcirCYP90B27 Gene nucleotide sequence as shown in SEQ ID NO.1, the amino acid sequence of encoding protein as shown in SEQ ID NO.2.The fritillaria cirrhosa cholesterol 22 (R) -hydroxylase FcirCYP90B27 Gene of the present application can be used as 22 (R) -hydroxylase biosynthesis control gene, and be applied to the preparation of 22 (R) -hydroxylase cholesterol, application prospect is remarkable, easy to popularization and application.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a gene of Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 and its application. Background Technology

[0002] Fritillaria cirrhosa D. Don is a perennial herb belonging to the genus Fritillaria in the family Liliaceae. It is a well-known traditional Chinese medicine with effects such as clearing heat and moistening the lungs, resolving phlegm and relieving cough, and dispersing nodules and reducing swelling. Steroidal alkaloids are the main components of Fritillaria cirrhosa, contributing to its effects of clearing heat and resolving phlegm, moistening the lungs and relieving cough. In addition, Fritillaria cirrhosa contains other compounds such as fritillaria cirrhosa extract, fritillaria cirrhosa extract alkaloid, fritillaria cirrhosa alkaloid, and fritillaria cirrhosa extract. Steroidal alkaloids are secondary metabolites of plants, participating in the regulation of plant communication and defense. They are also the main bioactive components of some traditional Chinese medicines. For example, fritillaria cirrhosa extract isolated from Fritillaria cirrhosa is a novel anticancer drug that inhibits the proliferation of human tumor cells. However, the acquisition of steroidal alkaloids such as fritillaria cirrhosa extract mainly relies on plant extraction and chemical synthesis. Due to their low content, extraction is difficult, and their chemical structure is complex, the efficiency of chemical synthesis is also low. This leads to a shortage of fritillaria cirrhosa extract, resulting in a huge consumption of wild resources.

[0003] The rapid development of metabolic engineering has further highlighted the important role of yeast cells in the synthesis of plant secondary metabolites, providing a new pathway for the heterologous production of high-value chemical drugs. Yeast, with its advantages of rapid growth and maturation, ease of genetic manipulation, and food-grade safety, is widely used in various chemical research fields and is currently being used to synthesize terpenes and steroids. Cholesterol, as one of the earliest discovered steroids, is a direct precursor to many steroidal compounds, such as plant-derived steroidal saponins and steroidal alkaloids. Cholesterol is one of the most common compounds in plants and animals; however, its synthesis differs between them. In animals, its precursor is lanosterol, produced by lanosterol synthase (LAS) catalysis of 2,3-squalene oxide, while in plants, it is cycloartenol, produced by cycloartenol synthase (CAS), as the precursor. The C-22 hydroxylation product of cholesterol is an important intermediate in the biosynthesis of steroidal alkaloids and has therefore attracted considerable attention. Synthetic biology, as a key approach to producing pharmacodynamic monomers, can not only alleviate the scarcity of wild Fritillaria cirrhosa resources and promote the sustainable development of its industry, but also significantly increase its yield.

[0004] Therefore, overcoming the shortcomings of existing technologies is a problem that urgently needs to be solved in the field of biotechnology. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene and its application.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] The first aspect of the present invention provides a Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] The second aspect of the present invention provides a protein encoded by the above-mentioned Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene, the amino acid sequence of which is shown in SEQ ID NO.2.

[0009] A third aspect of the present invention provides a recombinant plasmid containing the above-mentioned Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene.

[0010] Furthermore, the FcirCYP90B27 gene of cholesterol 22(R)-hydroxylase from Fritillaria cirrhosa was homologously recombined with the YCplac33 vector to obtain the Y33-FcirCYP90B27 recombinant plasmid.

[0011] The fourth aspect of the present invention provides a transgenic engineered bacterium containing the recombinant plasmid, or wherein the genome of the genetically engineered bacterium is integrated with the exogenous Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene.

[0012] Furthermore, the genetically engineered bacteria are Escherichia coli DH5α strain and Cholesterol Yeast strain Vg13.

