DNA targeted library construction kit and application thereof

Abstract

The invention belongs to the technical field of library construction, and particularly relates to a DNA targeted library construction kit and application thereof. The kit comprises a hybridization capture reagent combination, the hybridization capture reagent combination comprises a hybridization reaction solution, and the hybridization reaction solution comprises a hybridization reaction solution 1 and a hybridization reaction solution 2; the hybridization reaction solution 1 is prepared from betaine, tetramethylammonium chloride, Mg < 2 + > and Triton X-100; the hybridization reaction liquid 2 is prepared from formamide and N-methyl pyrrolidone; hybridization of the probe and the library is facilitated, the capture efficiency is superior to that of an existing hybridization reaction solution, and Panel with different sizes and different hybridization durations can be compatible; a small panel can also achieve relatively high and relatively stable capture efficiency, the hybridization time is selectable within 1-20 h, fast and slow hybridization reagents are unified, and production and simultaneous operation of multiple products are facilitated.

Description

Technical Field

[0001] This invention belongs to the field of library construction technology, specifically relating to a DNA-targeted library construction kit and its applications. Background Technology

[0002] Nucleic acid sequences are the carriers of life information, and high-throughput sequencing technology has become one of the core technologies in the fields of biology and medicine. High-throughput sequencing generates a large amount of data, not all of which are the target sequences for research or detection. Although sequencing costs have been significantly reduced, the high data volume of whole-genome sequencing still keeps costs high. The solution to this problem is to transform whole-genome sequencing into targeted enrichment technology. NGS sequencing technology, which enriches target regions, ignores information from regions of uninteresting interest in the genome and amplifies the signal from the target region, thus saving sequencing costs and sequencing time.

[0003] Targeted enrichment is mainly divided into multiplex PCR amplification and targeted capture, based on different enrichment principles. The latter, probe-based liquid-phase hybridization capture technology, is currently the mainstream approach, offering advantages such as low probe design difficulty and high probe fault tolerance. As a common targeted enrichment technique, liquid-phase hybridization capture technology has wide applications in clinical tumor detection and pathogen detection due to its high throughput and ability to accurately detect low-frequency mutations. While many hybridization capture reagents are available on the market, most are slow hybridization methods, and few can guarantee performance under 2-hour rapid hybridization. Conventional hybridization also suffers from low capture efficiency and instability with small panels. Summary of the Invention

[0004] The first aspect of the present invention is to provide a DNA targeted library construction kit.

[0005] The second aspect of this invention aims to provide an application of the reagent kit of the first aspect of this invention.

[0006] The third aspect of this invention aims to provide a method for constructing a DNA-targeting library.

[0007] The fourth aspect of this invention is to provide a DNA targeting library.

[0008] The fifth aspect of this invention aims to provide a sequencing method.

[0009] The sixth aspect of this invention aims to provide a product.

[0010] The seventh aspect of this invention aims to provide a DNA-targeted library construction system.

[0011] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A first aspect of the present invention provides a DNA targeted library construction kit, comprising: a hybridization capture reagent assembly, the hybridization capture reagent assembly comprising a hybridization reaction solution, the hybridization reaction solution comprising: hybridization reaction solution 1 and hybridization reaction solution 2; hybridization reaction solution 1 comprising: betaine, tetramethylammonium chloride, and Mg 2+ The hybridization reaction solution 2 contains: formamide and N-methylpyrrolidone.

[0012] In some embodiments, the hybridization reaction solution 1 and the hybridization reaction solution 2 exist independently or in combination; more specifically, they exist independently.

[0013] In some embodiments, the Mg 2+ The concentration in hybridization reaction solution 1 is 1-100 mM; further, 10-100 mM; even further, 20-40 mM; and still further, 25-35 mM.

[0014] In some embodiments, the magnesium ions are derived from magnesium acetate.

[0015] In some embodiments, the concentration of betaine in hybridization reaction solution 1 is 1-10 M; further, 2-5 M; and even further, 2.5-3.5 M.

[0016] In some embodiments, the concentration of the tetramethylammonium chloride in the hybridization reaction solution 1 is 1-10 M; further, 1-3 M; and even further, 1.5-2.5 M.

[0017] In some embodiments, the concentration of Triton X-100 in the hybridization reaction solution 1 is 0.01%-1% by volume; further, 0.01%-0.1%; and even further, 0.01%-0.02%.

[0018] In some embodiments, the concentration of formamide in the hybridization reaction solution 2 is 50%-90% by volume; further, 60%-80%; and even further, 75%-80%.

[0019] In some embodiments, the concentration of the N-methylpyrrolidone in the hybridization reaction solution 2 is 10%-50% by volume; further, 20%-40%; and even further, 20%-25%.

[0020] In some embodiments, when the hybridization reaction solution 1 and hybridization reaction solution 2 are present in a mixture, the volume ratio of the hybridization reaction solution 1 to the hybridization reaction solution 2 is (1-10):1; further, (2-5):1; further, (3-4):1.

[0021] In some embodiments, the kit further comprises: a DNA library (preferably a genomic DNA library) construction reagent assembly, the DNA library (preferably a genomic DNA library) construction reagent assembly comprising: a reagent assembly for adapter ligation, the reagent assembly for adapter ligation comprising: a ligation reaction solution; the ligation reaction solution comprising: buffer, magnesium ions, a thiol reducing agent, adenine nucleoside triphosphate (ATP), and propylene glycol; the ligation reaction solution does not contain polyethylene glycol (PEG).

[0022] In this invention, propylene glycol is used to replace polyethylene glycol, thereby reducing the PEG content in the linkage reaction system and thus reducing the generation of chimeras.

[0023] In some embodiments, the buffer solution comprises at least one of: citrate buffer, MES buffer solution, phosphate buffer, Bis-tris buffer, and Tris hydrochloric acid buffer; more particularly, Tris hydrochloric acid buffer.

[0024] In some embodiments, the concentration of the buffer solution in the ligation reaction solution is 0.1-1 M; further, 0.1-0.4 M; and even further, 0.1-0.2 M.

[0025] In some embodiments, the pH of the buffer solution is 7-9; more specifically, it is 7.4-7.8.

[0026] In some embodiments, the magnesium ions are derived from MgCl2.

[0027] In some embodiments, the concentration of magnesium ions in the bonding reaction solution is 0.01-1 M; further, 0.01-0.04 M; and even further, 0.01-0.02 M.

[0028] In some embodiments, the thiol reducing agent comprises at least one of tris(2-formylethyl)phosphonic acid hydrochloride (TCEP), dithiothreitol (DTT), and glutathione reduced (GSH); more specifically, TCEP.

[0029] In some embodiments, the concentration of the thiol reducing agent in the connecting reaction solution is 0.01-1 M; further, 0.01-0.04 M; and even further, 0.012-0.014 M.

[0030] In some embodiments, the concentration of ATP in the ligation reaction solution is 0.001-0.1 M; more specifically, 0.001-0.01 M; more specifically, 0.001-0.002 M.

[0031] In some embodiments, the concentration of propylene glycol in the bonding reaction solution is 40%-80% by volume; further, 50%-70%; and even further, 55%-65%.

[0032] In some embodiments, the hybridization capture reagent combination further comprises: a magnetic bead suspension.

[0033] In some embodiments, the magnetic bead suspension comprises hybridization reaction solution 1 and hybridization reaction solution 2.

[0034] In some embodiments, the volume ratio of hybridization reaction solution 1 to hybridization reaction solution 2 is (2-4):1.

[0035] In some embodiments, the hybridization capture reagent combination further comprises: a library blocking solution.

[0036] In some embodiments, the library blocking solution comprises: Human Cot DNA or Salmon Sperm DNA; and Blocker (preferably a general-purpose Blocker).

[0037] Human Cot DNA is genomic DNA extracted from the human placenta. It consists of highly repetitive sequences of approximately 50 to 300 bp in length found in the human genome. It can conveniently and effectively block repetitive sequences in the nucleic acid sequences of probes or samples to be tested, shielding these sequences and thus avoiding interference from non-specific hybridization signals during nucleic acid hybridization. This enhances the effectiveness of nucleic acid hybridization and ultimately achieves effective capture of nucleic acid sequences in the sample being tested, playing a "blocking" role. Specifically, Human Cot-1 DNA can be used to block high-copy / low-sequence-complexity regions of the human genome.

[0038] Salmon Sperm DNA can effectively block repetitive sequences in the nucleic acid sequences of probes or samples from other species to be tested, thus shielding repetitive sequences.

[0039] In some embodiments, the hybridization capture reagent assembly further includes a capture probe.

[0040] In some embodiments, the capture probe comprises at least one of a DNA probe and an RNA probe.

[0041] In some embodiments, the hybridization capture reagent combination further includes a washing solution combination.

[0042] In some embodiments, the cleaning solution combination includes magnetic bead cleaning solution, elution reaction solution I, elution reaction solution S, elution reaction solution II, and elution reaction solution III.

[0043] In some embodiments, the magnetic bead cleaning solution comprises: Tris-HCl, EDTA, NaCl, and Tween 20; and further comprises: 4-6 mM Tris-HCl, 0.4-0.6 mM EDTA, 0.8-1.2 M NaCl, and 0.05%-0.15% Tween 20.

[0044] In some embodiments, the elution reaction solution I comprises SSC buffer and SDS; further comprising 0.8-1.2× SSC buffer and 0.005%-0.015% SDS.

[0045] In some embodiments, the elution reaction solution S comprises SSC buffer and Tween 20; further comprising 0.8-1.2× SSC buffer and 0.08%-0.12% Tween 20.

[0046] In some embodiments, the elution reaction solution II comprises SSC buffer and Tween 20; further comprising 0.4-0.6× SSC buffer and 0.08%-0.12% Tween 20.

[0047] In some embodiments, the elution reaction solution III contains SSC buffer; further comprising 0.1-0.3×SSC buffer.

[0048] In some embodiments, the hybridization capture reagent combination further includes a reagent combination for capturing library amplification.

[0049] In some embodiments, the reagent combination for capturing library amplification comprises: amplification primers and DNA polymerase reaction solution.

[0050] In some embodiments, the DNA polymerase reaction solution comprises: DNA polymerase, buffer solution, magnesium ions, and dNTPs.

[0051] In some embodiments, the hybridization capture reagent combination further comprises magnetic beads for capturing and purifying the capture library.

[0052] In some embodiments, the hybridization capture reagent assembly also includes a specification describing a method for constructing a capture library according to a third aspect of the invention.

[0053] In some embodiments, the reagent combination for connector ligation further comprises a ligase.

[0054] In some embodiments, the ligase comprises at least one of: T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, Pfu DNA ligase, HiFi DNA ligase, and Quick Ligase; more particularly, it is T4 DNA ligase.

[0055] In some embodiments, the reagent assembly for connector connection further includes a connector.

[0056] In some embodiments, the connector is the hybrid specific molecular tag connector in patent document CN 114317528 A, specifically as follows: both the sense and antisense molecular tags of the connector use a specific molecular tag UMI group, which includes: a first specific molecular tag UMI with a sequence length of 5 bp, a second specific molecular tag UMI with a sequence length of 6 bp, a third specific molecular tag UMI with a sequence length of 7 bp, and a fourth specific molecular tag UMI with a sequence length of 8 bp.

[0057] In some embodiments, the sequences of the sense molecular tags of the specific molecular tag UMI group are shown in Table 2 of CN114317528 A, and the sequences of the antisense molecular tags are shown in Table 2 of CN 114317528 A.

[0058] In some embodiments, the first specific molecular tag UMI, the second specific molecular tag UMI, the third specific molecular tag UMI, and the fourth specific molecular tag UMI are present in the same number of moles in the connector.

[0059] In some embodiments, the linker comprises two partially complementary linker oligonucleotide chains: The linker oligonucleotide chain 1 includes, from the 5' end to the 3' end, an index2 primer binding region, a positive linker complementary region, a positive molecule tag, at least one base S with base balancing function, and one prominent fixed base T. Linker oligonucleotide chain 2, from the 5' end to the 3' end, includes a base complementary to base S in linker oligonucleotide chain 1, an antisense molecular tag anticomplementing to the sense molecular tag in linker oligonucleotide chain 1, an antisense linker complementary region anticomplementing to the sense linker complementary region in linker oligonucleotide chain 1, and an index1 primer binding region.

[0060] In some implementations, "S" represents either the G or C base.

[0061] In some embodiments, in the linker oligonucleotide chain 1, the length of the index2 primer-binding region is 15-42 bp. The length of the positive linker complementary region is 8-10 bp, and the length of the positive molecular tag is 5-8 bp; the positive linker complementary region is wholly or partially overlapped with the 3' end sequence of the index2 primer binding region; In some embodiments, in the linker oligonucleotide chain 2, the antisense molecular tag is 5-8 bp in length, the antisense linker complementary region is 8-10 bp in length, and the index1 primer binding region is 15-30 bp in length; the antisense linker complementary region is wholly or partially overlapped with the 5' end sequence of the index1 primer binding region.

[0062] In some embodiments, in the linker oligonucleotide chain 1, the number of each of the four bases A / T / G / C in the sequence composed of the positive molecule tag, the balancing base S, and the fixed base T accounts for 6.25% to 43.75% of the total number of bases in the positive molecule tag. In some embodiments, in the linker oligonucleotide chain 2, the number of each of the four bases A / T / G / C in the sequence composed of the antisense molecular tag and the complementary base S accounts for 6.25%-43.75% of the total number of bases in the antisense molecular tag.

