Molecular marker on chromosome 5 associated with soybean branch number and use thereof
By locating the SNP site Gm_Chr05_5125320 in soybean and designing KASP marker primers, the low efficiency problem of determining the number of soybean branches in traditional breeding methods was solved, enabling accurate prediction and efficient screening of the number of soybean branches and improving breeding efficiency.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHANDONG AGRICULTURAL UNIVERSITY
- Filing Date
- 2026-03-23
- Publication Date
- 2026-07-07
AI Technical Summary
The number of branches in soybeans is a quantitative trait controlled by multiple genes. Traditional breeding methods are inefficient and not precise enough, making it difficult to accurately determine the target genotype in the early stages, which affects the efficiency of soybean breeding.
By locating the SNP site Gm_Chr05_5125320 in the linkage region of soybean, a KASP marker primer set was designed, and the number of soybean branches was detected by real-time quantitative PCR, thus developing a rapid and efficient molecular marker-assisted breeding method.
It enables accurate prediction and screening of soybean branch numbers, improves breeding efficiency, simplifies the material selection process, and reduces costs.
Smart Images

Figure CN121874398B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to molecular markers located on chromosome 5 that are related to the number of soybean branches and their applications. Background Technology
[0002] Soybeans Glycine max Soybeans (L.) Merr. are an important food and oilseed crop, holding a dominant position in the global food and oil system. Statistics show that cultivated soybeans meet approximately 50% of the world's vegetable oil demand and 25% of its vegetable protein demand, and permeate modern diets through various processing methods. With population growth and decreasing arable land, the supply and demand relationship for soybeans is becoming increasingly strained; increasing soybean yields on limited arable land is now urgent. Many factors influence soybean yield, and in the development of crop breeding technology, ideal plant architecture has become the optimal solution for increasing yield. The semi-dwarfing breeding approach widely used in gramineous crops is not applicable to soybeans. Soybean plant architecture affects a series of yield components, including pod-setting habits, pod quantity, seed distribution, and seed size, and is a crucial pathway to increasing yield. Regarding pod-setting habits, semi-dwarfing breeding may reduce pod quantity; conversely, more branches and nodes seem to suggest higher growth potential. However, excessive branching is detrimental to dense planting and increases susceptibility to disease. Therefore, precise control of branching number is crucial for soybean breeding.
[0003] However, soybean branch number, as a quantitative trait, is controlled by multiple genes and influenced by cultivation and environmental conditions, resulting in complex genetic patterns. Traditional breeding methods rely heavily on field phenotypic data for selection. While this has promoted the development of varieties with ideal plant types to some extent, it is inefficient and lacks precision, often requiring multiple generations to obtain ideal materials. To address this challenge, modern molecular breeding methods have been widely introduced, providing new insights into the regulation of soybean branch number.
[0004] Molecular marker technology provides a powerful tool for the research and application of quantitative traits. Among the many marker types, KASP (Kompetitive Allele Specific PCR) technology is widely used due to its sensitivity, stability, and low cost. KASP relies on allele-specific amplification and fluorescence signal determination to achieve accurate genotyping of target single nucleotide polymorphisms (SNPs), making it particularly suitable for rapid screening of large-scale populations. In soybean breeding, developing KASP markers around genes or genomic loci regions related to soybean branch number or quantitative traits allows breeders to accurately determine target genotypes at an early stage of material screening, significantly improving breeding efficiency.
[0005] Meanwhile, QTL mapping is crucial for elucidating the genetic mechanism of branch number in soybean. By scanning the entire genome and performing association analysis between molecular markers (SNP markers, etc.) and specific traits (branch number, etc.), key gene loci affecting these traits can be located. Based on tightly linked or functional SNP loci, high-throughput, low-cost functional molecular markers can be developed.
[0006] In summary, precise regulation of soybean branch number is a crucial pathway to improving soybean yield. By combining KASP markers with QTL mapping, researchers can effectively control complex quantitative traits at the genotype level, thereby propelling soybean breeding towards greater efficiency and precision. Summary of the Invention
[0007] One of the objectives of this invention is to provide a molecular marker related to the number of branches in soybean.
[0008] The second objective of this invention is to provide the application of the aforementioned molecular markers related to the number of soybean branches.
[0009] To achieve the above objectives, the present invention adopts the following technical solution:
[0010] This invention discloses molecular markers related to the number of branches in soybean. Through statistical analysis of the number of branches at soybean maturity and QTL mapping, the inventors located a linkage region in soybean containing a single SNP locus, named Gm_Chr05_5125320, located in the soybean reference genome. Glycine max A T / C base mutation exists at position 5125320 on chromosome 5 of Wm82.a4.v1. The nucleotide sequence of this SNP site is shown in SEQ ID NO.1. When the base at this site is T (TT genotype, hereinafter referred to as 0 / 0 genotype), the soybean material has a high number of branches. When the base at this site is C (CC genotype, hereinafter referred to as 1 / 1 genotype), the soybean material has a low number of branches. There is also a heterozygous case, the TC genotype, also known as 0 / 1 genotype, which also results in a significantly lower number of branches. Population validation results show that the number of branches in soybean material with genotype 1 / 1 is significantly lower than that in soybean material with genotype 0 / 0, and the difference is statistically significant.