[0013] The fifth aspect of the present invention provides cholesterol 22(R)-hydroxylase encoded by the FcirCYP90B27 gene of Fritillaria cirrhosa.

[0014] The sixth aspect of this invention provides the application of the Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene in the preparation of 22(R)-hydroxy cholesterol.

[0015] Furthermore, using cholesterol as a substrate, under the catalysis of cholesterol 22(R)-hydroxylase encoded by the aforementioned Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene, a hydroxylation reaction is carried out at the C-22 position of cholesterol to generate 22(R)-hydroxy cholesterol.

[0016] The Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene described in this invention was identified from Fritillaria cirrhosa through transcriptome sequencing and bioinformatics techniques, after extensive experimental screening. RNA was extracted from Fritillaria cirrhosa using an RNA kit, reversed to cDNA, and then amplified by PCR. The amplification primers for the Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene (excluding the YCplac33 vector homologous arm sequence) are shown below:

[0017] 5'F: atggcactagagctgcttct;

[0018] 3'R:ttagttgatggcacggacct;

[0019] Furthermore, when performing homologous recombination with the YCplac33 vector, the FcirCYP90B27 gene requires amplification and recovery using primers with homologous arms. The primers with homologous arms are as follows:

[0020] 5'F: cagtcgacctcgaatctagaatggcactagagctgcttct;

[0021] 3'R: atgatgcggccctctagattagttgatggcacggacct;

[0022] The gene FcirCYP90B27, isolated and identified from Fritillaria cirrhosa, can serve as an important marker gene for molecular-assisted breeding of Fritillaria cirrhosa, and can also serve as an important candidate gene for the production of 22(R)-hydroxycholesterol in yeast chassis cell construction.

[0023] Compared with the prior art, the beneficial effects of this invention are as follows:

[0024] (1) This invention clarifies the function of the FcirCYP90B27 gene, which can hydroxylate cholesterol at the C22 position to produce 22(R)-hydroxy cholesterol, which is an important precursor in the synthesis of fritillary alkaloids. The biosynthesis of 22(R)-hydroxy cholesterol, a key precursor of steroidal alkaloids, may be a key step in the large-scale biosynthesis of fritillary alkaloids.

[0025] (2) Compared with the difficulty of direct extraction from Fritillaria cirrhosa, the present invention utilizes synthetic biology methods to not only improve the production efficiency of the required compounds, increase the yield, and reduce the production cycle, but also lay an important foundation for the complete pathway of Fritillaria cirrhosa isosteroidal alkaloid analysis.

[0026] (3) Yeast can integrate key enzyme genes of plant secondary metabolites and reconstruct complete synthetic pathways. Compared with prokaryotes (such as Escherichia coli), the yeast used in this invention has the post-translational modification system of eukaryotes, which can ensure the activity of plant-derived enzymes; its metabolic background is clear and its reproduction rate is fast, and it can be cultured on a large scale through fermentation to greatly increase the yield of secondary metabolites. Attached Figure Description

[0027] Figure 1 Diagram of the biosynthetic pathway of 22(R)-hydroxycholesterol;

[0028] Figure 2 This is a schematic diagram of the construction of the Y33-FcirCYP90B27 recombinant plasmid (used to express the gene encoding Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27).

[0029] Figure 3 Gel electrophoresis images of FcirCYP90B27 gene amplification and its recombinant vector detection; A is the gel electrophoresis image of FcirCYP90B27 gene amplification, where M: DNA Marker, Markers (from bottom to top): 100bp, 250bp, 500bp, 750bp, 1000bp, 1500bp, 2000bp, 3000bp, 5000bp; Lane 1 is the FcirCYP90B27 gene amplification band, all with a length of 1000-1500bp;

[0030] B is a PCR gel electrophoresis image of positive bacteria selected by the Y33-FcirCYP90B27 recombinant plasmid; where M: DNA Marker, Marker (from bottom to top): 100bp, 250bp, 500bp, 750bp, 1000bp, 1500bp, 2000bp, 3000bp, 5000bp; lanes 1 to 8 are 8 positive transformed colonies of the selected Y33-FcirCYP90B27 recombinant plasmid, all of which are 1000-1500bp.