[0063] In some implementations, the 5' end of the linker oligonucleotide chain 2 is phosphorylated.

[0064] In some embodiments, the connector is a Y-type hybrid specific molecular tag connector.

[0065] In some implementations, the index1 and index2 sequences are selected from Table 1 of CN 114317528 A, which ensures the amplification efficiency of the constructed library.

[0066] In some embodiments, the connector is the connector shown in Table 2 of patent document CN 114317528 A.

[0067] In some embodiments, the DNA library (preferably a genomic DNA library) construction reagent kit further includes: a reagent kit for end repair and adding "A".

[0068] In some embodiments, the reagent combination for end repair and adding "A" comprises: an end repair reaction solution; the end repair reaction solution comprises: a buffer solution, magnesium ions, potassium ions, a thiol reducing agent, adenine nucleoside triphosphate (ATP), dNTPs, and a nonionic surfactant.

[0069] In some embodiments, the buffer solution comprises at least one of: citrate buffer, MES buffer solution, phosphate buffer, Bis-tris buffer, and Tris hydrochloric acid buffer; more particularly, Tris hydrochloric acid buffer.

[0070] In some embodiments, the concentration of the buffer solution in the end-repair reaction solution is 0.1-1 M; more specifically, 0.4-0.5 M.

[0071] In some embodiments, the pH of the buffer solution is 7-9; more specifically, it is 7.8-8.2.

[0072] In some embodiments, the magnesium ions are derived from MgCl2.

[0073] In some embodiments, the concentration of magnesium ions in the end-repair reaction solution is 0.01-1M; further, 0.05-0.1M; and even further, 0.08-0.09M.

[0074] In some embodiments, the potassium ions are derived from KCl.

[0075] In some embodiments, the concentration of potassium ions in the end-repair reaction solution is 0.01-1 M; further, 0.05-0.1 M; and even further, 0.08-0.09 M.

[0076] In some embodiments, the thiol reducing agent comprises at least one of tris(2-formylethyl)phosphonic acid hydrochloride (TCEP), dithiothreitol (DTT), and glutathione reduced (GSH); more specifically, TCEP.

[0077] In some embodiments, the concentration of the thiol reducing agent in the end-repair reaction solution is 0.01-1M; further, 0.01-0.03M; and even further, 0.01-0.02M.

[0078] In some embodiments, the concentration of ATP in the terminal repair reaction solution is 0.001-0.1 M; further, 0.001-0.01 M; and even further, 0.006-0.008 M.

[0079] In some embodiments, the concentration of the dNTP in the end-repair reaction solution is 0.001-0.1 M; further, 0.001-0.02 M; and even further, 0.008-0.012 M.

[0080] In some embodiments, the nonionic surfactant comprises at least one of Tween 20, Triton X-100, NP-40, and Pluronic F-68; more specifically, Tween 20.

[0081] In some embodiments, the concentration of the nonionic surfactant in the end-repair reaction solution is 0.01%-1% by volume; further, 0.05%-0.15%; and even further, 0.08%-0.12%.

[0082] In some embodiments, the reagent combination for end repair and adding "A" further comprises: end repair enzyme.

[0083] In some embodiments, the terminal repair enzyme comprises a polymerase.

[0084] In some embodiments, the terminal repair enzyme further comprises a polynucleotide kinase, which is used to dephosphorylate and phosphorylate the DNA fragment at the 3' end when the end of the DNA fragment is not 5' phosphate and / or 3' hydroxyl.

[0085] In some embodiments, the polynucleotide kinase comprises T4 polynucleotide kinase.

[0086] In some embodiments, the polymerase comprises at least one of T4 DNA polymerase, DNA polymerase I (Klenow) large fragment (Klenow fragment), T7 DNA polymerase, and DNA polymerase I; and further comprises at least one of T4 DNA polymerase and DNA polymerase I (Klenow) large fragment (Klenow fragment).

[0087] In some embodiments, the terminal repair enzyme comprises: T4 polynucleotide kinase, T4 DNA polymerase, Klenow enzyme, and Taq DNA polymerase.

[0088] In some embodiments, the DNA library (preferably a genomic DNA library) construction reagent kit further includes a reagent kit for library amplification.

[0089] In some embodiments, the reagent combination for library amplification includes: library preparation primers and DNA polymerase reaction solution.

[0090] In some embodiments, the primers used for library construction are the primers of Example 3 in patent document CN 114317528 A.

[0091] In some embodiments, the DNA polymerase reaction solution comprises: DNA polymerase, buffer solution, magnesium ions, and dNTPs.

[0092] In some embodiments, the DNA library (preferably a genomic DNA library) construction reagent kit further includes magnetic beads for purifying adapter ligation products and / or library amplification products.

[0093] In some embodiments, the magnetic beads comprise PEG.

[0094] In some embodiments, the DNA library (preferably a genomic DNA library) construction reagent kit further includes a substance for breaking down DNA.

[0095] In some embodiments, the DNA-breaking substance is selected from one or more of the following methods: chemical breaking methods (e.g., acid hydrolysis, metal ion catalysis), biological breaking methods (e.g., enzyme digestion), and physical breaking methods (e.g., ultrasonic disruption, high-pressure homogenization).

[0096] In some embodiments, the DNA library (preferably a genomic DNA library) construction reagent kit further includes: a specification describing a DNA library construction method (preferably the DNA library construction method of the third aspect of the present invention).

[0097] In some embodiments, the DNA library (preferably a genomic DNA library) construction reagent kit further includes: a nucleic acid extraction reagent kit.

[0098] In some embodiments, the nucleic acid extraction reagent combination is a nucleic acid extraction reagent combination selected from any of the following methods: alkaline lysis, phenol-chloroform extraction, chelation resin method, centrifugal column membrane adsorption method, and magnetic bead method; further, it is a nucleic acid extraction reagent combination for the magnetic bead method.

[0099] In some embodiments, the DNA is derived from biological samples such as cells, fresh tissues, fresh organs, decaying tissues, formalin-fixed tissues, paraffin-embedded tissues, forensic samples, paleontological fossils, and biological materials containing cfDNA or RNA.

[0100] In some embodiments, the biological material includes, but is not limited to: peripheral blood, plasma, serum, urine, feces, saliva, cerebrospinal fluid, lymph, bronchoalveolar lavage fluid, amniotic fluid, blastocyst cavity fluid, cell culture medium, embryo culture medium, microbial culture medium, soil leachate, and bone meal leachate.

[0101] More specifically, The DNA can be isolated from a biological sample obtained from an individual (e.g., a test individual). The individual can be any living or non-living organism, including but not limited to humans, non-human animals, plants, bacteria, fungi, protozoa, or pathogens.

[0102] DNA can be isolated or obtained from any type of suitable biological sample. Nucleic acids can be isolated or obtained from single cells, multiple cells (e.g., cultured cells), cell culture media, conditioned media, tissues, organs, or organisms (e.g., bacteria, yeast, etc.).

[0103] In some cases, DNA can be obtained as part of forensic analysis. In some implementations, the kits described herein are applied to forensic samples or specimens. Forensic samples or specimens may include any biological material containing DNA. For example, forensic samples or specimens may include blood, semen, hair, skin, sweat, saliva, decomposed tissue, bone, nail scraps, licked stamps / envelopes, sluff, contact DNA, razor residue, etc. Specimens may be formalin-fixed tissue and / or paraffin-embedded tissue.

[0104] Biological samples can be any sample isolated from or obtained from an individual or a part thereof (e.g., a human individual, a pregnant female, a cancer patient, a patient with an infection or infectious disease, a transplant recipient, a fetus, a tumor, an infected organ or tissue, a transplanted organ or tissue, or a microbiome). In some embodiments, the biological sample is a cervical swab from an individual. Liquid or tissue samples from which nucleic acids are extracted can be cell-free (e.g., cell-free). In some embodiments, the biological sample may contain cellular components or cellular remnants. In some embodiments, the biological sample may include fetal cells or cancer cells.

[0105] Biological samples can be liquid samples. Liquid samples may contain extracellular nucleic acids (e.g., circulating cell-free DNA). Examples of liquid samples include, but are not limited to, blood or blood products (e.g., serum, plasma, etc.), urine, cerebrospinal fluid, saliva, sputum, biopsy samples (e.g., liquid biopsies for cancer detection), the above liquid samples, analogues, or combinations thereof. In some embodiments, a biological sample is a liquid biopsy, which generally refers to an assessment of a liquid sample from an individual regarding the presence, absence, progression, or remission of a disease (e.g., cancer). Liquid biopsies may be used in conjunction with commercially available biopsies (e.g., tumor biopsies) or as a substitute for them. In some cases, extracellular nucleic acids are analyzed in liquid biopsies.

[0106] Biological samples can be tumor nucleic acid samples (i.e. nucleic acid samples isolated from tumors).

[0107] In this invention, the DNA may be cfDNA.

[0108] A second aspect of the invention provides the use of the kit of the first aspect of the invention in any one of a1)-a4): a1) Construction of DNA-targeted libraries; a2) Prepare sequencing reagent kits; a3) Sequencing; a4) Prepare products for DNA targeted library construction.

[0109] In some embodiments, the product further includes an automated library preparation and hybridization workstation (preferably a GIN16 automated library preparation and hybridization workstation).

[0110] In some implementations, the product includes a system.

[0111] A third aspect of the present invention provides a method for constructing a DNA-targeted library, comprising the steps of using a DNA-targeted library construction kit according to the first aspect of the present invention.

[0112] In some implementations, the method includes the following steps: a) Construction of DNA libraries (preferably genomic DNA libraries); b) Capture library construction: b1) Hybridization; b2) Capture; b3) Elution; b4) Capture library amplification; The hybridization includes the step of using the hybridization reaction solution from the first aspect of the present invention.

[0113] In some embodiments, the hybridization method includes the following steps: mixing a DNA library (preferably a genomic DNA library), a hybridization reaction solution, a capture probe (preferably the capture probe in the first aspect of the invention), and a library blocking solution, and then reacting.

[0114] In some embodiments, the method of mixing the DNA library (preferably a genomic DNA library), hybridization reaction solution, capture probe, and library blocking solution may include: c1) Mix the DNA library (preferably a genomic DNA library) with the hybridization reaction solution, the capture probe, and the dried library blocking solution, wherein the mixture is obtained by eluting the DNA library (preferably a genomic DNA library) with the hybridization reaction solution (evaporation-free); or c2) The dried mixture, the capture probe, and the hybridization reaction solution are mixed, wherein the mixture contains a DNA library (preferably a genomic DNA library) and a library blocking solution (evaporated to dryness).

[0115] In some embodiments, the hybridization reaction solution described in c1) and c2) is a hybridization reaction solution diluted with water (preferably enzyme-free water).

[0116] In some embodiments, the volume ratio of the hybridization reaction solution to water (preferably enzyme-free water) is (4-8):1; further, (5-7):1; and even further, (6-6.4):1.

[0117] In some embodiments, the volume ratio of the mixture of the mixture of the capture probe and the library blocking solution described in c1) to the library blocking solution is (10-40):7; further, (15-35):7; and even further, (15-19):7.

[0118] In some embodiments, the volume ratio of the mixture to the capture probe is (11-15):4; further, it is (12-14):4.

[0119] In some embodiments, the method described in c1) of obtaining the DNA library (preferably a genomic DNA library) by eluting it with a hybridization reaction solution may include: d1) The final purification step in the construction of the DNA library (preferably a genomic DNA library) involves elution using the hybridization reaction solution (integrated construction and hybridization); or d2) The DNA library constructed from the purified DNA library (preferably a genomic DNA library) is then eluted using the hybridization reaction solution (hybridization separation).

[0120] In some implementations, the DNA library described in d2) may be a single DNA library or a mixture of multiple DNA libraries.

[0121] In some embodiments, the Mg 2+ The concentration in the reaction system is 0.5-50 mM; further, 15-50 mM; even further, 10-20 mM; and still further, 12.5-17.5 mM.

[0122] In some embodiments, the concentration of betaine in the reaction system is 0.5-5 M; further, 1-2.5 M; and even further, 1.25-1.75 M.

[0123] In some embodiments, the concentration of the tetramethylammonium chloride in the reaction system is 0.5-5 M; further, 0.5-1.5 M; and even further, 0.75-1.25 M.

[0124] In some embodiments, the concentration of Triton X-100 in the reaction system is 0.005%-0.5% by volume; further, 0.005%-0.05%; and even further, 0.005%-0.01%.

[0125] In some embodiments, the concentration of formamide in the reaction system is 5%-20% by volume; further, 10%-15%; and even further, 11%-13%.

[0126] In some embodiments, the concentration of the N-methylpyrrolidone in the reaction system is 1%-10% by volume; further, 2%-5%; and even further, 3%-5%.

[0127] In some embodiments, the reaction time is 1-20 hours; more specifically, 2-16 hours.

[0128] In some embodiments, the reaction temperature is 55-75°C; more specifically, it is 60-70°C.

[0129] In some embodiments, the reaction procedure is 90-100°C for 20-40 seconds; 55-75°C (preferably 60-70°C) for 1-20 hours (preferably 2-16 hours).

[0130] In some embodiments, the library blocking solution is the library blocking solution of the first aspect of the present invention.

[0131] In some embodiments, the capture method is as follows: mixing magnetic beads (preferably the magnetic beads in the hybridization capture reagent combination of the first aspect of the invention) with the product of b1), and reacting.

