Compound microbial agent with broad-spectrum nitrogen fixation function
By using Rhodopseudomonas palustris and anaerobic Clostridium bacteria in a compound microbial agent, atmospheric nitrogen is converted into organic matter, solving the problems of insufficient soil fertility and salinization, increasing crop yield and improving soil microecology, and has a broad-spectrum and highly efficient nitrogen fixation function.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SICHUAN RONGGUANG RUIDA BIOTECHNOLOGY CO LTD
- Filing Date
- 2025-12-18
- Publication Date
- 2026-04-17
AI Technical Summary
In existing technologies, arable land generally suffers from insufficient soil fertility and soil salinization, leading to increased use of chemical fertilizers in agricultural planting, which further exacerbates soil salinization and fertility loss, and affects crop yield.
A compound microbial agent containing Rhodopseudomonas palustris and two types of anaerobic Clostridium bacteria is used to convert atmospheric nitrogen into organic matter through photosynthesis and nitrogen fixation, providing nutrients for crops, improving the soil micro-ecological environment, and increasing the soil organic matter content.
It significantly increases crop yield, reduces fertilizer use, improves soil microecology, has broad-spectrum and highly efficient nitrogen fixation function, is suitable for a variety of crops, and reduces soil salinization.
Smart Images

Figure CN121874006A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of compound microbial agents, specifically to a compound microbial agent with broad-spectrum nitrogen-fixing function. Background Technology
[0002] Currently, arable land generally suffers from insufficient soil fertility and soil salinization, posing a significant challenge to agricultural planting and severely restricting agricultural development. In order to improve soil fertility and increase crop yields, it is necessary to increase the use of chemical fertilizers, which further exacerbates soil salinization and soil fertility loss, ultimately leading to increasingly lower soil productivity.
[0003] Nitrogen is a decisive factor affecting crop yield and is also the nutrient most consumed in agricultural planting. In agricultural planting, a large amount of nitrogen fertilizer is needed to meet the nutritional needs of crops and increase crop yield. Nitrogen-fixing microorganisms can convert atmospheric nitrogen into nitrogen-containing compounds, which are then supplied to crops and other microorganisms for absorption and utilization. Therefore, applying nitrogen-fixing microorganisms can not only promote crop growth but also improve the soil micro-ecological environment, making it one of the important methods to achieve the goal of reducing fertilizer use and increasing yield.
[0004] Photosynthetic bacteria (PSB) are microorganisms that can perform photosynthesis under light conditions. They convert nitrogen and carbon dioxide into organic matter using light energy, thus achieving photosynthesis. The organic matter produced by photosynthetic bacteria through metabolism can be supplied to crops and other microorganisms for absorption and utilization, thereby promoting soil improvement and plant growth and development in agricultural planting.
[0005] Clostridium bacteria possess nitrogen-fixing capabilities and can live independently in soil or the environment. Halophilic and alkaliphilic Clostridium bacteria primarily use inorganic salts as a nutrient source, fixing atmospheric nitrogen while also decomposing some proteins and other organic matter, producing organic acids through metabolism. This biological characteristic provides nitrogen-containing organic matter to the environment and further increases the nitrogen content by decomposing the remains of other dead microorganisms.
[0006] The nitrogen nutrients produced by microbial nitrogen fixation mainly exist in the form of nitrogen-containing organic matter. Therefore, they can not only be supplied to crops for absorption and utilization, but also serve as nutrients for other microorganisms in the soil, enhancing their activity. Thus, microbial nitrogen fixation does not cause soil salinization like the use of nitrogen fertilizers; instead, it can increase soil organic matter content and improve the soil's micro-ecological environment.
[0007] In contrast to common nitrogen-fixing bacteria such as rhizobia, photosynthetic bacteria and Clostridium species do not have their nitrogen-fixing ability affected by the type of crop planted. As long as they exist in the soil environment, they can continuously perform biological nitrogen fixation, providing nitrogen for all crops to absorb and utilize. Therefore, they have a strong broad spectrum and are more applicable to agriculture.