[0031] Figure 4The following are LC-MS analyses of the chemical composition of the fermentation products converted from lithium acetate by Y33-FcirCYP90B27: A is the LC-MS mass spectrum, where 22(R)-hydroxycholesterol is the LC-MS peak time of the standard 22(R)-hydroxycholesterol, Vg13+Y33 is the LC-MS peak time of the empty control group, and Vg13+FcirCYP90B27 is the LC-MS peak time of the shake-flask fermentation products of the Y33-FcirCYP90B27 recombinant plasmid lithium acetate-transformed strain; B is the mass spectrum characteristic of the standard 22(R)-hydroxycholesterol; C is the mass spectrum characteristic of the shake-flask fermentation products of the Y33-FcirCYP90B27 recombinant plasmid lithium acetate-transformed strain. Detailed Implementation

[0032] The present invention will now be described in further detail with reference to the embodiments.

[0033] Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed in accordance with the techniques or conditions described in the literature in the field or according to the product instructions. Materials or equipment whose manufacturers are not specified are all conventional products that can be obtained by purchase.

[0034] The culture medium used in this invention:

[0035] LB liquid medium: 10 g / L tryptone + 5 g / L yeast extract + 10 g / L sodium chloride;

[0036] LB solid medium: 10 g / L tryptone + 5 g / L yeast extract + 10 g / L sodium chloride + 15 g / L agar powder;

[0037] SC-His-Leu-Ura Deficient Liquid Culture Medium: 6.7 g / L yeast basal nitrogen source (YNB) + 0.1 g / L arginine + 0.1 g / L cysteine ​​+ 0.1 g / L lysine + 0.1 g / L threonine + 0.05 g / L aspartic acid + 0.05 g / L isoleucine + 0.05 g / L phenylalanine + 0.05 g / L proline + 0.05 g / L serine + 0.05 g / L tyrosine + 0.05 g / L valine + 0.05 g / L methionine + 0.1 g / L tryptophan + 0.2 g / L adenine + 2% v / v glucose, pH=5.6;

[0038] SC-His-Leu-Ura Deficit Solid Medium: 6.7 g / L yeast basal nitrogen source (YNB) + 0.1 g / L arginine + 0.1 g / L cysteine ​​+ 0.1 g / L lysine + 0.1 g / L threonine + 0.05 g / L aspartic acid + 0.05 g / L isoleucine + 0.05 g / L phenylalanine + 0.05 g / L proline + 0.05 g / L serine + 0.05 g / L tyrosine + 0.05 g / L valine + 0.05 g / L methionine + 0.1 g / L tryptophan + 0.2 g / L adenine + 2% v / v glucose + 20 g / L agar powder, pH=6.5.

[0039] Based on previous transcriptome sequencing data, open reading frames (ORFs) and sequence analysis were performed on candidate CYP90B subfamily genes in Fritillaria cirrhosa using the NCBI online tool (https: / / www.ncbi.nlm.nih.gov / orffinder / ). Primers specific for the full-length coding region of the gene were designed using the sequence analysis software SnapGene 3.2.1 and introduced into the homologous arm of the YCplac33 vector. Following a series of procedures including cDNA preparation, candidate gene amplification and recovery, homologous recombination, yeast transformation, bacterial water detection, shake-flask fermentation and product extraction, and LC-MS detection, the gene was finally identified as catalyzing the hydroxylation reaction at the C-22 position of cholesterol to generate 22(R)-hydroxycholesterol (C-22). Figure 1 The FcirCYP90B27 is used. The operating steps for each stage are as follows:

[0040] (1) Preparation of cDNA template

[0041] Bulbs of Fritillaria cirrhosa were collected, sliced, and flash-frozen in liquid nitrogen for RNA extraction. Total RNA was extracted using the HiPure HP Plant RNA Mini Kit from Guangzhou Meiji Biotechnology Co., Ltd. RNA was extracted according to the kit's instructions. After passing quality tests, the RNA was reverse transcribed into cDNA using the TAKARA reverse transcription kit and stored at -20ºC for later use.