[0132] In some embodiments, the magnetic beads are obtained by incubation with a magnetic bead suspension (preferably the magnetic bead suspension in the first aspect of the invention) before mixing.

[0133] In some embodiments, the incubation conditions are 60-70°C for 3-7 minutes.

[0134] In some embodiments, the reaction time is 10-60 min; more specifically, 12-18 min.

[0135] In some embodiments, the reaction temperature is 60-70°C.

[0136] In some embodiments, the elution includes hot elution and room temperature elution (preferably hot elution and room temperature elution in sequence).

[0137] In some embodiments, the thermal elution includes elution with elution reaction solution I (preferably elution reaction solution I in the first aspect of the invention) and elution with elution reaction solution S (preferably elution reaction solution S in the first aspect of the invention).

[0138] In some embodiments, the thermal elution sequentially comprises elution with elution reaction solution I (preferably elution reaction solution I in the first aspect of the invention) and elution with elution reaction solution S (preferably elution reaction solution S in the first aspect of the invention).

[0139] In some embodiments, the room temperature elution includes elution with elution reaction solution I (preferably elution reaction solution I in the first aspect of the invention), elution with elution reaction solution II (preferably elution reaction solution S in the first aspect of the invention), and elution with elution reaction solution III (preferably elution reaction solution III in the first aspect of the invention).

[0140] In some embodiments, the room temperature elution sequentially includes elution with elution reaction solution I (preferably elution reaction solution I in the first aspect of the invention), elution with elution reaction solution II (preferably elution reaction solution S in the first aspect of the invention), and elution with elution reaction solution III (preferably elution reaction solution III in the first aspect of the invention).

[0141] In some embodiments, the method for capturing library amplification is as follows: the product obtained in b3) (a DNA suspension containing magnetic beads) and a reagent combination for capturing library amplification (preferably the reagent combination for capturing library amplification in the first aspect of the present invention) are mixed and a PCR reaction is performed.

[0142] In some embodiments, the DNA library (preferably a genomic DNA library) construction method includes the step of using the DNA library (preferably a genomic DNA library) construction reagent combination from the first aspect of the present invention.

[0143] In some embodiments, the method for constructing the DNA library (preferably a genomic DNA library) includes the following steps: a1) Perform end repair and add "A" to DNA fragments; a2) Connect the product obtained in a1) with a joint; a3) Purify the product obtained in a2); a4) Perform library amplification on the product obtained in a3); The connector connection employs the reagent combination for connector connection described in the first aspect of this invention.

[0144] In some embodiments, the method for connecting the connector is as follows: the product obtained in a1), the connector, the connector ligation reaction solution, and the ligase are mixed and reacted.

[0145] The connector bonding reaction solution of the present invention uses propylene glycol instead of polyethylene glycol, thereby reducing the PEG content in the bonding reaction system and thus reducing the generation of chimeras.

[0146] In some embodiments, the concentration of the buffer solution in the ligation reaction system is 0.03-0.3 M; further, 0.03-0.12 M; and even further, 0.03-0.06 M.

[0147] In some embodiments, the concentration of magnesium ions in the bonding reaction system is 0.003-0.3 M; further, 0.003-0.012 M; and even further, 0.003-0.006 M.

[0148] In some embodiments, the concentration of the thiol reducing agent in the linkage reaction system is 0.003-0.3 M; further, 0.003-0.012 M; and even further, 0.0036-0.0042 M.

[0149] In some embodiments, the concentration of ATP in the ligation reaction system is 0.0003-0.03M; more specifically, 0.0003-0.003M; more specifically, 0.0003-0.0006M.

[0150] In some embodiments, the concentration of propylene glycol in the linkage reaction system is 12%-24%; further, 15%-21%; and even further, 16.5%-19.5%.

[0151] In some embodiments, the concentration of the ligase in the ligation reaction system is 1-5 U / μL; more specifically, it is 2-3 U / μL.

[0152] In some embodiments, the molar ratio of the connector to the product obtained in the reaction system is 50-1000; more specifically, it is 74.25-742.5.

[0153] In some implementations, by increasing the molar ratio of the connector to the product obtained in a1), the connector connection efficiency can be significantly improved, while simplifying automated operation.

[0154] In some embodiments, the reaction time is 10-25 min; further, 14-21 min; and even further, 14-16 min.

[0155] Based on the above-mentioned connector connection system, higher connection efficiency can be achieved with a shorter response time, and the time for library construction can be further shortened.

[0156] In some embodiments, the reaction temperature is 15-25°C; further, 18-22°C; and even further, 19-21°C.

[0157] In some embodiments, the method for purifying the product obtained from a2) is as follows: the product obtained from a2) is mixed with magnetic beads (preferably the magnetic beads in the DNA library (preferably genomic DNA library) construction reagent combination in the first aspect of the present invention), incubated, washed with ethanol, dried, and eluted.

[0158] The connector connection reaction solution of the present invention uses propylene glycol instead of polyethylene glycol, thereby reducing the PEG content in the product obtained in a2). Therefore, when the PEG concentration in the mixed system is fixed, the content of magnetic beads can be increased, thereby reducing purification losses and improving template recovery rate.

[0159] In some embodiments, the volume ratio of the product obtained in a2) to the magnetic beads is 1:(1-1.4); more specifically, it is 1:(1.1-1.3).

[0160] In some embodiments, the mixing is homogenization.

[0161] In some embodiments, the incubation time is 5-15 min; further, 8-12 min; and even further, 9-11 min.

[0162] In some embodiments, the concentration of the ethanol is 70-90%; more particularly, it is 75-85%.

[0163] In some implementations, the cleaning is performed 1-3 times.

[0164] In some embodiments, the elution is performed using water; further, enzyme-free water is used.

[0165] In some embodiments, the elution specifically involves adding water, mixing, and incubating (preferably incubating for 4-6 minutes).

[0166] In some embodiments, the library amplification employs the reagent combination for library amplification described in the first aspect of the present invention.

[0167] In some embodiments, the library amplification method is as follows: the product obtained from a3), the library construction primers, and the DNA polymerase reaction solution are mixed, and a PCR reaction is performed.

[0168] In some embodiments, the concentration of the library preparation primers in the PCR reaction system is 1-3 µM; more specifically, it is 1.5-2.5 µM.

[0169] This invention increases library yield while avoiding over-amplification by limiting the concentration of primers used for library construction.

[0170] In some embodiments, the PCR reaction is programmed as follows: 97-99℃ for 43-47s; 97-99℃ for 14-16s, 57-63℃ for 28-32s, 70-74℃ for 28-32s, 7-11 cycles; 70-74℃ for 56-64s.

[0171] In some embodiments, the end repair and addition of "A" employs the reagent combination for end repair and addition of "A" from the first aspect of the present invention.

[0172] In some embodiments, the method for end repair and adding "A" is as follows: mixing DNA fragments, end repair reaction solution, and end repair enzyme, and reacting.

[0173] In some embodiments, the reaction conditions are: 28-32°C for 18-22 min, or 70-74°C for 18-22 min.

[0174] In some embodiments, the DNA fragment is 100-400 bp in size.

[0175] In some embodiments, the DNA fragment is prepared using a substance for breaking DNA as described in the first aspect of the invention.

[0176] In some implementations, the library amplification process further includes a library purification step.

[0177] In some embodiments, the library purification steps are as follows: the library amplification product is mixed with magnetic beads (preferably magnetic beads in the DNA library (preferably genomic DNA library) construction reagent kit of the first aspect of the present invention), incubated, washed with ethanol, dried, and eluted.

[0178] In some embodiments, the volume ratio of the library amplification to the magnetic beads is 1:(0.7-1.1); more specifically, it is 1:(0.8-1).

[0179] In some embodiments, the mixing is homogenization.

[0180] In some embodiments, the incubation time is 5-15 min; further, 8-12 min; and even further, 9-11 min.

[0181] In some embodiments, the concentration of the ethanol is 70-90%; more particularly, it is 75-85%.

[0182] In some implementations, the cleaning is performed 1-3 times.

[0183] In some embodiments, the elution is performed using Low TE (evaporation-free-hybridization separated) or the hybridization reaction solution of the first aspect of the present invention (evaporation-free-hybridization integrated).

[0184] In some embodiments, the elution specifically involves adding Low TE or the hybridization reaction solution of the first aspect of the present invention, mixing well, and incubating (preferably incubating for 4-6 minutes).

[0185] A fourth aspect of the present invention provides a DNA targeting library obtained by the construction method of the third aspect of the present invention.

[0186] A fifth aspect of the present invention provides a sequencing method for sequencing a DNA-targeting library according to a fourth aspect of the present invention.

[0187] A sixth aspect of the present invention provides a product comprising a DNA-targeted library construction kit according to the first aspect of the present invention, and an automated library construction and hybridization workstation.

[0188] In some implementations, the automated library construction and hybridization workstation is a GIN16 automated library construction and hybridization workstation.

[0189] In some implementations, the product includes a system.

[0190] A seventh aspect of the present invention provides a DNA-targeting library construction system for performing the DNA-targeting library construction method of the third aspect of the present invention.

[0191] In some implementations, the system includes: a capture library construction module for constructing a capture library; The capture library construction module includes: a hybridization module for the specific binding of a target DNA fragment of the DNA library to a capture probe (preferably for performing the hybridization method in the third aspect of the invention).

[0192] In some embodiments, the capture library building module further includes a capture module for binding the hybridization complex to magnetic beads (preferably for performing the capture method in the third aspect of the invention).

[0193] In some embodiments, the capture library construction module further includes an elution module for removing non-specifically bound DNA or impurities (preferably for performing the elution method in the third aspect of the invention).

[0194] In some embodiments, the capture library construction module further includes a capture library amplification module for enriching a DNA library of the target region (preferably for performing the capture library amplification method in the third aspect of the invention).

[0195] In some embodiments, the system further includes a DNA library (preferably a genomic DNA library) construction module for constructing a DNA library (preferably a genomic DNA library).

[0196] In some embodiments, the DNA library (preferably a genomic DNA library) construction module includes: An end-repair and "A"-addition module for repairing and adding "A" to the ends of DNA fragments (preferably for performing the end-repair and "A"-addition method of the third aspect of the invention); and / or Adapter ligation module for ligating sequencing adapters to end-repaired and A-added DNA fragments (preferably for performing the adapter ligation method in the third aspect of the invention); and / or A purification module for removing impurities from the reaction system (preferably for performing the purification method of the third aspect of the invention); and / or A library amplification module for enriching DNA libraries containing ligation adapters (preferably for performing the library amplification method in the third aspect of the invention).

[0197] In some embodiments, when the method of mixing the DNA library (preferably a genomic DNA library), hybridization reaction solution, capture probe, and library blocking solution is described as c1), the system is a fully automated system.

[0198] In some embodiments, when the method of mixing the DNA library (preferably a genomic DNA library), hybridization reaction solution, capture probe, and library blocking solution is c1), and the method of obtaining the DNA library (preferably a genomic DNA library) by eluting it with the hybridization reaction solution is d1), the system is a fully automated system.

[0199] The beneficial effects of this invention are: This invention provides a DNA targeted library construction kit, comprising: a hybridization capture reagent assembly, wherein the hybridization capture reagent assembly includes a hybridization reaction solution, the hybridization reaction solution comprising: hybridization reaction solution 1 and hybridization reaction solution 2; hybridization reaction solution 1 comprises: betaine, tetramethylammonium chloride, and Mg 2+The hybridization reaction solution 2 contains formamide and N-methylpyrrolidone; it does not cause DNA fragments to clump together, which is beneficial for probe and library hybridization. The capture efficiency is better than existing hybridization reaction solutions, and it is compatible with different panel sizes and different hybridization times; even small panels can achieve high and relatively stable capture efficiency. The hybridization time is selectable from 1 to 20 hours, and the fast and slow mixing reagents are consistent, which is convenient for production and simultaneous operation of multiple products. This hybridization reaction solution is not only applicable to the current evaporation-free hybridization method, but also to the evaporation-free hybridization method, thereby achieving automated library preparation and hybridization. Furthermore, by limiting the volume ratio of the mixture of DNA library (preferably genomic DNA library) and hybridization reaction solution and the mixture of capture probes to the library blocking solution in the evaporation-free hybridization method, its capture efficiency can be made comparable to that of evaporation-free hybridization. Furthermore, when using this hybridization reaction solution for the evaporation-free hybridization method, one can choose between integrated hybridization and library preparation or separate hybridization: Integrated hybridization allows for a freely selectable library preparation throughput of 2-16, with no manual intervention required throughout the process; simply add the sample and reagents, wait for the reaction to complete, and collect the library. Hybridization time is freely selectable from 2-16 hours, and the intermediate library (i.e., the DNA library) is backed up for use in other tests or in case of instrument failure. Separate hybridization allows for a freely selectable library preparation throughput of 6-48, significantly increasing the upper limit of throughput, allowing for flexible combinations of hybridization bases, significantly reducing costs, and allowing for a freely selectable hybridization time of 2-16 hours. Multiple products can be run simultaneously. Furthermore, the kit also includes: a reagent combination for adapter ligation, comprising: a ligation reaction solution; the ligation reaction solution comprises: a buffer, magnesium ions, a thiol reducing agent, adenine nucleoside triphosphate (ATP), and propylene glycol; the ligation reaction solution does not contain polyethylene glycol (PEG), and propylene glycol is used to replace polyethylene glycol, thereby reducing the PEG content in the ligation reaction system and thus reducing the generation of chimeras.