[0008] Based on this, the present invention utilizes the biological characteristics of photosynthetic bacteria and Clostridium species to propose a composite microbial agent with broad-spectrum nitrogen-fixing function, providing a new means for maintaining soil fertility in arable land. Summary of the Invention
[0009] The purpose of this invention is to provide a compound microbial agent with broad-spectrum nitrogen-fixing function, which has the effect of significantly improving crop yield.
[0010] In a first aspect, the present invention provides a composite microbial agent with broad-spectrum nitrogen-fixing function, comprising at least two types of anaerobic Clostridium bacteria and photosynthetic bacteria, wherein the anaerobic Clostridium bacteria include Zn2. T and M3 / 9 T Among them, Zn2 T The 16S rDNA sequence is shown in SEQ ID NO. 1, M3 / 9 T The 16S rDNA sequence is shown in SEQ ID NO. 2; the photosynthetic bacteria is Rhodopseudomonas palustris, and the 16S rDNA sequence is shown in SEQ ID NO. 3.
[0011] Furthermore, the Rhodopseudomonas palustris accounts for 45% to 55% of the total number of bacteria in the compound microbial agent, and Clostridium bacteria account for 45% to 55% of the total number of bacteria in the compound microbial agent.
[0012] Furthermore, the culture medium for *Rhodopseudomonas palustris* consists of 1.0 g ammonium chloride, 2.0 g sodium acetate, 2.0 g monosodium glutamate, 0.1 g magnesium sulfate heptahydrate, 0.05 g calcium chloride, 0.6 g potassium dihydrogen phosphate, 0.4 g dipotassium hydrogen phosphate, 1.0 g yeast extract, and 1.0 g peptone, with 1000 mL of distilled water added and the pH adjusted to 7.5.
[0013] Furthermore, the culture method of the aforementioned Rhodopseudomonas palustris is as follows: the inoculum is 20%, and the bacteria are cultured under sunlight for 30 days under the climatic conditions of an average daytime temperature of 30°C. The bacterial concentration is then measured to be 2.02 billion / mL.
[0014] Furthermore, the anaerobic Clostridium spp. Zn2 TExtracted from industrial wastewater, the screening method includes: using adjusted PYG agar medium, incubating for 10 days under anaerobic conditions at 30℃, to obtain light beige, translucent, glossy, watermark-like colonies with a total edge diameter of up to 2.5 mm.
[0015] Furthermore, the adjusted PYG agar medium contains 20.0g peptone, 5.0g glucose, 10.0g yeast extract, 0.5g L-cysteine hydrochloride, 0.08g sodium chloride, 0.008g calcium chloride, 0.008g magnesium sulfate heptahydrate, 0.04g dipotassium hydrogen phosphate, 0.04g potassium dihydrogen phosphate, 0.4g sodium bicarbonate, and 3.0g agar powder per liter of medium, with the pH adjusted to 6.4.
[0016] Furthermore, the anaerobic Clostridium spp. Zn2 T The culture method is as follows: per liter of culture medium, there are 1.0g sodium sulfate, 30.0g sodium chloride, 5.0g magnesium chloride, 0.7g potassium chloride, 1.0g calcium chloride, 0.5g ammonium chloride, 0.5g dipotassium hydrogen phosphate, 0.5g potassium dihydrogen phosphate, 2.0g sodium bicarbonate, 2.0g yeast extract, 3.0g peptone, 1.0g glucose, and 0.4g L-cysteine. The pH value is adjusted to 6.4 using dilute hydrochloric acid. After sterilizing the culture medium, it is poured into a constant temperature sealed incubator and cultured at 30℃ under anaerobic conditions until the concentration reaches 1.24 billion / mL.
[0017] Furthermore, the anaerobic Clostridium M3 / 9 T Extracted from biogas fermentation liquid, the screening method includes: using tryptic soy peptone liquid medium, incubating for 10 days under anaerobic conditions at 30℃, to obtain light beige, translucent, glossy, slightly raised and round colonies, with a total edge diameter of up to 1.4 mm.