[0042] (2) Gene amplification and recovery

[0043] The ORF (open reading frame) of candidate CYP genes from Fritillaria cirrhosa was identified using the NCBI online tool (https: / / www.ncbi.nlm.nih.gov / orffinder). The recombinant FcirCYP90B27 gene expression vector Y33-FcirCYP90B27 was designed using the sequence analysis software SnapGene 3.2.1. Figure 2Primers for specific amplification of the full-length coding region of the gene were designed and introduced into the homologous arm of the YCplac33 vector. Specific primer information:

[0044] Upstream primer 5'F: cagtcgacctcgaatctagaatggcactagagctgcttct; (SEQ ID NO.3)

[0045] Downstream primer 3'R: atgatgcggccctctagattagttgatggcacggacct. (SEQ ID NO.4)

[0046] Using the previously reverse transcribed cDNA as a template, the gene was amplified using DNA polymerase (phanta enzyme).

[0047] The amplification system consisted of: 2 μL cDNA, 25 μL 2×phantaMax Master mix, 2 μL each of upstream and downstream primers (10 μmol / L), and ddH2O to a final volume of 50 μL.

[0048] The amplification program was as follows: 95ºC, 3 min; 95ºC, 15 s; 58ºC, 15 s; 72ºC, 50 s; 30 cycles; 72ºC, 5 min.

[0049] After the PCR amplification procedure, the amplified gene band and the target gene band were checked for consistency using 1.2% w / v agarose gel electrophoresis. After agarose gel electrophoresis, a clear and bright band appeared at approximately 1500 bp using the DNA marker as a scale, which was similar in length to the target gene band (1452 bp). Figure 3 (A) indicates good amplification effect. The target gene fragment was recovered and purified using a gel extraction kit from GenStar. The concentration of the recovered fragment was determined using a NanoDrop 2000 instrument and stored at -20°C.

[0050] (3) Construction and identification of gene recombination vectors

[0051] A. Vector linearization: The YCplac33 vector was linearized by single-enzyme digestion with XbaⅠ restriction endonuclease. The reaction conditions were 37℃ for 1 h, and then terminated by heating at 65℃ for 5 min.

[0052] Enzyme digestion system: 2 μL XbaⅠ restriction endonuclease; 2 μL 10×CutSmart Buffer; 5 μL YCplac33 vector; 11 μL ddH2O.

[0053] After verification by agarose gel electrophoresis, the enzyme digestion products were purified and recovered using the OMEGA EZNA® Cycle Pure Kit. The DNA concentration was measured using the NanoDrop2000 instrument and stored at -20°C for long-term storage.

[0054] B. Gene Recombination: Using the Seamless Cloning MasterMix kit from Sangon Biotech (Shanghai) Co., Ltd., the amplified target gene fragment was ligated into the YCplac33 linearized vector at the recommended molar ratio (3:1) according to the reagent instructions. The reaction system is shown in Table 1. After incubation at 50℃ for 30 min, the recombinant plasmid was constructed, yielding the Y33-FcirCYP90B27 recombinant plasmid.

[0055] Table 1

[0056]

[0057] The reaction and transformation steps are as follows:

[0058] Thaw DH5α competent cells stored at -80℃ in an ice bath, add 5 μL of homologous recombination ligation reaction solution, gently mix, and incubate on ice for 30 min; quickly transfer the centrifuge tube to a 42℃ metal bath for heat shock for 40-90 s, precisely control the time, and immediately return it to the ice bath for 3 min; add 450 μL of LB liquid medium to the centrifuge tube, shake at 37℃ and 200 r / min for 60 min, centrifuge at 5000×g for 1 min to collect the cells, discard 400 μL of supernatant, and spread the remaining bacterial suspension evenly on LB solid medium containing 100 ug / mL ampicillin and incubate upside down in a 37℃ incubator.