[0200] This invention provides a method for constructing a DNA-targeted library. By using the above-mentioned hybridization reaction solution, the capture efficiency can be improved, and it is compatible with panels of different sizes and different hybridization times. Even small panels can achieve high and relatively stable capture efficiency. The hybridization time can be selected from 1 to 20 hours. The fast and slow hybridization reagents are consistent, which is convenient for production and simultaneous operation of multiple products. Meanwhile, by using the above-mentioned hybridization reaction solution for the evaporation-free hybridization method, library construction and hybridization can be automated. Furthermore, by limiting the volume ratio of the mixture of DNA library (preferably genomic DNA library) and hybridization reaction solution and the mixture of capture probe to library blocking solution in the evaporation-free hybridization method, its capture efficiency can be made comparable to that of evaporation-free hybridization. Furthermore, when using this hybridization reaction solution for the evaporation-free hybridization method, one can choose to perform hybridization in one step or separately: Furthermore, by using the above-mentioned connector to connect the reaction solution, the content of PEG in the connection reaction system can be reduced, thereby reducing the generation of chimeras; Furthermore, by increasing the molar ratio of joint to end repair and "A" added product, the joint connection efficiency can be significantly improved, while simplifying automated operation. Furthermore, based on a specific connector connection system, a higher connection efficiency can be achieved with a shorter response time, and the library construction time can be further shortened. This allows for automated library construction and hybridization to be completed in as little as 8 hours, making 24-hour delivery feasible. Furthermore, based on the above-mentioned connector connection reaction solution, which reduces the PEG content in the connector connection product, the content of magnetic beads can be increased when the PEG concentration in the mixed system is fixed, thereby reducing purification losses and improving template recovery rate. Furthermore, by limiting the concentration of primers used for library construction, the library yield can be increased while avoiding over-amplification. Attached Figure Description

[0201] Figure 1 The process of constructing a DNA-targeted library is shown. Figure 2 The intermediate library yields of Example 1 (Sample 1 of the present invention), Example 2 (Sample 2 of the present invention), Example 3 (Sample 3 of the present invention), Example 4 (Sample 4 of the present invention), Comparative Example 1 (Control Sample 1), Comparative Example 2 (Control Sample 2), Comparative Example 3 (Control Sample 3), and Comparative Example 4 (Control Sample 4) are shown.

[0202] Figure 3 Intermediate library yields for Examples 5 (Sample 5 of the present invention), 6 (Sample 6 of the present invention), 7 (Sample 7 of the present invention), 8 (Sample 8 of the present invention), Comparative Example 5 (Control Sample 5), Comparative Example 6 (Control Sample 6), Comparative Example 7 (Control Sample 7), and Comparative Example 8 (Control Sample 8) are shown.

[0203] Figure 4 The capture efficiency of Examples 9-11 and Comparative Example 9 is shown, and 0.5 mean is given.

[0204] Figure 5 The capture efficiency and 0.5 mean of Examples 12, 13 and Comparative Example 10 are shown.

[0205] Figure 6 The capture efficiency and 0.5 mean of Examples 9-11 and 14-22 are shown.

[0206] Figure 7 The effective sequencing depths of Example 23 (Sample 1 of the present invention), Example 24 (Sample 2 of the present invention), Example 25 (Sample 3 of the present invention), Example 26 (Sample 4 of the present invention), Comparative Example 11 (Control Sample 1), Comparative Example 12 (Control Sample 2), Comparative Example 13 (Control Sample 3), and Comparative Example 14 (Control Sample 4) are shown.

[0207] Figure 8 The effective sequencing depths of Example 27 (Sample 5 of the present invention), Example 28 (Sample 6 of the present invention), Example 29 (Sample 7 of the present invention), Example 30 (Sample 8 of the present invention), Comparative Example 15 (Control Sample 5), Comparative Example 16 (Control Sample 6), Comparative Example 17 (Control Sample 7), and Comparative Example 18 (Control Sample 8) are shown.

[0208] Figure 9 The capture efficiency and effective depth of Examples 31 (FFPE manual), 32 (cfDNA manual), 33 (FFPEGIN16), and 34 (cfDNA GIN16) are shown. Detailed Implementation

[0209] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly used in the field to which this invention pertains. For the purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural forms, and vice versa.

[0210] The present invention will be further described in detail below through specific embodiments.

[0211] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0212] Unless otherwise specified, experimental methods in the following examples are generally performed under standard conditions or as recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in these examples are commercially available. For reagents whose manufacturers are listed, similar products from other manufacturers are substituted.

[0213] The preparation methods for cfDNA samples in the following examples / comparative examples are as follows: 10 mL of whole blood was collected from lung cancer patients. The sample was collected using a cfDNA sample preservation tube (Kangwei Century, CW2815M). After centrifugation at 1600g for 10 min, the supernatant was collected, followed by centrifugation at 16000g for 10 min, and the supernatant was collected again to obtain a plasma sample. The separated plasma was then used to extract cfDNA samples using a nucleic acid extraction or purification kit (GenePlus, 120011304).

[0214] The preparation methods of FFPE DNA samples in the following examples / comparative examples are as follows: paraffin-embedded tumor tissue samples were collected from lung cancer patients, and FFPE DNA samples were extracted using a tissue paraffin section DNA extraction kit (Fanzhi, FG1103D-02).

[0215] Example 1: A method for constructing a cfDNA library ( Figure 2 Sample 1 of this invention A method for constructing a cfDNA library includes the following steps: 1. End-stage repair and adding "A" Add 50 ng of cfDNA sample to a 0.2 mL PCR tube, and use TE buffer to bring the volume to 50 μL. Prepare the reaction mixture in the PCR tube according to Table 1. Place the PCR tube in the PCR instrument and run the program as shown in Table 2.

[0216] Table 1. End-stage repair and "A" addition system

[0217] Note: The end-of-life repair reaction solution consists of the following components: 428mM Tris-HCl (pH 8), 85mM MgCl2, 85mM M KCl, 17mM TCEP, 7mM ATP, 10mM dNTP, and 0.1% Tween 20 (volume percentage). The terminal repair enzyme consists of four enzymes: T4 DNA polymerase (400 ng / μL, Novizan, T4 DNA polymerase, N101-01), T4 polynucleotide kinase (27 ng / μL, Novizan, T4 Polynucleotide Kinase, N102-01), Klenow enzyme (167 ng / μL, Novizan, DNA polymerase I Klenow fragment, N104-01), and Taq DNA polymerase (2 ng / μL, Takara, TaKaRa Taq). ™ (R001A).

[0218] Table 2. End-stage repair and "A" addition procedures

[0219] 2. Connector connection Prepare the reaction system in the PCR tubes according to Table 3. Place the PCR tubes in the PCR instrument and run the following program: without heat cap; 20℃ for 15 min; 4℃ Hold.

[0220] Table 3 Connector Connection System

[0221] Note: The connector is the connector in Table 2 of patent document CN 114317528 A; The ligation reaction solution consists of the following components: 133mM Tris-HCl (pH 7.6), 10mM MgCl2, 13mM TCEP, 1.67mM ATP, and 60% propylene glycol (volume percentage).

[0222] 3. Purification after adapter connection 3.1 Take out magnetic bead A (Yisheng, item number: 12601ES56) in advance, vortex thoroughly, equilibrate at room temperature for 30 minutes, and vortex again before use.

[0223] 3.2 Pipette 120 µL of magnetic bead A into a PCR tube containing the adapter ligation product, vortex for 10 s to mix, and incubate at room temperature for 10 min.

[0224] 3.3 After incubation, centrifuge the PCR tube briefly and place it on a magnetic rack for 5 minutes until the liquid is completely clear. Carefully remove the supernatant, being careful not to pick up the magnetic beads.

[0225] 3.4 Keep the PCR tube fixed on the magnetic rack, add 200 μL of freshly prepared 80% ethanol, rotate the tube wall 180° and let it stand for 2 min, then carefully remove the supernatant.

[0226] 3.5 Repeat step 3.4 once.

[0227] 3.6 After briefly centrifuging the PCR tubes, place them on a magnetic rack and use a 10 µL pipette tip to remove any residual ethanol.

[0228] 3.7 Open the PCR tube cap and let it stand at room temperature for 5 minutes until the surface of the magnetic beads is no longer reflective.

[0229] 3.8 Remove the PCR tube from the magnetic rack, add 22 µL of enzyme-free water to the PCR tube, vortex for 10 s to mix, and incubate at room temperature for 5 min.

[0230] 3.9 After briefly centrifuging the PCR tube, place it on a magnetic rack and let it stand for 5 min until the liquid is completely clear. Then, carefully transfer 20 μL of the supernatant into a new PCR tube.

[0231] 4. Library amplification Prepare the reaction system in the PCR tubes according to Table 4. Place the PCR tubes in the PCR instrument and run the program as shown in Table 5.

[0232] Table 4 Library amplification system

[0233] Note: The primers used for library construction are those used in Example 3 of patent document CN 114317528 A.

[0234] Table 5 Library amplification procedures

[0235] 5. Library purification 5.1 Take out magnetic bead A (Yisheng, item number: 12601ES56) in advance, vortex thoroughly, equilibrate at room temperature for 30 minutes, and vortex again before use.

[0236] 5.2 Pipette 45 µL of magnetic bead A into a PCR tube containing the amplification product, vortex for 10 s to mix, and incubate at room temperature for 10 min.

[0237] 5.3 After incubation, centrifuge the PCR tube briefly and place it on a magnetic rack for 5 minutes until the liquid is completely clear. Carefully remove the supernatant, being careful not to pick up the magnetic beads.

[0238] 5.4 Keep the PCR tube fixed on the magnetic rack, add 200 µL of freshly prepared 80% ethanol, rotate the tube wall 180° and let it stand for 2 min, then carefully remove the supernatant.

[0239] 5.5 Repeat step 5.4 once.

[0240] 5.6 After briefly centrifuging the PCR tubes, place them on a magnetic rack and use a 10 µL pipette tip to remove any residual ethanol.

[0241] 5.7 Open the PCR tube cap and let it stand at room temperature for 5 minutes until the surface of the magnetic beads is no longer reflective.

[0242] 5.8 Remove the PCR tube from the magnetic rack, add 60 µL of Low TE to the PCR tube, vortex for 10 s to mix, and incubate at room temperature for 5 min.

[0243] 5.9 After the PCR tube is briefly centrifuged, place it on a magnetic rack and let it stand for 5 min until the liquid is completely clear. Then carefully transfer 59 μL of supernatant into a new 1.5 mL centrifuge tube.

[0244] Example 2: A method for constructing a cfDNA library ( Figure 2Sample 2 of this invention A method for constructing a cfDNA library is the same as in Example 1, except that the cfDNA sample is different.

[0245] Example 3 A method for constructing a cf DNA library ( Figure 2 Sample 3 of this invention A method for constructing a cf DNA library is the same as in Example 1, except that the cf DNA sample is different.

[0246] Example 4: A method for constructing a cf DNA library ( Figure 2 Sample 4 of this invention A method for constructing a cf DNA library is the same as in Example 1, except that the cf DNA sample is different.

[0247] Example 5: A method for constructing an FFPE DNA library ( Figure 3 Sample 5 of this invention A method for constructing an FFPE DNA library is the same as in Example 1, except that the sample is FFPE DNA. Fragmentation is required before library construction. The specific steps are as follows: Add 500 ng of FFPE DNA sample to the fragmentation tube of the DNA fragmentation instrument, and use TE buffer to bring the volume to 55 μL; use the fragmentation instrument (Bioruptor Pico) for fragmentation with parameters of 30s on / 30s off, 30 cycles; use a biological fragment analyzer (Guangding Biotech Qsep100) to control fragment size. If the main peak is too large, repeat the fragmentation until the main peak size is between 100-400 bp. The number of cycles for "denaturation-renaturation-extension" in Table 5 is 9.

[0248] Example 6: A method for constructing an FFPE DNA library ( Figure 3 Sample 6 of this invention An FFPE DNA library construction method is the same as in Example 5, except that the FFPE DNA sample is different.

[0249] Example 7: A method for constructing an FFPE DNA library ( Figure 3 Sample 7 of this invention An FFPE DNA library construction method is the same as in Example 5, except that the FFPE DNA sample is different.

[0250] Example 8: A method for constructing an FFPE DNA library ( Figure 3 Sample 8 of this invention An FFPE DNA library construction method is the same as in Example 5, except that the FFPE DNA sample is different.

[0251] Example 9: A method for constructing an FFPE DNA-targeting library ( Figure 4 Reagent T36 2h, Figure 6 188 probe - 2h tissue) A method for constructing FFPE DNA-targeting libraries ( Figure 1 ), which includes the following steps: 1. DNA Fragmentation: Add 200 ng FFPE DNA sample to the fragmentation tube of the DNA fragmentation instrument, and use TE to bring the volume to 55 μL; use the fragmentation instrument (Bioruptor Pico) for fragmentation with the parameters 30s on / 30s off, 30 cycles; use a biological fragment analyzer (Guangding Biotech Qsep100) to control the fragment size. If the main peak of the fragment is too large, repeat the fragmentation until the main peak size is between 100-400 bp. 2. End-stage repair and adding "A" Prepare the reaction system in the PCR tubes according to Table 6. Place the PCR tubes in the PCR instrument and run the program as shown in Table 7.