[0018] Furthermore, the tryptic soy peptone liquid culture medium contains 17.0g tryptic peptone, 3.0g soy papain hydrolysate, 5.0g sodium chloride, 2.5g dipotassium hydrogen phosphate, 2.5g glucose, and 3.0g agar powder per liter of culture medium, with the pH adjusted to 7.5.
[0019] Furthermore, the anaerobic Clostridium M3 / 9 T The culture method is as follows: per liter of culture medium, there are 17.0g tryptone, 3.0g soybean papain hydrolysate, 5.0g sodium chloride, 2.5g dipotassium hydrogen phosphate, 2.5g glucose, 1.0g L-cysteine, and 0.1g resazurin. The pH of the culture medium is adjusted to 7.5 with sodium hydroxide. After sterilization, the culture medium is poured into a constant temperature sealed incubator and cultured at 30℃ under anaerobic conditions until the concentration reaches 1 billion / mL.
[0020] The beneficial effects of this invention are as follows:
[0021] This invention discloses a compound microbial agent with broad-spectrum biological nitrogen fixation function that can be used in agricultural planting. In the soil, it converts atmospheric nitrogen and carbon dioxide into nitrogen-containing organic compounds that can be absorbed and utilized by crops, thus achieving biological nitrogen fixation and promoting crop growth. This compound microbial agent includes photosynthetic bacteria and two or more species of anaerobic Clostridium bacteria. The compound microbial agent has strong salt and alkali tolerance, low dependence on organic nutrients, and its microbial community can achieve a dynamic balance of activity. It is characterized by stable properties, long shelf life, and strong applicability to agricultural production. Attached Figure Description
[0022] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0023] Figure 1 and Figure 2 For field trials of cauliflower, among which Figure 1 The control group showed the growth of cauliflower seedlings during the seedling stage. Figure 2 The growth of cauliflower seedlings in the group treated with a mixed bacterial solution of photosynthetic bacteria (Clostridium spp.).
[0024] Figure 3 and Figure 4 This was a field trial for maize. Among them... Figure 3 The control group showed the growth of corn seedlings during the seedling stage. Figure 4 The growth of maize seedlings in the group treated with a mixed bacterial solution of photosynthetic bacteria (Clostridium spp.).
[0025] Figure 5 and Figure 6 This was a field trial of Coptis chinensis. Figure 5 The growth of Coptis chinensis plants was used as a control group. Figure 5 The growth of Coptis chinensis plants in the treatment group was observed 7 months after application of a mixed bacterial solution of photosynthetic bacteria and Clostridium species. Detailed Implementation
[0026] The technical solution of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0027] It should be noted that the yeast extract, peptone, casein peptone, soybean peptone, yeast extract, and beef extract used in this invention were all purchased from Sichuan Baoshun Biotechnology Co., Ltd., molasses was purchased from Jinan Jinjutian Biotechnology Co., Ltd., soybean papain hydrolysate was purchased from Shandong Tuopu Bioengineering Co., Ltd., and the razor clairosa was model RT209503-5g.
[0028] This invention discloses a composite microbial agent with broad-spectrum nitrogen-fixing function, comprising at least two types of anaerobic Clostridium bacteria and photosynthetic bacteria, wherein the anaerobic Clostridium bacteria include Zn2. T and M3 / 9 T Among them, Zn2 T The 16S rDNA sequence is shown in SEQ ID NO. 1, M3 / 9 T The 16S rDNA sequence is shown in SEQ ID NO. 2; the photosynthetic bacteria is *Rhodopseudomonas palustris*, and its 16S rDNA sequence is shown in SEQ ID NO. 3. *Rhodopseudomonas palustris* accounts for 45%–55% of the total number of bacteria in the compound microbial agent, and *Clostridium* bacteria account for 45%–55% of the total number of bacteria in the compound microbial agent.
