Recombinant escherichia coli capable of efficiently synthesizing carmine and construction method and application of recombinant escherichia coli
By heterologously expressing key enzyme systems in Escherichia coli BAP1, recombinant Escherichia coli was constructed, and the efficient synthesis of carmine acid was successfully achieved, overcoming the shortcomings of traditional extraction methods and providing a safe and sustainable production route.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- 中原食品实验室
- Filing Date
- 2024-10-17
- Publication Date
- 2026-04-17
AI Technical Summary
The traditional production of carmine acid in existing technologies relies on extraction from cochineal insects, which suffers from problems such as poor stress resistance, cumbersome breeding, complex extraction, high cost, and unstable quality, making it difficult to achieve efficient, safe, and sustainable production.
Recombinant Escherichia coli was constructed by heterologously expressing type II polyketide synthase antDEFBG, cyclase zhuI, aromatase zhuJ, hydroxylase RdmE, and C-glucosyltransferase GcCGT in Escherichia coli BAP1, and carmine acid was synthesized through metabolic engineering.
The efficient synthesis of carmine acid in Escherichia coli was achieved, with a yield of 19.4 μg/L, which overcomes the shortcomings of traditional extraction methods and provides a safe and sustainable production route.
Smart Images
Figure CN121874071A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of biotechnology and genetic engineering, and specifically relates to a recombinant Escherichia coli that efficiently synthesizes carmine acid, its construction method, and its application. Background Technology
[0002] Carmine cochineal is a natural red pigment, its main component being carmine acid, an anthraquinone compound known for its vibrant color, stability, and antioxidant properties. This pigment has high commercial value and is widely used in food, cosmetics, textiles, and other fields. In the food industry, carmine acid is commonly used as a food additive to impart a red color to foods such as beverages, candies, and baked goods. In the cosmetics industry, carmine acid is used as a colorant to formulate various makeup products, such as lipsticks and eyeshadows. In the textile industry, carmine acid is widely used as a dye due to its good stability and coloring effect. Furthermore, as its derivative functions are continuously discovered, the carmine cochineal market is gradually expanding into new areas and gaining consumer favor.
[0003] Currently, carmine is mainly extracted from the dried bodies of female cochineal insects (Dactylopius coccus Costa) that parasitize cacti. These insects are native to Mexico and Central America, with the majority of the world's cochineal insects originating from Peru. Female cochineal insects are rich in carmine (accounting for 14%-26% of their dry weight). Traditional production processes rely almost entirely on cochineal extraction. However, cochineal insects suffer from poor disease resistance, cumbersome breeding processes, complex extraction and purification procedures, and limited availability, making them susceptible to regional and climatic influences, leading to fluctuating yields, unstable quality, and high costs. Furthermore, the allergenicity of protein residues from dried insect extracts limits its widespread application. To meet production and daily needs, there is an urgent need to develop an efficient, safe, and sustainable method for producing cochineal pigment.
[0004] Synthetic biology designs and modifies biological systems by decoupling, standardizing, and modularizing biological components found in nature. This strategy is highly efficient, low-cost, and easy to control, and is increasingly being applied to the "factory-scale" production of various functional substances. Based on metabolic engineering and synthetic biology strategies, engineered strains that produce carmine acid are created by manipulating metabolic pathways within organisms, aiming to achieve its microbial synthesis. *Escherichia coli*, due to its clear genetic background and mature genetic manipulation tools, is currently the most widely used chassis cell in the field of synthetic biology manufacturing. The development of synthetic biology has also transformed *E. coli* from a model microorganism into a very important cell factory. Therefore, *E. coli* has significant advantages and potential as a chassis cell for carmine acid synthesis. However, how to achieve efficient synthesis of carmine acid in *E. coli* remains a problem that needs to be solved. Summary of the Invention
[0005] To overcome the problems of existing technologies, this invention proposes a recombinant *E. coli* strain capable of efficiently synthesizing carmine acid, its construction method, and its applications. By heterologously expressing type II polyketide synthase antDEFBG, cyclase zhuI, aromatase zhuJ, hydroxylase RdmE, and C-glucosyltransferase GcCGT in *E. coli* BAP1, a recombinant *E. coli* strain capable of efficiently synthesizing carmine acid is obtained.