[0252] Table 6 End-stage remediation and "A" addition system

[0253] Note: The end-of-life repair reaction solution consists of the following components: 428mM Tris-HCl (pH 8), 85mM MgCl2, 85mM M KCl, 17mM TCEP, 7mM ATP, 10mM dNTP, and 0.1% Tween 20 (volume percentage). The terminal repair enzyme consists of four enzymes: T4 DNA polymerase (400 ng / μL, Novizan, T4 DNA polymerase, N101-01), T4 polynucleotide kinase (27 ng / μL, Novizan, T4 Polynucleotide Kinase, N102-01), Klenow enzyme (167 ng / μL, Novizan, DNA polymerase I Klenow fragment, N104-01), and Taq DNA polymerase (2 ng / μL, Takara, TaKaRa Taq). ™ (R001A).

[0254] Table 7 End-point repair and "A" addition procedures

[0255] 3. Connector connection Prepare the reaction system in the PCR tubes according to Table 8. Place the PCR tubes in the PCR instrument and run the following program: without heat cap; 20℃ for 15 min; 4℃ Hold.

[0256] Table 8 Connector Connection System

[0257] Note: The connector is the connector in Table 2 of patent document CN 114317528 A; The ligation reaction solution consists of the following components: 133mM Tris-HCl (pH 7.6), 10mM MgCl2, 13mM TCEP, 1.67mM ATP, and 60% propylene glycol (volume percentage).

[0258] 4. Purification after adapter connection 4.1 Take out magnetic bead A (Yisheng, item number: 12601ES56) in advance, vortex thoroughly, equilibrate at room temperature for 30 minutes, and vortex again before use.

[0259] 4.2 Pipette 120 µL of magnetic bead A into a PCR tube containing the adapter ligation product, vortex for 10 s to mix, and incubate at room temperature for 10 min.

[0260] 4.3 After incubation, centrifuge the PCR tube briefly and place it on a magnetic rack for 5 minutes until the liquid is completely clear. Carefully remove the supernatant, being careful not to pick up the magnetic beads.

[0261] 4.4 Keep the PCR tube fixed on the magnetic rack, add 200 μL of freshly prepared 80% ethanol, rotate the tube wall 180 degrees and let it stand for 2 min, then carefully remove the supernatant.

[0262] 4.5 Repeat step 4.4 once.

[0263] 4.6 After briefly centrifuging the PCR tubes, place them on a magnetic rack and use a 10 µL pipette tip to remove any residual ethanol.

[0264] 4.7 Open the PCR tube cap and let it stand at room temperature for 5 minutes until the surface of the magnetic beads is no longer reflective.

[0265] 4.8 Remove the PCR tube from the magnetic rack, add 22 µL of enzyme-free water to the PCR tube, vortex for 10 s to mix, and incubate at room temperature for 5 min.

[0266] 4.9 After briefly centrifuging the PCR tube, place it on a magnetic rack and let it stand for 5 min until the liquid is completely clear. Then, carefully transfer 20 μL of the supernatant into a new PCR tube.

[0267] 5. Library amplification Prepare the reaction system in the PCR tubes according to Table 9. Place the PCR tubes in the PCR instrument and run the program as shown in Table 10.

[0268] Table 9 Library amplification system

[0269] Note: The primers used for library construction are those used in Example 3 of patent document CN 114317528 A.

[0270] Table 10 Library Augmentation Procedures

[0271] 6. Library purification 6.1 Take out magnetic bead A (Yisheng, item number: 12601ES56) in advance, vortex thoroughly, equilibrate at room temperature for 30 minutes, and vortex again before use.

[0272] 6.2 Pipette 45 µL of magnetic bead A into a PCR tube containing the amplification product, vortex for 10 s to mix, and incubate at room temperature for 10 min.

[0273] 6.3 After incubation, centrifuge the PCR tube briefly and place it on a magnetic rack for 5 minutes until the liquid is completely clear. Carefully remove the supernatant, being careful not to pick up the magnetic beads.

[0274] 6.4 Keep the PCR tube fixed on the magnetic rack, add 200 µL of freshly prepared 80% ethanol, rotate the tube wall 180 degrees and let it stand for 2 min, then carefully remove the supernatant.

[0275] 6.5 Repeat step 6.4 once.

[0276] 6.6 After briefly centrifuging the PCR tubes, place them on a magnetic rack and use a 10 µL pipette tip to remove any residual ethanol.

[0277] 6.7 Open the PCR tube cap and let it stand at room temperature for 5 minutes until the surface of the magnetic beads is no longer reflective.

[0278] 6.8 Remove the PCR tube from the magnetic rack, add 15 µL of the library return solution shown in Table 11 to the PCR tube, vortex for 10 s to mix, and incubate at room temperature for 5 min.

[0279] Table 11 Library Return Solution

[0280] Note: Hybridization reaction solution 1 (hyb#1) contains: betaine (3M), tetramethylammonium chloride (2M), Mg 2+ (Magnesium acetate, 30mM), Triton X-100 (0.01%, volume percentage); Hybridization reaction solution 2 (hyb#2) contains: formamide (77.78%, volume percentage) and N-methylpyrrolidone (22.22%, volume percentage).

[0281] 6.9 After the PCR tube is briefly centrifuged, place it on a magnetic rack and let it stand for 5 min until the liquid is completely clear. Then carefully transfer 13 μL of supernatant into a new 1.5 mL centrifuge tube.

[0282] 7. Hybridization Prepare the library blocking mixture in 1.5 mL centrifuge tubes according to Table 12. Open the tube cap and place it in a vacuum concentrator. Concentrate and dry at 60°C. After the liquid is completely evaporated, remove it and centrifuge briefly. Do not over-dry.

[0283] Table 12 Library Blocking Mixture

[0284] Add 13 µL of supernatant and 4 µL of 188 probe (GenePlus, catalog number: M0163) from step 6 to the bottom of a pre-vacuum concentrated and dried centrifuge tube, vortex to mix, briefly centrifuge, and incubate at room temperature for 10 min. Vortex the incubated product and briefly centrifuge. Add 17 µL of the product (Mg) from the centrifuge tube to the bottom of the tube. 2+ Transfer the entire amount of magnesium acetate (at a concentration of 15 mM) into a new 0.2 mL PCR tube and centrifuge briefly. Place the PCR tube in a PCR instrument and run the program shown in Table 13.

[0285] Table 13 Hybridization Procedure

[0286] 8. Washing the magnetic beads 8.1 Remove magnetic bead B (Invitrogen part number: 35302) in advance, vortex thoroughly, and equilibrate at room temperature for at least 30 minutes. Vortex thoroughly again before use.

[0287] 8.2 Pipette 10 μL of magnetic bead B into a new 1.5 mL centrifuge tube. The three magnetic beads (30 μL) from the capture reaction can be resuspended simultaneously in a 1.5 mL centrifuge tube.

[0288] 8.3 Add 100 μL of magnetic bead cleaning solution to the centrifuge tube (300 μL for 3 capture reactions), vortex for 15 s, centrifuge briefly, place on a magnetic rack for 1 min, and wait until the liquid is completely clear. Carefully discard the supernatant, being careful not to aspirate the magnetic beads. Remove the centrifuge tube from the magnetic rack. The magnetic bead cleaning solution contains: 5 mM Tris-HCl, 0.5 mM EDTA, 1 M NaCl, and 0.1% (v / v) Tween 20.

[0289] 8.4 Repeat step 8.3 twice.

[0290] 8.5 After briefly centrifuging the centrifuge tubes, place them on a magnetic rack and remove any residual liquid using a 10 µL pipette tip.

[0291] 8.6 Add 17 μL of magnetic bead suspension to each centrifuge tube (51 μL for 3 capture reactions), vortex for 15 s, and transfer all magnetic bead suspension to a new 0.2 mL PCR tube, 17 μL / tube. The magnetic bead suspension contains 8.5 μL of hybridization reaction solution 1 (hyb#1), 2.7 μL of hybridization reaction solution 2 (hyb#2), and 5.8 μL of enzyme-free water.

[0292] 8.7 Place the PCR tube containing the magnetic bead suspension into the PCR instrument and incubate at 65°C for 5 min.

[0293] 9. Capture 9.1 Immediately after the hybridization reaction is complete, add the preheated magnetic bead B (product of step 8) to the hybridization system (product of step 7), vortex for 3 seconds to mix thoroughly, and place in a PCR instrument to start the hybridization capture program as follows: heated cap 70℃; reaction conditions: 65℃ for 15 min; 65℃ Hold. Vortex rapidly for 3 seconds at 7.5 min intervals to ensure complete resuspension of the magnetic beads and avoid liquid splashing onto the tube cap as much as possible.

[0294] 10. Washing 10.1 Hot washing 10.1.1 After the sample and magnetic beads have been incubated, add 100 μL of preheated elution reaction solution I (1×SSC, 0.01% (v / v) SDS) to the PCR tube containing magnetic beads B and hybridization products from step 3, and mix thoroughly by pipetting twice.

[0295] 10.1.2 Place the PCR tube on a magnetic rack for 4 seconds. Once the liquid has completely clarified, discard the supernatant.

[0296] 10.1.3 Transfer the PCR tube from the magnetic rack to a 65°C constant temperature mixer, add 150 μL of preheated elution reaction solution S (1×SSC, 0.1% (v / v) Tween20), and incubate at 1200 rpm for 5 min.

[0297] 10.1.4 After briefly centrifuging the PCR tube, place it on a magnetic rack for 4 seconds. Once the liquid has completely clarified, discard the supernatant.

[0298] 10.1.5 Repeat the above steps, adding 150 μL of preheated elution reaction solution S to wash once.

[0299] 10.2 Elution at room temperature 10.2.1 Set the constant temperature mixer to 1200 rpm and 25℃; 10.2.2 Add 150 μL of room temperature elution reaction solution I, place it on a constant temperature mixer and mix at 1200 rpm and 25°C for 2 min (vortex for 30 s, let stand for 30 s). After the PCR tube is centrifuged briefly, place it on a magnetic rack for 1 min. After the liquid is completely clear, discard the supernatant.

[0300] 10.2.3 Add 150 μL of room temperature elution reaction solution II (0.5×SSC, 0.1% (v / v) Tween20), place it on a constant temperature mixer and oscillate at 1200 rpm and 25°C for 2 min. After the PCR tube is briefly centrifuged, place it on a magnetic rack for 1 min. After the liquid is completely clear, discard the supernatant.

[0301] 10.2.4 Add 150 μL of room temperature elution reaction solution III (0.2×SSC), place it on a constant temperature mixer and oscillate at 1200 rpm and 25°C for 2 min. After the PCR tube is briefly centrifuged, place it on a magnetic rack for 1 min. After the liquid is completely clear, discard the supernatant.

[0302] 10.2.5 After briefly centrifuging the PCR tube, remove the residual liquid using a 10 µL pipette tip.

[0303] 10.2.6 Remove the PCR tube from the magnetic rack, add 20 μL of enzyme-free water, vortex for 10 s, and centrifuge briefly.

[0304] 11. Capture Library Amplification Prepare the capture library amplification system in centrifuge tubes according to Table 14. Add the obtained system to the DNA suspension containing magnetic beads (product of step 10), vortex to mix and then briefly centrifuge. Place the above PCR tubes in a PCR instrument, and the reaction program is shown in Table 15.

[0305] Table 14 Capture Library Amplification System

[0306] Note: The amplification primers are as follows: MGI-Du-F: TCTCAGTTACGTCAGCAGTT, SEQ ID NO:1; MGI-Du-R: GGCATGGCGACCTTATCAG, SEQ ID NO:2.

[0307] Table 15 Reaction Procedure

[0308] 12. Capture Library Purification 12.1 Take out magnetic bead A in advance, vortex thoroughly, and equilibrate at room temperature for at least 30 min. Vortex again before use. Transfer 60 μL of magnetic bead A into a new PCR tube.

[0309] 12.2 After PCR amplification is complete, the PCR tube is briefly centrifuged and then placed on a magnetic rack to stand for 5 minutes until the solution becomes clear.

[0310] 12.3 Transfer the supernatant to a PCR tube containing magnetic bead A, vortex for 10 s to mix, and incubate at room temperature for 10 min.

[0311] 12.4 After incubation, centrifuge the PCR tube briefly and place it on a magnetic rack for 5 minutes. Once the liquid is completely clear, carefully discard the supernatant, being careful not to pick up the magnetic beads.

[0312] 12.5 Keep the PCR tube fixed on the magnetic rack, add 200 μL of freshly prepared 80% ethanol, let stand for 30 s, and carefully remove the supernatant.

[0313] 12.6 Repeat step 12.5 once.

[0314] 12.7 After briefly centrifuging the PCR tubes, place them on a magnetic rack and use a 10 µL pipette tip to remove any residual ethanol.

[0315] 12.8 Open the PCR tube cap and let it stand at room temperature for 5 minutes until the surface of the magnetic beads is non-reflective.

[0316] 12.9 Remove the PCR tube from the magnetic rack, add 22 µL of DNA dissolving solution to the PCR tube, vortex for 10 s to mix, and incubate at room temperature for 5 min.

[0317] 12.10 After the PCR tube is briefly centrifuged, place it on a magnetic rack and let it stand for 5 min until the liquid is completely clear. Then carefully transfer 20 μL of the supernatant into a new 1.5 mL centrifuge tube.