[0029] SEQ ID NO.1 is as follows: TACGTAGGGGGCAAGCGTTATCCGGAATCACTGGGCGTAAAGGGTGCGTAGGCGGCCCAAATAAAGTCAGGGGTGAAAGGGCTACGGCCTTACCCGTAGTAAGCCTTGAAAACTTATTGGCTTGAGTGCAGGAGAGGTAAGTGGAATTCCTAGTGTAGCGGTGAAATGCGTAGATATTAGGAGGAACACCAGTGGCGAA GGCGACTTACTGGACTGTAACTGACGCTGAGGCACGAAAGCGTGGGGAGCGAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAGTGCTAGGTGTCGGAGCCGACAGGCTTCGGTGCCGCAGCAAACGCATTAAGCACTCCGCCTGGGGAGTACGTTCGCAAGAATGAAACTCAAAGGAATTGACGGGGA SEQ ID NO.2 is as follows: TACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGAGTAGGCGGATTAGTAAGCCATATGTGAAAACTCAGGGCTTAACTTTGAGATTGCATAAGGAACTGTTAATCTAGAGTACAGGAGAGGTAAGTGGAATTCCTAGTGTAGCGGTGAAATGCGTAGATATTAGGAGGAACA CCAGTGGCGAAGGCGACTTACTGGACTGAAACTGACGCTGAGGCACGAAAGCGTGGGTAGCGAACAGGATTAGATACCCTGGTAGTCCACGCTGTAAACGATGAGTGCTAGGTGTGGGGGAGAGATCCTCGGTGCCGCAGCAAACGCAATAAGCACTCCACCTGGGGAGTACGGCCGCAAGGTTG SEQ ID NO.3 is as follows: TACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGTGCGTAGGCGGGTTTCTAAGTCAGAGGTGAAAGCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGGAAGTCTTGAGTATGGCAGAGGTGAGTGGAACTGCGAGTGTAGAGGTGAAATTCGTAGATATTCGCAAGAACAC CAGTGGCGAAGGCGGCTCACTGGGCCATTACTGACGCTGAGGCACGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAATGCCAGCCGTTAGTGGGTTTACTCACTAGTGGCGCAGCTAACGCTTTAAGCATTCCGCCTGGGGAGTACGGTCGCAAGATTA The Clostridium species 1 selected in this invention is an anaerobic organic acid-producing bacillus extracted from industrial wastewater, specifically an anaerobic Clostridium Zn2. TThe screening method included: using an adjusted PYG agar medium containing 20.0g peptone, 5.0g glucose, 10.0g yeast extract, 0.5g L-cysteine hydrochloride, 0.08g sodium chloride, 0.008g calcium chloride, 0.008g magnesium sulfate heptahydrate, 0.04g dipotassium hydrogen phosphate, 0.04g potassium dihydrogen phosphate, 0.4g sodium bicarbonate, and 3.0g agar powder per liter of medium, adjusting the pH to 6.4, and incubating for 10 days under anaerobic conditions at 30℃, resulting in light beige, translucent, glossy, watermark-like colonies with a total edge diameter of up to 2.5mm.
[0030] The culture method was as follows: per liter of culture medium, there were 1.0 g sodium sulfate, 30.0 g sodium chloride, 5.0 g magnesium chloride, 0.7 g potassium chloride, 1.0 g calcium chloride, 0.5 g ammonium chloride, 0.5 g dipotassium hydrogen phosphate, 0.5 g potassium dihydrogen phosphate, 2.0 g sodium bicarbonate, 2.0 g yeast extract, 3.0 g peptone, 1.0 g glucose, and 0.4 g L-cysteine. The pH was adjusted to 6.4 using dilute hydrochloric acid. After sterilization, the culture medium was poured into a constant temperature sealed incubator and cultured at 30°C under anaerobic conditions until the concentration reached 1.24 billion / mL.
[0031] The Clostridium species 2 selected in this invention is an anaerobic organic acid-producing bacterium extracted from biogas fermentation broth, specifically anaerobic Clostridium M3 / 9. T The screening method included using TSB medium (tryptic soy peptone liquid medium), containing 17.0 g casein, 3.0 g soybean papain hydrolysate, 5.0 g sodium chloride, 2.5 g dipotassium hydrogen phosphate, 2.5 g glucose, and 3.0 g agar powder per liter of medium, adjusting the pH to 7.5. After incubation at 30°C under anaerobic conditions for 10 days, light beige, translucent, glossy, slightly raised, and round colonies were obtained, with a total edge diameter of up to 1.4 mm.