[0006] The objective of this invention is achieved as follows:
[0007] The first aspect of the present invention provides a recombinant Escherichia coli for efficient synthesis of carmine acid, wherein the recombinant Escherichia coli expresses type II polyketide synthase antDEFBG, cyclase zhuI, aromatase zhuJ, hydroxylase RdmE and C-glucosyltransferase GcCGT.
[0008] Furthermore, the GenBank accession number for the type II polyketide synthase antDEFBG is BX470251.1; the GenBank accession numbers for the cyclase zhuI and aromatase zhuJ are AF293442.1; the GenBank accession number for the hydroxylase RdmE is WP_230528923.1; and the GenBank accession number for the C-glucosyltransferase GcCGT is 8IE4.
[0009] Furthermore, Escherichia coli BAP1 was used as the starting bacterium.
[0010] A second aspect of the present invention provides a method for constructing the above-mentioned highly efficient recombinant Escherichia coli for synthesizing carmine acid, comprising the following steps:
[0011] The following genes were obtained from the NCBI database: type II polyketide synthase-related genes antD, antE, antF, antB, and antG from *Bacillus luminifera* (GenBank: BX470251.1); cyclase and aromatase genes zhuI and zhuJ from *Streptomyces* (GenBank: AF293442.1); hydroxylase gene RdmE from *Streptomyces cerevisiae* (GenBank: WP_230528923.1); and C-glucosyltransferase gene GcCGT from *Gentiana macrophylla* (GenBank: 8IE4).
[0012] Codon optimization was performed based on the codon preference of E. coli, and the optimized gene sequences were artificially synthesized. The final nucleotide sequences of antD, antE, antF, antB, antG, zhuI, zhuJ, RdmE, and GcCGT are shown in SEQ ID NO.1 to SEQ ID NO.9, respectively.
[0013] The synthesized gene sequences were amplified by PCR and purified. Using homologous recombination technology, the genes encoding type II polyketide synthase antDEFBG, cyclase zhuI, and aromatase zhuJ were constructed into the pET30a vector, and the genes encoding hydroxylase RdmE and C-glucosyltransferase GcCGT were constructed into the pCDFDuet1 vector. The constructed recombinant vectors were transformed into Escherichia coli DH5α by heat shock, and replicated extensively in DH5α. The recombinant plasmids were extracted and then transformed into Escherichia coli by heat shock to obtain an engineered E. coli strain containing both pET30a-antDEFBG-zhuIJ and pCDFDuet1-RdmE-GcCGT recombinant plasmids, which is the recombinant E. coli strain that efficiently synthesizes carmine.
[0014] The third invention provides a method for producing carmine acid, wherein the above-mentioned recombinant Escherichia coli is used as the fermentation strain to obtain carmine acid through fermentation.
[0015] Furthermore, using glucose as a substrate, fermentation was carried out at 25–35°C for at least 48 hours.
[0016] Furthermore, type II polyketide synthase antDEFBG, cyclase zhuI, aromatase zhuJ, hydroxylase RdmE, and C-glucosyltransferase GcCGT were expressed in Escherichia coli.
[0017] Furthermore, the GenBank accession number for the type II polyketide synthase antDEFBG is BX470251.1; the GenBank accession numbers for the cyclase zhuI and aromatase zhuJ are AF293442.1; the GenBank accession number for the hydroxylase RdmE is WP_230528923.1; and the GenBank accession number for the C-glucosyltransferase GcCGT is 8IE4.
[0018] The fourth invention provides a recombinant Escherichia coli for the efficient synthesis of carmine acid, and the application of the above method in the preparation of products containing carmine acid.
[0019] The advantages and beneficial effects of this invention are:
[0020] 1. Based on the known biosynthetic pathway of carmine acid, this invention utilizes homologous recombination technology to construct genes for key enzymes, including polyketide synthase, cyclase, aromatase, hydroxylase, and C-glucosyltransferase, onto vectors pET30a and pCDFDuet1 with different selection markers. The resulting recombinant plasmid pET30a-antDEFBG-zhuIJ enables the synthesis of the precursors acetyl-CoA and malonyl-CoA into the key intermediate product yellow carmine acid, while the recombinant plasmid pCDFDuet1-RdmE-GcCGT enables the synthesis of carmine acid from yellow carmine acid. The obtained recombinant Escherichia coli strain PFA, after shake-flask culture and LC-QTOF detection and verification, can synthesize carmine acid.