[0059] Recombinant screening and validation:

[0060] Colony PCR identification: In a clean bench, eight single colonies were randomly picked from a transformation plate using a sterile pipette tip and inoculated into PCR tubes containing 20 μL of ddH2O. The colonies were repeatedly pipetted to ensure complete suspension. 3 μL of the bacterial suspension was transferred to a new sterile PCR tube as a template for PCR identification. The PCR identification used was 2×Taq Master Mix enzyme from Nanjing Novizan Biotechnology Co., Ltd. The reaction system consisted of: 12.5 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers (10 μmol / L), 3 μL of bacterial suspension as template, and ddH2O to a final volume of 25 μL.

[0061] Identification primer sequences:

[0062] 5'F: ctggcacgacaggtttccc; (SEQ ID NO.5)

[0063] 3'R: gagaaataccgcatcaggcgc; (SEQ ID NO.6)

[0064] The PCR program was 95℃ for 3 min; 95℃ for 30 s, 58℃ for 15 s, 72℃ for 50 s, 30 cycles; 72℃ for 5 min.

[0065] After the reaction procedure, the length of the PCR products was determined by 1% w / v agarose gel electrophoresis. The 1% w / v agarose gel electrophoresis showed a clear and bright band at approximately 1500 bp in lanes 1-8, using the DNA marker as a scale. Clones matching the expected target fragment (1452 bp) were identified as positive recombinants. Figure 3 (B) The sequencing of the PCR reaction stock solution corresponding to the positive band was performed by Sangon Biotech Co., Ltd. The sequencing results were compared and analyzed with the target gene sequence using DNAMAN software. The results showed that the gene ligation was successful, there were no mutations, and the selected single colonies were positive bacteria, indicating that the assembly was successful.

[0066] The remaining 17 μL of bacterial solution from the PCR-verified positive colonies was added to 5 mL of LB broth containing 100 μg / mL ampicillin and incubated overnight at 37°C and 220 rpm for 12–16 h on a shaker. After the bacterial suspension became turbid, 4 mL of the suspension was taken for plasmid extraction in a clean bench. The plasmid extraction kit used was the ready-to-use Steadure plasmid extraction kit from Wuhan Aireco Biotechnology Co., Ltd. The extracted plasmids were stored at -20°C. The remaining 1 mL of bacterial suspension was added to 1 mL of 50% v / v sterile glycerol and stored at -80°C for later use.

[0067] (4) Conversion of lithium acetate in yeast chassis

[0068] The recombinant plasmid Y33-FcirCYP90B27 was transformed into *Saccharomyces cerevisiae* strain Vg13 using the lithium acetate transformation method. A blank control group was also established, in which the empty vector YCplac33 was transformed into *Saccharomyces cerevisiae* strain Vg13. The transformed cells were then plated onto SC-His-Leu-Ura deficient solid medium and incubated at 30°C inverted for 2-3 days until transformants appeared. Single colonies were picked and incubated overnight for 12-16 hours until turbidity was achieved, followed by screening for positive transformants.

[0069] (5) Shake flask fermentation

[0070] The bacterial culture (1 mL) of the positive transformants screened by lithium acetate conversion in the previous step was inoculated into 50 mL of SC-His-Leu-Ura deficient liquid medium and cultured on a shaker at 30℃ and 220 r / min for 5-7 days. The bacterial cells were collected by centrifugation at 4℃ and 5000×g for 15 min.

[0071] (6) Extraction of fermentation products

[0072] The bacterial cells collected in the previous step were resuspended in 10 mL of methanol and sonicated in an ice bath for 30 min. The lysate was centrifuged at 5000 g for 20 min at 4 °C, and the supernatant was collected to obtain the methanol extract. The methanol extract was transferred to a separatory funnel, an equal volume of ethyl acetate was added, and the mixture was shaken and extracted for 10 min. After standing and separating the layers, the organic phase was collected. The extraction was repeated 3 times, and the organic phases were combined to obtain the extract.