[0032] The culture method was as follows: per liter of culture medium, there were 17.0 g tryptone, 3.0 g soybean papain hydrolysate, 5.0 g sodium chloride, 2.5 g dipotassium hydrogen phosphate, 2.5 g glucose, 1.0 g L-cysteine, and 0.1 g resazurin. The pH of the culture medium was adjusted to 7.5 with sodium hydroxide. After sterilization, the culture medium was poured into a constant-temperature sealed incubator and incubated at 30°C under anaerobic conditions until the concentration reached 1 billion / mL.
[0033] The culture medium for Rhodopseudomonas palustris consisted of: 1.0g ammonium chloride, 2.0g sodium acetate, 2.0g monosodium glutamate, 0.1g magnesium sulfate heptahydrate, 0.05g calcium chloride, 0.6g potassium dihydrogen phosphate, 0.4g dipotassium hydrogen phosphate, 1.0g yeast extract, and 1.0g peptone, all added to 1000mL distilled water, and the pH was adjusted to 7.5.
[0034] With an inoculum size of 20%, and under sunny conditions with an average daytime outdoor temperature of 30°C, the bacteria were cultured for 30 days under sunlight, and the bacterial concentration was measured to be 2.02 billion / mL.
[0035] The concentration of photosynthetic bacteria was measured using the plate spreading method. The plate culture medium consisted of: 0.1g ammonium chloride, 0.1g sodium bicarbonate, 0.02g dipotassium hydrogen phosphate, 0.01g yeast extract, 0.005g peptone, 0.5g sodium acetate, 0.02g magnesium sulfate heptahydrate, 0.05g sodium chloride, 1mL growth factor, 1mL trace element solution, 97mL distilled water, and 2g agar powder, with a pH of 7.0.
[0036] The trace element solution contains 2.8 g / L boric acid, 0.04 g / L copper nitrate trihydrate, 0.75 g / L sodium permolybdate dihydrate, 2.1 g / L manganese sulfate tetrahydrate, and 0.24 g / L zinc sulfate heptahydrate.
[0037] After inoculation onto agar plates, the surface of the culture medium was covered with sterile liquid paraffin and incubated under an incandescent lamp at 30°C. Photosynthetic bacteria formed smooth, red colonies with an edge diameter of 0.5 mm.
[0038] Example 1
[0039] Clostridium species 1 and Clostridium species 2 were mixed at a volume ratio of 1:1. Then, photosynthetic bacteria solution was mixed with the mixed Clostridium bacteria solution at a volume ratio of 1:1.5. At this point, the concentration of photosynthetic bacteria was 808 million / mL, accounting for 54.6% of the total number of bacteria, and Clostridium bacteria accounted for 45.4% of the total number of bacteria.
[0040] Under these conditions, after 3 months of storage, all bacterial species in the mixed bacterial solution maintained their activity. This was evidenced by the bacterial solution remaining red, confirming that no large-scale death of photosynthetic bacteria occurred. The absence of bottle swelling in the encapsulated bacterial solution container confirmed that no large-scale death of other Clostridium species occurred.
[0041] A 6-mu (approximately 0.4 hectares) cauliflower planting field was selected in Jianyang City, Sichuan Province. The soil was low-nutrient red clay soil. A black and white striped mulch film was used, with a translucent white film covering the plant area to allow sunlight to reach the soil around the plant roots. The planting field was divided into two experimental plots. One plot served as the experimental group, where the aforementioned photosynthetic bacteria (Clostridium spp.) mixed solution was applied at a rate of 5 L / mu (approximately 0.067 hectares). This solution was applied twice during the crop growing season, once at the transplanting stage and again at the rosette stage, spraying the solution onto the soil surface around the plant roots. The other plot served as the control group, without the application of the photosynthetic bacteria (Clostridium spp.) mixed solution.