[0021] 2. This invention identifies the process of carmine synthesis pathway in Escherichia coli and successfully constructs the carmine synthesis pathway. The carmine yield of the constructed recombinant Escherichia coli can reach 19.4 μg / L after shaking flask culture for 48 h. Attached Figure Description
[0022] The present invention will be further described below with reference to the accompanying drawings and embodiments.
[0023] Figure 1 This is the plasmid map of the recombinant vector pET30a-antDEFBG-zhuIJ;
[0024] Figure 2 This is the plasmid map of the recombinant vector pCDFDuet1-RdmE-GcCGT;
[0025] Figure 3 This is a gel electrophoresis image of recombinant Escherichia coli PFA colony PCR verification;
[0026] Figure 4 The images show the LC-QTOF graphs of recombinant Escherichia coli PFA, control, and standard carmine acid.
[0027] Figure 5 This is a diagram showing the synthetic pathway of carmine acid synthesized by Escherichia coli. Detailed Implementation
[0028] The preferred embodiments of the present invention will be described in detail below with reference to examples. It should be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from the spirit and intent of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the equipment and reagents used are all commercially available.
[0029] Example 1 – Construction of Recombinant Escherichia coli BAP1
[0030] This embodiment uses E. coli BAP1 as the starting strain, which was purchased from Beijing BioBio Biotechnology Co., Ltd., to construct a recombinant Escherichia coli that efficiently synthesizes carmine acid, including the following steps:
[0031] Step 1: Codon optimization, recombinant vector design, and artificial synthesis of genes related to the carmine synthesis pathway:
[0032] Based on the codon preference of *E. coli*, codon optimization was performed on antD, antE, antF, antB, antG, zhuI, zhuJ, RdmE, and GcCGT. The optimized nucleotide sequences are shown in SEQ ID No. 1 to SEQ ID No. 9, respectively. To ensure successful expression of the relevant genes, complete expression elements were designed for each gene and constructed together with the genes into two expression vectors with different resistances. The recombinant vector design is as follows:
[0033] pET30a(P T7 -antDEF-T T7 -P T7 -antB-T T7 -P T7 -antG-T rrnBT1 -P tac -zhuIJ-T T7 ), pCDFDuet1(P T7 -RdmE-T T7 -P T7 -GcCGT-T T7 ), where P represents the promoter and T represents the terminator. Related expression elements and gene segments are synthesized, where segment 1 contains antD and antE, segment 2 contains antF, antB, and antG, segment 3 contains zhuI and zhuJ, segment 4 contains RdmE, and segment 5 contains GcCGT.
[0034]
[0035]
[0036]
[0037]
[0038]
[0039] Step 2: Construction of recombinant plasmids pET30a-antDEFBG-zhuIJ and pCDFDuet1-RdmE-GcCGT:
[0040] 2.1 Gene fragments synthesized by PCR amplification
[0041] Specific primers with homologous arms were designed. Using the synthetically produced pUC57 plasmid containing the antD, antE, antF, antB, antG, zhuI, zhuJ, RdmE, and GcCGT genes and their expression elements as a template, PCR amplification was performed using primer pair F1-F / F1-R, and the product was purified to obtain fragment 1 containing the antD and antE genes. PCR amplification was performed using primer pair F2-F / F2-R, and the product was purified to obtain fragment 2 containing the antF, antB, and antG genes. PCR amplification was performed using primer pair F3-F / F3-R, and the product was purified to obtain fragment 3 containing the zhuI and zhuJ genes. PCR amplification was performed using primer pair F4-F / F4-R, and the product was purified to obtain fragment 4 containing the RdmE gene. PCR amplification was performed using primer pair F5-F / F5-R, and the product was purified to obtain fragment 5 containing the GcCGT gene. The primer sequences are shown in the table below.
[0042]
[0043] The PCR reaction program was as follows: Fragment 1: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 57℃ annealing for 15 s, 72℃ extension for 3 min, 72℃ final extension for 5 min, for a total of 30 cycles; Fragment 2: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 3 min, 72℃ final extension for 5 min, for a total of 30 cycles; Fragments 3, 4, and 5: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 2 min, 72℃ final extension for 5 min, for a total of 30 cycles. The PCR amplification products were analyzed and purified by 1% agarose gel electrophoresis.