[0318] 13. Library quantification and sequencing The above-mentioned library was quantitatively analyzed using Qubit and then sent to Geneplus Medical Laboratory sequencing facility for sequencing.

[0319] Example 10: A method for constructing an FFPE DNA-targeting library ( Figure 4 Reagent T36 4h, Figure 6 188 probe - 4h tissue) A method for constructing an FFPE DNA targeted library is the same as in Example 9, except that “2h” is replaced with “4h” in Table 13.

[0320] Example 11: A method for constructing an FFPE DNA-targeting library ( Figure 4 Reagent T36 was evaporated to dryness and left overnight. Figure 6 188 probe - 16h tissue) A method for constructing an FFPE DNA library is the same as in Example 9, except that "2h" is replaced with "16h" in Table 13. The intermediate library is evaporated to dryness before hybridization. The specific steps are as follows: 1) 6.8 Remove the PCR tube from the magnetic rack, add 60 µL Low TE to the PCR tube, vortex for 10 s to mix, and incubate at room temperature for 5 min.

[0321] 2) After the 6.9 PCR tube is briefly centrifuged, it is placed on a magnetic rack and left to stand for 5 min. After the liquid is completely clear, carefully transfer 59 μL of supernatant into a new 1.5 mL centrifuge tube.

[0322] 3) 7. Hybridization Remove the Cot-1 DNA and universal Blocker, thaw them, vortex to mix, briefly centrifuge, and place on an ice box. The preparation system is shown in Table 16. Mix each component in a 1.5 mL centrifuge tube according to Table 16, vortex to mix, briefly centrifuge, open the tube cap and place it in a vacuum concentrator, concentrate and dry at 60℃ (40 min). After the liquid is completely evaporated, remove it and briefly centrifuge, do not over-dry.

[0323] Table 16 Library Condensation System

[0324] Take out hybridization reaction solution 1 (hyb#1) and hybridization reaction solution 2 (hyb#2) from Example 9, thaw them, vortex to mix, briefly centrifuge, and place them on an ice box to prepare the hybridization reaction solution in Table 17. After mixing the hybridization reaction solution evenly, add it to the bottom of a vacuum-concentrated and dried centrifuge tube, vortex to mix, briefly centrifuge, and incubate at room temperature for 10 min. Vortex to mix the incubated product and briefly centrifuge. Transfer all 17 µL of product from the centrifuge tube to a new 0.2 mL PCR tube and briefly centrifuge. Place the above PCR tube in a PCR instrument and run the program shown in Table 13 (replace "2h" with "16h").

[0325] Table 17 Hybridization reaction solution

[0326] Example 12: A method for constructing an FFPE DNA-targeting library ( Figure 5 15mM magnesium) An FFPE DNA library construction method is the same as in Example 9, except that "2h" is replaced with "1h" in Table 13.

[0327] Example 13 A method for constructing an FFPE DNA-targeting library ( Figure 5 50mM magnesium) A method for constructing an FFPE DNA library is the same as in Example 12, except that the Mg in hybridization reaction solution 1 (hyb#1) in Table 11 is different. 2+ The concentration of (magnesium acetate) should be replaced with 100 mM (Mg). 2+ The concentration of the product was 50 mM.

[0328] Example 14: A method for constructing a cfDNA targeted library ( Figure 6 188 2h plasma) A method for constructing a cfDNA targeted library is the same as in Example 9, except that the FFPE DNA sample is replaced with a 30 ng cfDNA sample, and the sample does not need to be fragmented.

[0329] Example 15: A method for constructing a cfDNA targeted library ( Figure 6 188 4h plasma) A method for constructing a cfDNA targeted library is the same as in Example 10, except that the FFPE DNA sample is replaced with a 30 ng cfDNA sample, and the sample does not need to be fragmented.

[0330] Example 16: A method for constructing a cfDNA targeted library ( Figure 6 188 16h plasma) A method for constructing a cfDNA targeted library is the same as in Example 11, except that the FFPE DNA sample is replaced with a 30 ng cfDNA sample, and the sample does not need to be fragmented.

[0331] Example 17 A method for constructing a cfDNA targeted library ( Figure 6 mf 2h plasma) A method for constructing a cfDNA targeted library is the same as in Example 14, except that the 188 probe is replaced with the mf probe (GenePlus catalog number: B0759-48), and the number of cycles for "denaturation-renaturation-extension" in Table 15 is 19.

[0332] Example 18: A method for constructing a cfDNA targeted library ( Figure 6 MF 4h plasma) A method for constructing a cfDNA targeted library is the same as in Example 15, except that the 188 probe is replaced with the mf probe (GenePlus catalog number: B0759-48), and the number of cycles for "denaturation-renaturation-extension" in Table 15 is 19.

[0333] Example 19 A method for constructing a cfDNA targeted library ( Figure 6 MF 16h plasma) A method for constructing a cfDNA targeted library is the same as in Example 16, except that the 188 probe is replaced with the mf probe (GenePlus catalog number: B0759-48), and the number of cycles for "denaturation-renaturation-extension" in Table 15 is 19.

[0334] Example 20: A method for constructing an FFPE DNA-targeting library ( Figure 6 1021 2h organization) A method for constructing an FFPE DNA targeted library is the same as in Example 9, except that the 188 probe is replaced with the 1021 probe (GenePlus, catalog number: M0033).

[0335] Example 21: A method for constructing an FFPE DNA-targeting library ( Figure 6 1021 4h organization) A method for constructing an FFPE DNA targeted library is the same as in Example 10, except that the 188 probe is replaced with the 1021 probe (GenePlus, catalog number: M0033).

[0336] Example 22: A method for constructing an FFPE DNA-targeting library ( Figure 6 1021 16h organization) A method for constructing an FFPE DNA targeted library is the same as in Example 11, except that the 188 probe is replaced with the 1021 probe (GenePlus, catalog number: M0033).

[0337] Example 23 A method for constructing a cfDNA targeted library ( Figure 7 Sample 1 of this invention A method for constructing a cfDNA targeting library includes the following steps: 1. Hybridization Prepare the library concentration system in centrifuge tubes according to Table 18. Open the tube caps and place them in a vacuum concentrator. Concentrate and dry at 60°C. After the liquid has completely evaporated, remove the tubes and centrifuge briefly. Do not over-dry.

[0338] Table 18 Library Condensation System

[0339] Prepare the hybridization reaction solution in centrifuge tubes according to Table 19. After mixing the hybridization reaction solution thoroughly, add it to the bottom of a centrifuge tube that has been vacuum concentrated and dried, vortex to mix, and centrifuge briefly. Incubate at room temperature for 10 min. Vortex the incubated product and centrifuge briefly. Transfer all 17 µL of product from the centrifuge tube to a new 0.2 mL PCR tube and centrifuge briefly. Place the PCR tube in a PCR instrument and run the program shown in Table 20.

[0340] Table 19 Hybridization reaction solution

[0341] Note: Hybridization reaction solution 1 (hyb#1) contains: betaine (3M), tetramethylammonium chloride (2M), Mg 2+ (Magnesium acetate, 30mM), Triton X-100 (0.01%, volume percentage); Hybridization reaction solution 2 (hyb#2) contains: formamide (77.78%, volume percentage) and N-methylpyrrolidone (22.22%, volume percentage).

[0342] Table 20 Hybridization Procedure

[0343] 2. Washing the magnetic beads 2.1 Remove magnetic bead B (Invitrogen part number: 35302) in advance, vortex thoroughly, and equilibrate at room temperature for at least 30 minutes. Vortex thoroughly again before use.

[0344] 2.2 Pipette 10 μL of magnetic bead B into a new 1.5 mL centrifuge tube. The three magnetic beads (30 μL) from the capture reaction can be resuspended simultaneously in a 1.5 mL centrifuge tube.

[0345] 2.3 Add 100 μL of magnetic bead cleaning solution to the centrifuge tube (300 μL for 3 capture reactions), vortex for 15 s, centrifuge briefly, place on a magnetic rack for 1 min, and wait until the liquid is completely clear. Carefully discard the supernatant, being careful not to aspirate the magnetic beads. Remove the centrifuge tube from the magnetic rack. The magnetic bead cleaning solution contains: 5 mM Tris-HCl, 0.5 mM EDTA, 1 M NaCl, and 0.1% Tween 20.

[0346] 2.4 Repeat step 2.3 twice.

[0347] 2.5 After briefly centrifuging the centrifuge tubes, place them on a magnetic rack and use a 10 µL pipette tip to remove any residual liquid.

[0348] 2.6 Add 17 μL of magnetic bead suspension to each centrifuge tube (the total amount for 3 capture reactions should be 51 μL), vortex to mix for 15 s, and transfer all the magnetic bead suspension to a new 0.2 mL PCR tube, 17 μL / tube. The magnetic bead suspension contains 8.5 μL of hybridization reaction solution 1 (hyb#1), 2.7 μL of hybridization reaction solution 2 (hyb#2), and 5.8 μL of enzyme-free water.

[0349] 2.7 Place the PCR tube containing the magnetic bead suspension into the PCR instrument and incubate at 65°C for 5 min.

[0350] 3. Capture 3.1 Immediately after the hybridization reaction is complete, add the preheated magnetic bead B (product of step 2) to the hybridization system (product of step 1), vortex for 3 s to mix thoroughly, and place in the PCR instrument to start the hybridization capture program as follows: hot lid 70℃; reaction conditions: 65℃ 45 min; 65℃ Hold.

[0351] 3.2 Incubate at 65℃ for 15 min, then vortex rapidly for 3 s at 7.5 min intervals to ensure the magnetic beads are completely resuspended and to minimize liquid impact on the tube cap.

[0352] 4. Washing 4.1 Hot washing 4.1.1 After the sample and magnetic beads have been incubated, add 100 μL of preheated elution reaction solution I (1×SSC, 0.01%SDS) to the PCR tube containing magnetic beads B and hybridization products from step 3, and mix thoroughly by pipetting twice.

[0353] 4.1.2 Place the PCR tube on a magnetic rack for 4 seconds. Once the liquid has completely clarified, discard the supernatant.

[0354] 4.1.3 Transfer the PCR tube from the magnetic rack to a 65°C constant temperature mixer, add 150 μL of preheated elution reaction solution S (1×SSC, 0.1% Tween20), and incubate at 1200 rpm for 5 min.

[0355] 4.1.4 After briefly centrifuging the PCR tube, place it on a magnetic rack for 4 seconds. Once the liquid is completely clear, discard the supernatant.

[0356] 4.1.5 Repeat the above steps, adding 150 μL of preheated elution reaction solution S to wash once.

[0357] 4.2 Elution at room temperature 4.2.1 Set the constant temperature mixer to 1200 rpm and 25℃; 4.2.2 Add 150 μL of room temperature elution reaction solution I, place it on a constant temperature mixer and mix at 1200 rpm and 25°C for 2 min (vortex for 30 s, let stand for 30 s). After the PCR tube is briefly centrifuged, place it on a magnetic rack for 1 min. After the liquid is completely clear, discard the supernatant.

[0358] 4.2.3 Add 150 μL of room temperature elution reaction solution II (0.5×SSC, 0.1% Tween20), place it on a constant temperature mixer and oscillate at 1200 rpm and 25°C for 2 min. After the PCR tube is briefly centrifuged, place it on a magnetic rack for 1 min. After the liquid is completely clear, discard the supernatant.

[0359] 4.2.4 Add 150 μL of room temperature elution reaction solution III (0.2×SSC), place it on a constant temperature mixer and oscillate at 1200 rpm and 25°C for 2 min. After the PCR tube is briefly centrifuged, place it on a magnetic rack for 1 min. After the liquid is completely clear, discard the supernatant.

[0360] 4.2.5 After briefly centrifuging the PCR tube, remove the residual liquid using a 10 µL pipette tip.

[0361] 4.2.6 Remove the PCR tube from the magnetic rack, add 20 μL of enzyme-free water, vortex for 10 s, and centrifuge briefly.

[0362] 5. Capture Library Amplification Prepare the capture library amplification system in centrifuge tubes according to Table 21. Add the obtained system to the DNA suspension containing magnetic beads (product of step 4), vortex to mix and then briefly centrifuge. Place the above PCR tubes in a PCR instrument, and the reaction program is shown in Table 22.

[0363] Table 21 Capture Library Amplification System

[0364] Note: The amplification primers are as follows: MGI-Du-F: TCTCAGTTACGTCAGCAGTT, SEQ ID NO:1; MGI-Du-R: GGCATGGCGACCTTATCAG, SEQ ID NO:2.

[0365] Table 22 Reaction Procedure

[0366] 6. Capture library purification 6.1 Remove magnetic bead A in advance, vortex thoroughly, and equilibrate at room temperature for at least 30 min. Vortex again before use. Transfer 60 μL of magnetic bead A to a new PCR tube.

[0367] 6.2 After PCR amplification is complete, the PCR tube is briefly centrifuged and then placed on a magnetic rack to stand for 5 minutes until the solution becomes clear.

[0368] 6.3 Transfer the supernatant to a PCR tube containing magnetic bead A, vortex for 10 s to mix, and incubate at room temperature for 10 min.

[0369] 6.4 After incubation, centrifuge the PCR tube briefly and place it on a magnetic rack for 5 minutes. Once the liquid is completely clear, carefully remove the supernatant, being careful not to pick up the magnetic beads.