[0042] Both the experimental and control groups adopted a reduced-fertilizer planting model for cauliflower throughout its entire growth period. The total amount of fertilizer applied per acre was 25 kg of potassium sulfate compound fertilizer (16-16-16), 10 kg of magnesium nitrate (applied in three applications), and 5 kg of potassium nitrate (applied in two applications). All other field management conditions were the same. For conventional agricultural management, the normal fertilizer application rate is 50 kg of potassium sulfate compound fertilizer (16-16-16), 20 kg of magnesium nitrate (applied in three applications), and 10 kg of potassium nitrate (applied in two applications) per acre.
[0043] Throughout the entire growth process of cauliflower, the growth of cauliflower plants in the experimental group and the control group were continuously observed. After harvest, the yield per mu of cauliflower that meets the commercial diameter (cauliflower that meets the harvest specifications, with a cauliflower diameter of more than 20cm) and the total yield per mu (including cauliflower that meets the harvest specifications and cauliflower that does not meet the harvest specifications) were measured respectively.
[0044] Table 1. Effects of compound microbial inoculum on cauliflower yield
[0045] deal with Product yield per mu (kg / mu) Increment % Total yield per mu (kg / mu) Increment % Product rate control group 492.8±37 — 542±44 — 90.9% experimental group 670.8±22 36.1% 702±18 29.5% 95.6%
[0046] Depend on Figure 1 , Figure 2 It can be seen that under the conditions of reduced fertilizer use in planting, the mixed microbial inoculum of the present invention can improve the growth of cauliflower plants during the growth process.
[0047] As shown in Table 1, under the conditions of reduced fertilizer use, the mixed microbial inoculum of the present invention can significantly increase the yield per mu of cauliflower that meets the commercial standard (cauliflower that meets the harvest specifications, with a cauliflower diameter of more than 20cm) and the total yield per mu (including cauliflower that meets the harvest specifications and cauliflower that does not meet the harvest specifications), and can greatly improve the commercial rate (the proportion of cauliflower that meets the harvest specifications).
[0048] Example 2
[0049] Clostridium species 1 and Clostridium species 2 were mixed at a volume ratio of 1:1. Then, photosynthetic bacteria solution was mixed with the mixed Clostridium bacteria solution at a volume ratio of 1:2.2. At this point, the concentration of photosynthetic bacteria was 631 million / mL, accounting for 45.0% of the total number of bacteria, and Clostridium bacteria accounted for 55.0% of the total number of bacteria.
[0050] Under these conditions, after 3 months of storage, all bacterial species in the mixed bacterial solution maintained their activity. This was evidenced by the bacterial solution remaining red, confirming that no large-scale death of photosynthetic bacteria occurred. The absence of bottle swelling in the encapsulated bacterial solution container confirmed that no large-scale death of other Clostridium species occurred.
[0051] Sixty mu (approximately 4 hectares) of maize planting field were selected in Bachu County, Kashgar Prefecture, Xinjiang. The soil was high-salt-alkaline, low-nutrient sandy soil. Translucent white plastic film was used to ensure that the soil around the plant roots could receive sunlight. The planting field was divided into two experimental plots. One plot served as the experimental group, where the aforementioned mixed solution of photosynthetic bacteria (Clostridium) was applied at a rate of 10 L / mu (approximately 10 L / mu). This application was done once during the entire crop growing season, during the first drip irrigation after maize sowing. The other plot served as the control group, without the application of the mixed solution of photosynthetic bacteria (Clostridium).
[0052] Both the experimental and control groups adopted a reduced-fertilizer planting model for maize throughout its growth period, applying a total of 5 kg of urea, 15 kg of diammonium phosphate, and 10 kg of potassium sulfate per mu (approximately 0.067 hectares). Other field management conditions were identical. Conventional agricultural management, with normal fertilizer application rates, involves 10 kg of urea, 30 kg of diammonium phosphate, and 10 kg of potassium sulfate per mu.
[0053] Throughout the entire growth process of maize, the growth of maize plants in the experimental group and the control group was continuously observed, and the yield per acre was measured after harvest.