[0044] 2.2 Vector Construction Using Homologous Recombination
[0045] The method is as follows: The pET30a plasmid was double-digested with NdeI and NcoI restriction endonucleases, followed by agarose gel electrophoresis. The digested vector was then recovered and purified using the gel. The recovered linearized vector fragment was mixed with the amplified and purified products of fragments 1, 2, and 3 using a homologous recombination cloning kit (Vazyme) at a molar ratio (vector to each insert fragment molar ratio was 1:1). The recombinant products were ligated at 50℃ for 15 min to construct the pET30a plasmid. Figure 1The recombinant plasmid pET30a-antDEFBG-zhuIJ shown was used. The pCDFDuet1 plasmid was double-digested with NcoI and KpnI. The linearized vector purified by digestion was then mixed with the amplified and purified fragments 4 and 5 at a molar ratio (vector to each insert fragment molar ratio was 1:1). The recombinant products were ligated at 50℃ for 15 min to obtain the desired product. Figure 2 The recombinant plasmid pCDFDuet1-RdmE-GcCGT is shown.
[0046] Step 3, Preparation of recombinant Escherichia coli BAP1 strain:
[0047] 3.1 Mass replication of recombinant plasmids in Escherichia coli
[0048] The recombinant products pET30a-antDEFBG-zhuIJ and pCDFDuet1-RdmE-GcCGT obtained above were transformed into Escherichia coli DH5α by heat shock method.
[0049] Positive transformants were identified using colony PCR. The positive transformant of recombinant plasmid pET30a-antDEFBG-zhuIJ was verified using primer pair S1-F / F3-R, and the positive transformant of recombinant plasmid pCDFDuet1-RdmE-GcCGT was verified using primer pair S2-F / F5-R. The sequences of the verification primers are shown in the table below.
[0050] Primers Serial Number Sequence 5'-3' S1-F SEQ ID No. 20 TGATGCCGGCCACGATGCGT F3-R SEQ ID No. 15 TTCGGATCCGATATCAGCCATGGTTAATCCTCTTCTTC S2-F SEQ ID No. 21 GGATCTCGACGCTCTCCCT F5-R SEQ ID No. 19 CGAGGGTACCTTATTTGGTGCCGGTTTTACG
[0051] The reaction program for colony PCR was as follows: pET30a-antDEFBG-zhuIJ: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 7 min, 72℃ final extension for 5 min, for a total of 30 cycles. pCDFDuet1-RdmE-GcCGT: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 4 min, 72℃ final extension for 5 min, for a total of 30 cycles.
[0052] The obtained pET30a-antDEFBG-zhuIJ and pCDFDuet1-RdmE-GcCGT positive recombinants were inoculated into fresh LB liquid medium (containing kanamycin and streptomycin, respectively), cultured at 37°C with shaking at 200 rpm, and then the plasmids were extracted and sequenced for identification. The positive recombinants with correct sequencing were prepared into glycerol bacteria and stored at -80°C for later use.
[0053] 3.2 Preparation of recombinant Escherichia coli BAP1 strain
[0054] E. coli BAP1 competent cells were prepared using the CaCl2 method. The pCDFDuet1-RdmE-GcCGT recombinant plasmid was transformed into BAP1 competent cells using the heat shock method. Colony PCR was performed using primer pair S2-F / F5-R to verify the correctness of the transformants and ensure the pCDFDuet1-RdmE-GcCGT recombinant plasmid was successfully transformed into BAP1 cells. Positive transformants were cultured amplified, and BAP1 competent cells containing the pCDFDuet1-RdmE-GcCGT recombinant plasmid were prepared again using the CaCl2 method. Based on these competent cells, the pET30a-antDEFBG-zhuIJ recombinant plasmid was transformed into them using the heat shock method. Colony PCR was performed simultaneously using primer pair S1-F / F3-R and primer pair S2-F / F5-R to verify the transformation. The results are as follows: Figure 3 As shown. Expanding the culture of positive transformants yields BAP1 recombinant Escherichia coli PFA containing two recombinant plasmids, pET30a-antDEFBG-zhuIJ and pCDFDuet1-RdmE-GcCGT. This is the recombinant Escherichia coli that efficiently synthesizes carmine acid. The glycerol-containing bacteria are stored at -80℃ for later use.