[0370] 6.5 Keep the PCR tube fixed on the magnetic rack, add 200 μL of freshly prepared 80% ethanol, let stand for 30 s, and carefully remove the supernatant.

[0371] 6.6 Repeat step 6.5 once.

[0372] 6.7 After briefly centrifuging the PCR tubes, place them on a magnetic rack and use a 10 µL pipette tip to remove any residual ethanol.

[0373] 6.8 Open the PCR tube cap and let it stand at room temperature for 5 minutes until the surface of the magnetic beads is no longer reflective.

[0374] 6.9 Remove the PCR tube from the magnetic rack, add 22 µL of DNA dissolving solution to the PCR tube, vortex for 10 s to mix, and incubate at room temperature for 5 min.

[0375] 6.10 After the PCR tube is briefly centrifuged, place it on a magnetic rack and let it stand for 5 min until the liquid is completely clear. Then carefully transfer 20 μL of the supernatant into a new 1.5 mL centrifuge tube.

[0376] 7. Library quantification and sequencing The above-mentioned library was quantitatively analyzed using Qubit and then sent to Geneplus Medical Laboratory sequencing facility for sequencing.

[0377] Example 24: A method for constructing a cfDNA targeted library ( Figure 7 Sample 2 of this invention A method for constructing a cfDNA-targeting library is the same as in Example 23, except that the library in Table 18 is the library obtained in Example 2.

[0378] Example 25: A method for constructing a cfDNA targeted library ( Figure 7 Sample 3 of this invention A method for constructing a cfDNA targeted library is the same as in Example 23, except that the library in Table 18 is the library obtained in Example 3, the probe in Table 19 is the 188 probe (GenePlus, catalog number: M0163), and the number of cycles for "denaturation-renaturation-extension" in Table 22 is 15.

[0379] Example 26: A method for constructing a cfDNA targeted library ( Figure 7 Sample 4 of this invention A method for constructing a cfDNA targeted library is the same as in Example 23, except that the library in Table 18 is the library obtained in Example 4, the probe in Table 19 is the 188 probe (GenePlus, catalog number: M0163), and the number of cycles for "denaturation-renaturation-extension" in Table 22 is 15.

[0380] Example 27 A method for constructing an FFPE DNA-targeting library ( Figure 8 Sample 5 of this invention A method for constructing an FFPE DNA-targeting library is the same as in Example 25, except that the library in Table 18 is the library obtained in Example 5.

[0381] Example 28: A method for constructing an FFPE DNA-targeting library ( Figure 8 Sample 6 of this invention A method for constructing an FFPE DNA-targeting library is the same as in Example 25, except that the library in Table 18 is the library obtained in Example 6.

[0382] Example 29: A method for constructing an FFPE DNA-targeting library ( Figure 8 Sample 7 of this invention A method for constructing an FFPE DNA targeted library is the same as that in Example 25, except that the library in Table 18 is the library obtained in Example 7, and the probe in Table 19 is the 1021 probe (GenePlus, catalog number: M0033).

[0383] Example 30: A method for constructing an FFPE DNA-targeting library ( Figure 8 Sample 8 of this invention A method for constructing an FFPE DNA targeted library is the same as that in Example 25, except that the library in Table 18 is the library obtained in Example 8, and the probe in Table 19 is the 1021 probe (GenePlus, catalog number: M0033).

[0384] Example 31: A method for constructing an FFPE DNA-targeting library ( Figure 9 FFPE (handmade) A method for constructing an FFPE DNA targeted library is the same as in Example 9, except that the starting amount of FFPE DNA is 30 ng and the number of cycles for "denaturation-renaturation-extension" in Table 10 is 9.

[0385] Example 32: A method for constructing a cfDNA targeted library ( Figure 9 (cfDNA handmade) A method for constructing a cfDNA targeted library is the same as in Example 9, except that the FFPE DNA sample is replaced with a 30 ng cfDNA sample, and the sample does not need to be fragmented.

[0386] Example 33: A method for constructing an FFPE DNA-targeting library ( Figure 9 FFPE GIN16) A method for constructing an FFPE DNA targeted library is the same as in Example 31, except that a GIN16 automated library construction script is used instead of manual operation.

[0387] Example 34 A method for constructing a cfDNA targeted library ( Figure 9 cfDNA GIN16) A method for constructing a cfDNA targeted library is the same as in Example 32, except that a GIN16 automated library construction script is used instead of manual operation.

[0388] Comparative Example 1: A method for constructing a cfDNA library ( Figure 2 Control Sample 1) A method for constructing a cfDNA library was disclosed, using the Yisheng Bio All-Purpose DNA Library Construction Kit (Cat No. 12201). The method followed the instructions, with the following differences: the sample was the cfDNA sample from Example 1; the adapters in the adapter ligation system were the adapters listed in Table 2 of patent document CN 114317528 A (2 μL, 15 μM concentration for each adapter); the adapter ligation program was: no heat cap; 20℃ for 15 min; 4℃ Hold; the magnetic beads used for purification after adapter ligation were 69 μL; the primers for library construction were the primers from Example 3 of patent document CN 114317528 A (5 μM concentration); and the number of cycles for "denaturation-annealing-extension" in the library amplification program was 8.

[0389] Comparative Example 2: A method for constructing a cf DNA library ( Figure 2 Control sample 2) A method for constructing a cf DNA library is the same as that in Comparative Example 1, except that the sample is the same as that in Example 2.

[0390] Comparative Example 3: A method for constructing a cfDNA library ( Figure 2 Control sample 3) A method for constructing a cfDNA library is the same as that in Comparative Example 1, except that the sample is the sample from Example 3.

[0391] Comparative Example 4: A method for constructing a cfDNA library ( Figure 2 Control sample 4) A method for constructing a cfDNA library is the same as that in Comparative Example 1, except that the sample is the sample from Example 4.

[0392] Comparative Example 5: A method for constructing an FFPE DNA library ( Figure 3 Control sample 5) A method for constructing an FFPE DNA library is identical to Comparative Example 1, except that the sample used is the same as in Example 5. Fragmentation is required before library construction. The specific steps are as follows: Add 500 ng of FFPE DNA sample to the fragmentation tube of the DNA fragmentation instrument, and use TE buffer to bring the volume to 55 μL; use the fragmentation instrument (Bioruptor Pico) for fragmentation with parameters of 30s on / 30s off, 30 cycles; use a biological fragment analyzer (Guangding Biotech Qsep100) to control fragment size. If the main peak is too large, repeat the fragmentation until the main peak size is between 100-400 bp. The number of cycles for "denaturation-annealing-extension" in the library amplification program is 10.

[0393] Comparative Example 6: A method for constructing an FFPE DNA library ( Figure 3 Control sample 6) A method for constructing an FFPE DNA library is the same as that for Comparative Example 5, except that the sample is the sample from Example 6.

[0394] Comparative Example 7: A method for constructing an FFPE DNA library ( Figure 3 Control sample 7) A method for constructing an FFPE DNA library is the same as that for Comparative Example 5, except that the sample is the sample from Example 7.

[0395] Comparative Example 8: A method for constructing an FFPE DNA library ( Figure 3 Control sample 8) A method for constructing an FFPE DNA library is the same as that for Comparative Example 5, except that the sample is the sample from Example 8.

[0396] Comparative Example 9: A method for constructing an FFPE DNA-targeting library ( Figure 4 Reagent RapidT1 (2h) A method for constructing an FFPE DNA targeted library is the same as in Example 9, except that: 1) Hybridization reaction solution 1 (hyb#1) in Table 6 contains: 3M betaine, 2M tetramethylammonium chloride, and 30mM Co 3+ ([Co(NH3)6]Cl3), 0.01% Triton X-100; Hybridization reaction solution 2 (hyb#2) contains: N-methylpyrrolidone.

[0397] Comparative Example 10: A method for constructing an FFPE DNA-targeting library ( Figure 5 15mM cobalt) A method for constructing an FFPE DNA targeted library is the same as in Example 12, except that: 1) the Mg in hybridization reaction solution 1 (hyb#1) in Table 6 is... 2+ (Magnesium acetate) replaced with Co 3+ ([Co(NH3)6]Cl3).

[0398] Comparative Example 11: A method for constructing a cfDNA targeted library ( Figure 7 Control Sample 1) A method for constructing a cfDNA targeted library is the same as in Example 23, except that the library in Table 18 is the library obtained in Comparative Example 1, and the hybridization reagent used is V3 hybridization reagent (GenePlus catalog number: KB0040024). The method is as described in the instruction manual.

[0399] Comparative Example 12: A method for constructing a cf DNA targeted library ( Figure 7 Control sample 2) A method for constructing a cf DNA targeted library is the same as in Example 24, except that the library in Table 18 is the library obtained in Comparative Example 2, and the hybridization reagent used is V3 hybridization reagent (GenePlus catalog number: KB0040024). The method is as described in the instruction manual.

[0400] Comparative Example 13: A method for constructing a cfDNA targeted library ( Figure 7 Control sample 3) A method for constructing a cfDNA targeted library is the same as in Example 25, except that the library in Table 18 is the library obtained in Comparative Example 3, and the hybridization reagent used is V3 hybridization reagent (GenePlus catalog number: KB0040024). The method is as described in the instruction manual.

[0401] Comparative Example 14: A method for constructing a cfDNA targeting library ( Figure 7 Control sample 4) A method for constructing a cfDNA targeted library is the same as in Example 26, except that the library in Table 18 is the library obtained in Comparative Example 4, and the hybridization reagent used is V3 hybridization reagent (GenePlus catalog number: KB0040024). The method is as described in the instruction manual.

[0402] Comparative Example 15: A method for constructing an FFPE DNA-targeting library ( Figure 8 Control sample 5) A method for constructing an FFPE DNA targeted library is the same as in Example 27, except that the library in Table 18 is the library obtained in Comparative Example 5, and the hybridization reagent used is V3 hybridization reagent (GenePlus catalog number: KB0040024). The method is described in the instruction manual.

[0403] Comparative Example 16: A method for constructing an FFPE DNA-targeting library ( Figure 8 Control sample 6) A method for constructing an FFPE DNA targeted library is the same as in Example 28, except that the library in Table 18 is the library obtained in Comparative Example 6, and the hybridization reagent used is V3 hybridization reagent (GenePlus catalog number: KB0040024). The method is described in the instruction manual.

[0404] Comparative Example 17: A method for constructing an FFPE DNA-targeting library ( Figure 8 Control sample 7) A method for constructing an FFPE DNA targeted library is the same as in Example 29, except that the library in Table 18 is the library obtained in Comparative Example 7, and the hybridization reagent used is V3 hybridization reagent (GenePlus catalog number: KB0040024). The method is described in the instruction manual.

[0405] Comparative Example 18: A method for constructing an FFPE DNA-targeting library ( Figure 8 Control sample 8) A method for constructing an FFPE DNA targeted library is the same as in Example 30, except that the library in Table 18 is the library obtained in Comparative Example 8, and the hybridization reagent used is V3 hybridization reagent (GenePlus catalog number: KB0040024). The method is described in the instruction manual.

[0406] The libraries of Example 1 (Sample 1 of the present invention), Example 2 (Sample 2 of the present invention), Example 3 (Sample 3 of the present invention), Example 4 (Sample 4 of the present invention), Comparative Example 1 (Control Sample 1), Comparative Example 2 (Control Sample 2), Comparative Example 3 (Control Sample 3), and Comparative Example 4 (Control Sample 4) were quantified using the Qubit® dsDNA HS Assay Kit with the Qubit fluorescence quantitative analyzer. The results are as follows: Figure 2As shown: The yield of intermediate libraries in the four cfDNA libraries constructed using this invention was significantly higher than that in the control.

[0407] The libraries of Example 5 (sample 5 of the present invention), Example 6 (sample 6 of the present invention), Example 7 (sample 7 of the present invention), Example 8 (sample 8 of the present invention), Comparative Example 5 (control sample 5), Comparative Example 6 (control sample 6), Comparative Example 7 (control sample 7), and Comparative Example 8 (control sample 8) were quantified using the Qubit® dsDNA HS Assay Kit with the Qubit fluorescence quantitative analyzer. The results are as follows: Figure 3 As shown: The intermediate library yields of the four FFPE DNA libraries constructed using this invention were all significantly higher than those of the control.

[0408] The hybridization capture efficiency and 0.5 mean (0.5 × mean depth) of Example 9 (reagent T36, evaporated to dryness and free for 2 hours), Example 10 (reagent T36, evaporated to dryness and free for 4 hours), Example 11 (reagent T36, evaporated to dryness and free overnight), and Comparative Example 9 (reagent RapidT1, evaporated to dryness and free for 2 hours) were analyzed. The results are as follows: Figure 4 As shown; the capture efficiency and 0.5 mean (0.5 × average depth) of Example 13 (50 mM magnesium), Example 12 (15 mM magnesium), and Comparative Example 10 (15 mM cobalt) were measured, and the results are as follows. Figure 5 As shown, the capture efficiency (1h, 2h rapid hybridization) of the hybridization reaction solution (reagent T36) of the present invention is higher than that of Comparative Example 1 (reagent RapidT1), and it has good performance at different hybridization times of 1h, 2h, 4h and 16h.