[0054] Table 2. Effects of compound microbial inoculum on maize yield
[0055] deal with 1000-grain weight (g) Yield (kg / mu) Increment % control group 263.6±34 523.5±18 — experimental group 302.8±20 708.0±10 35.2%
[0056] Depend on Figure 3 , Figure 4 It can be seen that under the conditions of reduced fertilizer use in planting, the mixed microbial inoculum of the present invention can improve the growth of corn plants during the growth process.
[0057] As can be seen from Table 2, under the conditions of reduced fertilizer use in planting, the mixed microbial inoculum of the present invention can significantly increase the yield of corn per mu.
[0058] Example 3
[0059] Clostridium species 1 and Clostridium species 2 were mixed at a volume ratio of 1:1. Then, photosynthetic bacteria solution was mixed with the mixed Clostridium bacteria solution at a volume ratio of 1:1.2. At this point, the concentration of photosynthetic bacteria was 918 million / mL, accounting for 60.0% of the total number of bacteria, and Clostridium bacteria accounted for 40.0% of the total number of bacteria.
[0060] Under these conditions, after 3 months of storage, all bacterial species in the mixed bacterial solution maintained their activity. This was evidenced by the bacterial solution remaining red, confirming that no large-scale death of photosynthetic bacteria occurred. The absence of bottle swelling in the encapsulated bacterial solution container confirmed that no large-scale death of other Clostridium species occurred.
[0061] One mu (approximately 0.16 acres) of Coptis chinensis (Huanglian) planting field was selected in Shawan District, Leshan City, Sichuan Province. The crop was Coptis chinensis, and the variety was Weilian. The entire growth period is 5 years, and 3-year-old Weilian plants were used in this example. The planting environment was high-altitude forest soil at an altitude of 1350 meters. The planting field was divided into two experimental plots. One plot served as the experimental group, which was treated with the above-mentioned photosynthetic bacteria-Clostridium spp. mixed solution at a rate of 5 L / mu, once. The other plot served as the control group, which was not treated with the photosynthetic bacteria-Clostridium spp. mixed solution.
[0062] Neither the experimental nor the control group of Coptis chinensis was treated with chemical fertilizers, and all other field management conditions were the same.
[0063] After applying a mixed solution of photosynthetic bacteria and Clostridium species for 7 months, the growth of Coptis chinensis plants in the experimental group and the control group was continuously observed and used as the evaluation criterion.
[0064] Depend on Figure 5 , Figure 6 It can be seen that, without the application of chemical fertilizers, the mixed microbial inoculum of the present invention can provide the nutrients needed for the growth of Coptis chinensis and improve the growth of the plant during the growth process.
[0065] Finally, it should be noted that the above embodiments are only used to illustrate the present invention and are not intended to limit the technical solutions described in the present invention; those skilled in the art should understand that modifications or equivalent substitutions can still be made to the present invention; and all technical solutions and improvements that do not depart from the spirit and scope of the present invention should be covered within the scope of the claims of the present invention.
Claims
1. A compound microbial agent with broad-spectrum nitrogen-fixing function, characterized in that, It includes at least two types of anaerobic Clostridium bacteria and photosynthetic bacteria, wherein the anaerobic Clostridium bacteria include Zn2. T and M3 / 9 T Among them, Zn2 T The 16S rDNA sequence is shown in SEQ ID NO. 1, M3 / 9 T The 16S rDNA sequence is shown in SEQ ID NO. 2; the photosynthetic bacteria is Rhodopseudomonas palustris, and the 16S rDNA sequence is shown in SEQ ID NO.
3.
2. The composite microbial agent with broad-spectrum nitrogen-fixing function according to claim 1, characterized in that, The *Rhodopseudomonas palustris* accounted for 45% to 55% of the total number of bacteria in the compound microbial agent, and *Clostridium* bacteria accounted for 45% to 55% of the total number of bacteria in the compound microbial agent.