[0073] The extract was rotary evaporated to dryness at 40°C, and the residue was dissolved in 2 mL of methanol, filtered through a 0.22 μm organic filter membrane, and then used for LC-MS analysis.

[0074] (7) Product testing

[0075] The LC-MS detection conditions are as follows:

[0076] The analysis was performed using an Agilent 1290 UPLC / 6540 Q-TOF liquid chromatography-mass spectrometry system, with the following specific parameters:

[0077] Mass spectrometry detection conditions: Ion source: electrospray positive ion mode (ESI+); Spray voltage: 3.5 kV; fragmentation voltage: 135 V; cone voltage: 60 V; radio frequency capillary voltage: 750 V; scan range: 100–1000 m / z; scan mode: selected reaction monitoring (SRM); column: Waters XBridge C18 (4.6 × 150 mm, 5 μm); column temperature: 30 °C.

[0078] Chromatographic separation conditions: Column: Waters XBridge C18 reversed-phase column (4.6 mm × 150 mm, 5 μm); Column temperature: 25℃; UV absorption peak: 203 nm; Mobile phase: Phase A: pure water, Phase B: methanol (chromatographic grade); Elution program: 0~45 min, 80%–20% A; 45~70 min, 95%–5% A; During elution, the gradient change was linear; Flow rate: 0.3 mL / min; Injection volume: 15 μL.

[0079] The shake-flask fermentation products were analyzed by LC-MS, and the results are as follows: Figure 4As shown. Analysis revealed that the elution time of the product from shake-flask fermentation of the Y33-FcirCYP90B27 recombinant plasmid transformed into the cholesterol yeast strain Vg13 (13.34 min) was consistent with that of the standard 22(R)-hydroxycholesterol (13.34 min), while no new product peak was detected in the blank control group. Figure 4 (A). Further determination of the molecular weight of the new product revealed that an engineered strain transformed with the Y33-FcirCYP90B27 recombinant plasmid using the cholesterol yeast strain Vg13 as the chassis strain detected a characteristic chromatographic peak at a mass-to-charge ratio of 425.3395 [M+Na]+. Figure 4 The LC-MS spectrum of the 22(R)-hydroxycholesterol standard was positive (C), while no corresponding signal was detected in the blank control group. Furthermore, this mass spectrometry characteristic perfectly matched the LC-MS spectrum of the 22(R)-hydroxycholesterol standard. Figure 4 B, Figure 4 (C)

[0080] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. A gene for FcirCYP90B27, a cholesterol 22(R)-hydroxylase from Fritillaria cirrhosa, characterized in that... The nucleotide sequence of the Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene is shown in SEQ ID NO.

1.

2. The protein encoded by the Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene as described in claim 1, characterized in that, The amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

3. A recombinant plasmid containing the Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene as described in claim 1.

4. The recombinant plasmid according to claim 3, characterized in that, The FcirCYP90B27 gene of cholesterol 22(R)-hydroxylase from Fritillaria cirrhosa was homologously recombined with the YCplac33 vector to obtain the Y33-FcirCYP90B27 recombinant plasmid.

5. A transgenic engineered bacterium containing the recombinant plasmid as described in claim 3, or wherein the genome of the transgenic engineered bacterium is integrated with an exogenous Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene as described in claim 1.

6. The genetically engineered bacteria according to claim 5, characterized in that, The genetically engineered bacteria are either Escherichia coli DH5α strain or Cholesterol Yeast strain Vg13.

7. The cholesterol 22(R)-hydroxylase encoded by the Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene as described in claim 1.

8. The use of the Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene as described in claim 1 in the preparation of 22(R)-hydroxy cholesterol.

9. The application of the Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene according to claim 8 in the preparation of 22(R)-hydroxycholesterol, characterized in that: Using cholesterol as a substrate, 22(R)-hydroxylase encoded by the cholesterol 22(R)-hydroxylase gene of Fritillaria cirrhosa is used to hydroxylate cholesterol at the C-22 position to generate 22(R)-hydroxy cholesterol.

Images