[0055] Example 2 – Identification of the ability of recombinant Escherichia coli BAP1 to synthesize carmine acid
[0056] To determine whether the recombinant Escherichia coli PFA constructed in Example 1 has the ability to synthesize carmine acid, this example induced and subjected the recombinant Escherichia coli PFA to shake-flask fermentation.
[0057] I. Induction of Recombinant Strains and Shake-Flavor Fermentation
[0058] The recombinant Escherichia coli PFA (containing two recombinant plasmids, pET30a-antDEFBG-zhuIJ and pCDFDuet1-RdmE-GcCGT) and control bacteria (containing pET30a and pCDFDuet1-empty vector) obtained in Example 1 were streaked onto LB agar plates (containing kanamycin and streptomycin) and incubated overnight in an inverted 37°C incubator. Single colonies of the recombinant bacteria and control bacteria were picked from the newly activated plates and inoculated into shake flasks containing fresh LB medium. After overnight incubation at 37°C and 200 rpm, they became activated seed cultures. The activated seed cultures were then inoculated into fresh R2 medium and incubated at 30°C and 200 rpm until OD200. 600 The concentration was initially set between 0.6 and 0.8; then IPTG was added to bring the final concentration to 0.5 mM. At the same time, glucose (20 g / L) and ascorbic acid (0.45 g / L) were added. Expression was induced at 30°C and 200 rpm for 48 h, and the color change of the culture medium was observed.
[0059] (1) Culture medium components
[0060] LB medium: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L. Add 15 g / L agar powder to prepare solid LB medium;
[0061] R2 medium: yeast extract 3g / L, diamine hydrogen phosphate 2g / L, potassium dihydrogen phosphate 6.75g / L, citric acid 0.85g / L, magnesium sulfate heptahydrate 0.8g / L, trace metal solution 5mL / L.
[0062] (2) Solution
[0063] Trace metal solution: 0.1M hydrochloric acid, 10g / L ferrous sulfate heptahydrate, 2.25g / L zinc sulfate heptahydrate, 1g / L copper sulfate pentahydrate, 0.41g / L manganese sulfate monohydrate, 0.02g / L sodium tetraborate decahydrate, 2g / L calcium chloride dihydrate, and 0.1g / L ammonium molybdate tetrahydrate.
[0064] II. LC-QTOF Detection of Carmine Acid
[0065] (1) Pretreatment of fermentation broth samples
[0066] Solid-phase extraction was used for extraction. 30 mL of culture medium was centrifuged at 4000 g for 30 min, and the supernatant was added to a pre-activated SPE (HLB) column. The supernatant was then loaded onto the column. After loading, the column was washed with 6 mL of 5% methanol-water mixture, eluted with 12 mL of methanol, dried under nitrogen, and reconstituted with an appropriate amount of 1% formic acid-methanol. The sample was then concentrated 75 times, i.e., reconstituted with 0.4 mL of 1% formic acid-methanol mixture, and filtered through a 0.22 μm filter membrane for later use.
[0067] (2) LC-QTOF determination of carmine acid yield
[0068] The chromatographic column was a ZORBAX Eclipse Plus C18 column (4.6 × 150 mm, 5 μm). Detection was performed using an Agilent TOF analyzer at 40 °C. The mobile phase consisted of an aqueous solution (A) containing 0.1% formic acid and acetonitrile (B) containing 0.1% formic acid, eluted at a flow rate of 0.4 mL / min. Elution conditions were: 0–20 min, 10%–100% B; 20–25 min, 100% B; 25–27 min, 100%–10% B; 28–30 min, 10% B. TOF negative ion mode was used, with a mass range of 300–500 m / z.
[0069] The results are as follows Figure 4As shown, carmine acid was detected in recombinant E. coli PFA induced by IPTG, with a yield of 19.4 μg / L. No carmine acid was detected in the uninduced recombinant strain, the induced control strain, or the uninduced control strain. Therefore, carmine acid can be synthesized by expressing the antD, antE, antF, antB, antG, zhuI, zhuJ, RdmE, and GcCGT genes in E. coli BAP1.