3. The composite microbial agent with broad-spectrum nitrogen-fixing function according to claim 1, characterized in that, The culture medium for *Rhodopseudomonas palustris* consisted of 1.0 g ammonium chloride, 2.0 g sodium acetate, 2.0 g monosodium glutamate, 0.1 g magnesium sulfate heptahydrate, 0.05 g calcium chloride, 0.6 g potassium dihydrogen phosphate, 0.4 g dipotassium hydrogen phosphate, 1.0 g yeast extract, and 1.0 g peptone, with 1000 mL of distilled water added and the pH adjusted to 7.
5.
4. The composite microbial agent with broad-spectrum nitrogen-fixing function according to claim 1, characterized in that, The culture method for Rhodopseudomonas palustris was as follows: the inoculum was 20%, and the bacteria were cultured for 30 days under sunny conditions with an average daytime temperature of 30°C. The bacterial concentration was then measured to be 2.02 billion / mL.
5. The composite microbial agent with broad-spectrum nitrogen-fixing function according to claim 1, characterized in that, The anaerobic Clostridium genus bacteria Zn2 T Extracted from industrial wastewater, the screening method includes: using adjusted PYG agar medium, incubating for 10 days under anaerobic conditions at 30℃, to obtain light beige, translucent, glossy, watermark-like colonies with a total edge diameter of up to 2.5 mm.
6. The composite microbial agent with broad-spectrum nitrogen-fixing function according to claim 5, characterized in that, The adjusted PYG agar medium contains 20.0g peptone, 5.0g glucose, 10.0g yeast extract, 0.5g L-cysteine hydrochloride, 0.08g sodium chloride, 0.008g calcium chloride, 0.008g magnesium sulfate heptahydrate, 0.04g dipotassium hydrogen phosphate, 0.04g potassium dihydrogen phosphate, 0.4g sodium bicarbonate, and 3.0g agar powder per liter of medium, with the pH adjusted to 6.
4.
7. The composite microbial agent with broad-spectrum nitrogen-fixing function according to claim 1, characterized in that, The anaerobic Clostridium genus bacteria Zn2 T The culture method is as follows: per liter of culture medium, there are 1.0g sodium sulfate, 30.0g sodium chloride, 5.0g magnesium chloride, 0.7g potassium chloride, 1.0g calcium chloride, 0.5g ammonium chloride, 0.5g dipotassium hydrogen phosphate, 0.5g potassium dihydrogen phosphate, 2.0g sodium bicarbonate, 2.0g yeast extract, 3.0g peptone, 1.0g glucose, and 0.4g L-cysteine. The pH value is adjusted to 6.4 using dilute hydrochloric acid. After sterilizing the culture medium, it is poured into a constant temperature sealed incubator and cultured at 30℃ under anaerobic conditions until the concentration reaches 1.24 billion / mL.
8. The composite microbial agent with broad-spectrum nitrogen-fixing function according to claim 1, characterized in that, The anaerobic Clostridium M3 / 9 T Extracted from biogas fermentation liquid, the screening method includes: using tryptic soy peptone liquid medium, incubating for 10 days under anaerobic conditions at 30℃, to obtain light beige, translucent, glossy, slightly raised and round colonies, with a total edge diameter of up to 1.4 mm.
9. A composite microbial agent with broad-spectrum nitrogen-fixing function according to claim 8, characterized in that, The soy peptone liquid culture medium contains 17.0g casein peptone, 3.0g soy papain hydrolysate, 5.0g sodium chloride, 2.5g dipotassium hydrogen phosphate, 2.5g glucose, and 3.0g agar powder per liter of culture medium, with the pH adjusted to 7.
5.
10. A composite microbial agent with broad-spectrum nitrogen-fixing function according to claim 1, characterized in that, The anaerobic Clostridium M3 / 9 T The culture method is as follows: per liter of culture medium, there are 17.0g tryptone, 3.0g soybean papain hydrolysate, 5.0g sodium chloride, 2.5g dipotassium hydrogen phosphate, 2.5g glucose, 1.0g L-cysteine, and 0.1g resazurin. The pH of the culture medium is adjusted to 7.5 with sodium hydroxide. After sterilization, the culture medium is poured into a constant temperature sealed incubator and cultured at 30℃ under anaerobic conditions until the concentration reaches 1 billion / mL.