[0409] The hybridization capture efficiency and 0.5 mean of Examples 9-11 (tissue samples with 188 probe-2h, 188 probe-4h, and 188 probe-16h, respectively) and Examples 14-22 (plasma samples with 188 probe-2h, 188 probe-4h, 188 probe-16h, MF probe-2h, MF probe-4h, and MF probe-16h, respectively, tissue samples with 1021 probe-2h, 1021 probe-4h, and 1021 probe-16h, respectively) were analyzed, and the results are as follows: Figure 6 As shown: The hybridization reaction solution of the present invention is compatible with panels of different sizes and different hybridization times; even small panels can achieve high and relatively stable capture efficiency, the hybridization time can be selected from 2 to 16 hours, the fast and slow mixing reagents are consistent, which is convenient for production and simultaneous operation of multiple products.

[0410] The sequencing results of Examples 23 (Sample 1 of the present invention), 24 (Sample 2 of the present invention), 25 (Sample 3 of the present invention), 26 (Sample 4 of the present invention), Comparative Example 11 (Control Sample 1), Comparative Example 12 (Control Sample 2), Comparative Example 13 (Control Sample 3), and Comparative Example 14 (Control Sample 4) were analyzed, and the results are as follows: Figure 7 As shown: The effective depth of the four cfDNA libraries constructed using this invention was higher than that of the control.

[0411] The sequencing results of Examples 27 (Sample 5 of the present invention), 28 (Sample 6 of the present invention), 29 (Sample 7 of the present invention), 30 (Sample 8 of the present invention), Comparative Example 15 (Control Sample 5), Comparative Example 16 (Control Sample 6), Comparative Example 17 (Control Sample 7), and Comparative Example 18 (Control Sample 8) were analyzed, and the results are as follows: Figure 8 As shown: The effective depth of the four FFPE DNA libraries constructed using this invention was higher than that of the control.

[0412] The sequencing results of Examples 31 (FFPE DNA, manual), 32 (cfDNA, manual), 33 (FFPE DNA GIN16), and 34 (cfDNA GIN16) were analyzed, and the results are as follows: Figure 9 As shown, the cfDNA and FFPE DNA libraries constructed using the automated library construction method of this invention can achieve the same level of performance as manual methods in terms of capture efficiency, effective depth, and other indicators.

[0413] The technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made in accordance with the technical solutions of the present invention fall within the protection scope of the present invention.

Claims

1. A DNA targeted library construction kit, comprising: a hybridization capture reagent assembly, the hybridization capture reagent assembly comprising a hybridization reaction solution, the hybridization reaction solution comprising: hybridization reaction solution 1 and hybridization reaction solution 2; wherein hybridization reaction solution 1 comprises: betaine, tetramethylammonium chloride, and Mg 2+ The hybridization reaction solution 2 contains: formamide and N-methylpyrrolidone.

2. The reagent kit according to claim 1, characterized in that, The hybridization reaction solution 1 and hybridization reaction solution 2 may exist independently or in mixture; Preferably, the Mg 2+ The concentration in hybridization reaction solution 1 is 1-100 mM; Preferably, the concentration of betaine in hybridization reaction solution 1 is 1-10 M; Preferably, the concentration of tetramethylammonium chloride in hybridization reaction solution 1 is 1-10 M; Preferably, the concentration of Triton X-100 in hybridization reaction solution 1 is 0.01%-1% by volume. Preferably, the concentration of formamide in hybridization reaction solution 2 is 50%-90% by volume. Preferably, the concentration of N-methylpyrrolidone in hybridization reaction solution 2 is 10%-50% by volume. Preferably, when the hybridization reaction solution 1 and hybridization reaction solution 2 are present in a mixture, the volume ratio of the hybridization reaction solution 1 to the hybridization reaction solution 2 is (1-10):

1.

3. The reagent kit according to any one of claims 1-2, characterized in that, The kit also includes: a DNA library construction reagent kit, which includes: a reagent kit for adapter ligation, which includes: a ligation reaction solution; the ligation reaction solution includes: buffer, magnesium ions, thiol reducing agent, adenine triphosphate (ATP), and propylene glycol; the ligation reaction solution does not contain polyethylene glycol (PEG). Preferably, the buffer solution comprises at least one of: citrate buffer, MES buffer solution, phosphate buffer, Bis-tris buffer, and Tris hydrochloric acid buffer; Preferably, the concentration of the buffer solution in the ligation reaction solution is 0.1-1M; Preferably, the concentration of magnesium ions in the bonding reaction solution is 0.01-1M; Preferably, the thiol reducing agent comprises at least one of: tris(2-formylethyl)phosphine hydrochloride (TCEP), dithiothreitol (DTT), and glutathione reduced (GSH); Preferably, the concentration of the thiol reducing agent in the connecting reaction solution is 0.01-1M; Preferably, the concentration of ATP in the ligation reaction solution is 0.001-0.1M; Preferably, the concentration of propylene glycol in the bonding reaction solution is 40%-80% by mass percentage.

4. The reagent kit according to any one of claims 1-3, characterized in that, The hybridization capture reagent assembly further comprises: a magnetic bead suspension; Preferably, the magnetic bead suspension comprises hybridization reaction solution 1 and hybridization reaction solution 2 as described in any one of claims 1-3; Preferably, the hybridization capture reagent combination further comprises: a library blocking solution; Preferably, the hybridization capture reagent combination further comprises: a capture probe; Preferably, the hybridization capture reagent combination further comprises: a washing solution combination; Preferably, the cleaning solution combination comprises magnetic bead cleaning solution, elution reaction solution I, elution reaction solution S, elution reaction solution II, and elution reaction solution III; Preferably, the magnetic bead cleaning solution comprises: Tris-HCl, EDTA, NaCl, and Tween 20; Preferably, the elution reaction solution I comprises SSC buffer and SDS; Preferably, the elution reaction solution S comprises SSC buffer and Tween 20; Preferably, the elution reaction solution II comprises SSC buffer and Tween 20; Preferably, the elution reaction solution III contains SSC buffer; Preferably, the hybridization capture reagent combination further comprises: a reagent combination for capturing library amplification; Preferably, the reagent combination for capturing library amplification comprises: amplification primers and DNA polymerase reaction solution.

5. The reagent kit according to any one of claims 1-4, characterized in that, The reagent kit for connector ligation further includes: a ligase; Preferably, the reagent assembly for connector connection further comprises: a connector; Preferably, the DNA library construction reagent kit further comprises: a reagent kit for end repair and adding "A"; Preferably, the reagent combination for end repair and adding "A" comprises: an end repair reaction solution; the end repair reaction solution comprises: a buffer solution, magnesium ions, potassium ions, a thiol reducing agent, adenine nucleoside triphosphate (ATP), dNTPs, and a nonionic surfactant; Preferably, the buffer solution comprises at least one of: citrate buffer, MES buffer solution, phosphate buffer, Bis-tris buffer, and Tris hydrochloric acid buffer; Preferably, the thiol reducing agent comprises at least one of: tris-(2-formylethyl)phosphine hydrochloride, dithiothreitol, and glutathione reduced form; Preferably, the nonionic surfactant comprises at least one of Tween 20, Triton X-100, NP-40, and Pluronic F-68; Preferably, the reagent combination for terminal repair and adding "A" further comprises: terminal repair enzyme; Preferably, the DNA library construction reagent kit further comprises: a reagent kit for library amplification; Preferably, the reagent combination for library amplification comprises: library preparation primers and DNA polymerase reaction solution; Preferably, the DNA library construction reagent kit further comprises: a substance for breaking down DNA; Preferably, the DNA library construction reagent kit further includes: a nucleic acid extraction reagent kit.

6. The use of the kit according to any one of claims 1-5 in any one of a1)-a4): a1) Construction of DNA-targeted libraries; a2) Prepare sequencing reagent kits; a3) Sequencing; a4) Prepare products for DNA targeted library construction.

7. A method for constructing a DNA-targeted library, comprising the step of using the DNA library construction kit according to any one of claims 1-5.

8. The method according to claim 7, characterized in that, The method includes the following steps: a) DNA library construction; b) Capture library construction: b1) Hybridization; b2) Capture; b3) Elution; b4) Capture library amplification; Wherein, the hybridization includes the step of using the hybridization reaction solution according to any one of claims 1-5; Preferably, the hybridization method includes the following steps: mixing a DNA library, a hybridization reaction solution, a capture probe, and a library blocking solution, and then reacting.

9. The method according to claim 8, characterized in that, The method for mixing the DNA library, hybridization reaction solution, capture probe, and library blocking solution includes: c1) Mix the DNA library with the hybridization reaction solution, the capture probe, and the dried library blocking solution, wherein the mixture is obtained by eluting the DNA library with the hybridization reaction solution; or c2) The dried mixture, the capture probe, and the hybridization reaction solution are mixed, wherein the mixture contains a DNA library and a library blocking solution; Preferably, the volume ratio of the mixture of the mixed solution and the capture probe to the library blocking solution in c1) is (10-40):7; further, (15-35):7; and even more preferably (15-19):

7. Preferably, the method described in c1) for obtaining the DNA library by eluting it with a hybridization reaction solution includes: d1) The final purification step in the DNA library construction process uses the hybridization reaction solution for elution; or d2) The DNA library constructed from the purified DNA library is then eluted using the hybridization reaction solution; Preferably, the DNA library described in d2) can be a single DNA library or a mixture of multiple DNA libraries; Preferably, the Mg 2+ The concentration in the reaction system is 0.5-50 mM; Preferably, the concentration of betaine in the reaction system is 0.5-5M; Preferably, the concentration of tetramethylammonium chloride in the reaction system is 0.5-5M; Preferably, the concentration of Triton X-100 in the reaction system is 0.005%-0.5% by volume. Preferably, the concentration of formamide in the reaction system is 5%-20% by volume. Preferably, the concentration of N-methylpyrrolidone in the reaction system is 1%-10% by volume. Preferably, the reaction time is 1-20 hours.

10. The method according to any one of claims 8-9, characterized in that, The capture method is as follows: mix the magnetic beads with the product of b1), and react; Preferably, the elution includes hot elution and room temperature elution; Preferably, the method for capturing library amplification is as follows: the product obtained in b3) and the reagents used for capturing library amplification are mixed together, and a PCR reaction is performed.

11. The method according to any one of claims 8-10, characterized in that, The DNA library construction method includes the step of using the DNA library construction reagent combination as described in any one of claims 3-5; Preferably, the DNA library construction method comprises the following steps: a1) Perform end repair and add "A" to DNA fragments; a2) Connect the product obtained in a1) with a joint; a3) Purify the product obtained in a2); a4) Perform library amplification on the product obtained in a3); The connector connection uses the reagent combination for connector connection as described in any one of claims 3-5; Preferably, the method for connecting the connector is as follows: the product obtained in a1), the connector, the connector ligation reaction solution, and the ligase are mixed and reacted; Preferably, the concentration of the buffer solution in the ligation reaction system is 0.03-0.3M; Preferably, the concentration of magnesium ions in the bonding reaction system is 0.003-0.3M; preferably, the concentration of the thiol reducing agent in the bonding reaction system is 0.003-0.3M. Preferably, the concentration of ATP in the ligation reaction system is 0.0003-0.03M; Preferably, the concentration of propylene glycol in the linkage reaction system is 12%-24% by volume. Preferably, the ligase comprises at least one of: T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, Pfu DNA ligase, HiFi DNA ligase, and Quick Ligase.

12. The method according to claim 11, characterized in that, The method for purifying the product obtained in a2) is as follows: mix the product obtained in a2) with magnetic beads, incubate, wash with ethanol, dry, and elute. Preferably, the volume ratio of the product obtained in a2) to the magnetic beads is 1:(1-1.4). Preferably, the library amplification uses the reagent combination for library amplification as described in claim 5; Preferably, the method for library amplification is as follows: the product obtained from a3), the library construction primers, and the DNA polymerase reaction solution are mixed, and a PCR reaction is performed; Preferably, the concentration of the library preparation primers in the PCR reaction system is 1-3 µM; Preferably, the end repair and addition of "A" adopt the reagent combination for end repair and addition of "A" as described in claim 5.

13. A DNA-targeting library, obtained by the method described in any one of claims 7-12.

14. A sequencing method for sequencing the DNA targeting library of claim 13.

15. A product comprising the kit according to any one of claims 1-5; and an automated library construction and hybridization workstation.

16. A DNA-targeted library construction system for performing the method of any one of claims 7-12.

17. The system according to claim 16, characterized in that, The system includes: a capture library construction module, which is used to construct the capture library; Preferably, the capture library construction module includes: a hybridization module for the specific binding of the target DNA fragment of the DNA library to the capture probe; Preferably, the capture library construction module further includes: a capture module for binding the hybridization complex to magnetic beads; Preferably, the capture library construction module further includes: an elution module for removing non-specifically bound DNA or impurities; Preferably, the capture library construction module further includes: a capture library amplification module, which is used to enrich the DNA library of the target region.

18. The system according to any one of claims 16-17, characterized in that, The system also includes: a DNA library construction module, which is used for constructing DNA libraries; Preferably, the DNA library construction module includes: End repair and "A" addition module, used for end repair and "A" addition of DNA fragments; and / or Adapter ligation module, used to ligate sequencing adapters to DNA fragments that have undergone end repair and "A" addition; and / or Purification module, used to remove impurities from the reaction system; and / or Library amplification module, used to enrich DNA libraries containing ligation adapters; Preferably, when the method of mixing the DNA library, hybridization reaction solution, capture probe and library blocking solution is c1), the system is a fully automated system.

Images