[0070] Figure 5 This describes the biosynthetic pathway of carmine acid in *Escherichia coli*. Glucose, as a substrate, is broken down into pyruvate via glycolysis. *E. coli* then generates acetyl-CoA via metabolic pathways such as the pyruvate dehydrogenase complex. Acetyl-CoA is then converted to malonyl-CoA by acetyl-CoA carboxylase (ACC). The synthesis of carmine acid in *E. coli* uses acetyl-CoA and malonyl-CoA as precursors. Under the action of the introduced exogenous enzyme polyketide synthase (antDEFBG), polyketide compounds are obtained. These compounds are then converted to yellow carmine acid by cyclase and aromatase (zhuIJ). Yellow carmine acid undergoes hydroxylation and glycosylation reactions under the action of hydroxylase (RdmE) and C-glucosyltransferase (GcCGT) to produce the final product, carmine acid.
[0071] Finally, it should be noted that the above description is only used to illustrate the technical solutions of the present invention and is not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention.
Claims
1. A recombinant Escherichia coli for efficient synthesis of carmine acid, characterized in that, The recombinant Escherichia coli expressed type II polyketide synthase antDEFBG, cyclase zhuI, aromatase zhuJ, hydroxylase RdmE, and C-glucosyltransferase GcCGT.
2. The recombinant Escherichia coli according to claim 1, characterized in that, The GenBank accession number for the type II polyketide synthase antDEFBG is BX470251.1; the GenBank accession number for the cyclase zhuI and aromatase zhuJ is AF293442.1; the GenBank accession number for the hydroxylase RdmE is WP_230528923.1; and the GenBank accession number for the C-glucosyltransferase GcCGT is 8IE4.
3. The recombinant Escherichia coli according to claim 1, characterized in that, The starting strain was Escherichia coli BAP1.
4. The method for constructing recombinant Escherichia coli for efficient synthesis of carmine acid as described in any one of claims 1 to 3, characterized in that, The construction method includes the following steps: Based on the gene sequences encoding type II polyketide synthase antDEFBG, cyclase zhuI, aromatase zhuJ, hydroxylase RdmE, and C-glucosyltransferase GcCGT, codon optimization was performed according to the codon preference of Escherichia coli, and the optimized gene sequences were artificially synthesized. The synthesized gene sequences were amplified by PCR and purified. Using homologous recombination technology, the genes encoding type II polyketide synthase antDEFBG, cyclase zhuI, and aromatase zhuJ were constructed into the pET30a vector, and the genes encoding hydroxylase RdmE and C-glucosyltransferase GcCGT were constructed into the pCDFDuet1 vector. The constructed recombinant vectors were transformed into Escherichia coli DH5α by heat shock, and replicated extensively in DH5α. The recombinant plasmids were extracted and then transformed into Escherichia coli by heat shock to obtain an engineered E. coli strain containing both pET30a-antDEFBG-zhuIJ and pCDFDuet1-RdmE-GcCGT recombinant plasmids, which is the recombinant E. coli strain that efficiently synthesizes carmine.
5. A method for producing carmine acid, characterized in that, Using the recombinant Escherichia coli according to any one of claims 1 to 3 as the fermentation strain, carmine acid is obtained by fermentation.
6. The method for producing carmine acid according to claim 5, characterized in that, Using glucose as a substrate, ferment at 25–35°C for at least 48 hours.
7. A method for synthesizing carmine acid using Escherichia coli, characterized in that, Type II polyketide synthase antDEFBG, cyclase zhuI, aromatase zhuJ, hydroxylase RdmE, and C-glucosyltransferase GcCGT were expressed in Escherichia coli.
8. The method according to claim 7, characterized in that, The GenBank accession number for the type II polyketide synthase antDEFBG is BX470251.1; the GenBank accession number for the cyclase zhuI and aromatase zhuJ is AF293442.1; the GenBank accession number for the hydroxylase RdmE is WP_230528923.1; and the GenBank accession number for the C-glucosyltransferase GcCGT is 8IE4.
9. The method according to claim 7, characterized in that, The Escherichia coli produces carmine acid in a fermentation system containing glucose.
10. The recombinant Escherichia coli as described in any one of claims 1 to 3, or the method as described in any one of claims 5 to 9, in the preparation of products containing carmine acid.