[0011] Specifically, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein a T / C base mutation exists at position 25 of the sequence shown in SEQ ID NO.1, and the sequence is:
[0012] TCTTTTTTTCATTCATTTTTTTTA [T / C]CCTTACAGTTTTTTTTATCCAAACATTAAA (as shown in SEQ ID NO.1, the bold and underlined part is the SNP site Gm_Chr05_5125320 (T / C)).
[0013] Based on this SNP site, a primer set for the KASP marker was designed to amplify the KASP marker primer set associated with the number of soybean branches. The primer set sequence for the molecular marker is as follows:
[0014] Gm_Chr05_5125320-F1: GAAGGTGACCAAGTTCATGCTTCTTTTTTTCATTCATTTTTTTTAT (shown in SEQ ID NO.2);
[0015] Gm_Chr05_5125320-F2: GAAGGTCGGAGTCAACGGATTTCTTTTTTTCATTCATTTTTTTTAC (shown in SEQ ID NO.3);
[0016] Gm_Chr05_5125320-R: TAAAATTTAATGTTTGGATAAAAAAAACT (shown as SEQ ID NO.4).
[0017] Two forward primers are attached to different fluorescent adapter sequences; the 5' end of forward primer Gm_Chr05_5125320-F1 is attached to the FAM fluorescent adapter sequence, and the 5' end of forward primer Gm_Chr05_5125320-F2 is attached to the VIC fluorescent adapter sequence; the FAM and VIC fluorescent adapter sequences are as follows:
[0018] FAM: GAAGGTGACCAAGTTCATGCT (shown in SEQ ID NO.5);
[0019] VIC: GAAGGTCGGAGTCAACGGATT (shown as SEQ ID NO.6).
[0020] This invention also discloses the application of the primer set of the aforementioned molecular markers in marker-assisted breeding of soybean branch number. In other words, the primer set of the molecular markers of this invention can be used in future marker-assisted breeding to predict the branch number of soybean materials by extracting DNA from seedling leaves and detecting the presence of the molecular markers of this invention. The detection can be performed using quantitative real-time PCR, specifically using the aforementioned molecular marker primer set.
[0021] This invention also discloses the application of the aforementioned molecular marker primer set in predicting the number of soybean branches. Specifically, the specific steps for predicting the number of soybean branches are as follows:
[0022] Using the DNA of the tested soybean germplasm as a template for quantitative real-time PCR amplification, quantitative real-time PCR amplification was performed using the primer set corresponding to the molecular marker Gm_Chr05_5125320. The reaction system for quantitative real-time PCR amplification is shown in Tables 1, 2, and 3.
[0023] Table 1 PCR primer premix preparation
[0024]
[0025] Table 2 Reaction system configuration
[0026]
[0027] Table 3 PCR reaction procedure
[0028]
[0029] Quantitative real-time PCR amplification was performed using primer sets Gm_Chr05_5125320-F1, Gm_Chr05_5125320-F2, and Gm_Chr05_5125320-R. If only primer Gm_Chr05_5125320-F1 containing the fluorescent adapter sequence was detected in the PCR product of the sample, the result would be positive. If the corresponding FAM fluorescence signal is detected, the detection site is the 0 / 0 genotype, which is determined to be a homozygous type with a large number of branches. If the PCR product of the sample only detects the VIC fluorescence signal corresponding to the primer Gm_Chr05_5125320-F2 with the fluorescent adapter sequence, the detection site is the 1 / 1 genotype, which is determined to be a homozygous type with a small number of branches. If both FAM and VIC fluorescence signals corresponding to primers Gm_Chr05_5125320-F1 and Gm_Chr05_5125320-F2 with the fluorescent adapter sequence are detected at the same time, the detection site is the 0 / 1 genotype (corresponding to the TC genotype), which is determined to be a heterozygous type with a small number of branches.
[0030] In addition, this invention also protects a kit for predicting the number of branches in soybeans, the kit containing primer sets Gm_Chr05_5125320-F1, Gm_Chr05_5125320-F2, and Gm_Chr05_5125320-R. Other components of the kit are from Guangzhou Goodbio's FLU-ARMS for KASP 2×PCR Mix V5F. This invention does not impose any special restrictions on the concentration of the primer sets, but a concentration of 10 μM is recommended. This invention does not impose any special restrictions on the source of the 2×PCR Mix; commercially available KASP genotyping kits are acceptable.
[0031] The kit of this invention can rapidly predict the number of soybean branches and the genotype of soybean branch number. The specific method follows the steps for predicting the number of soybean branches. Analysis of the quantitative PCR amplification results reveals the following: If the PCR product only detects the FAM fluorescence signal corresponding to primer Gm_Chr05_5125320-F1 with the fluorescent adapter sequence, the detection site is the 0 / 0 genotype, and the base information is TT; if the PCR product only detects the VIC fluorescence signal corresponding to primer Gm_Chr05_5125320-F2 with the fluorescent adapter sequence, the detection site is the 1 / 1 genotype, and the base information is CC; if both FAM and VIC fluorescence signals corresponding to primers Gm_Chr05_5125320-F1 and Gm_Chr05_5125320-F2 with the fluorescent adapter sequence are detected simultaneously, the detection site is the 0 / 1 genotype, and the base information is TC.
[0032] The present invention has the following advantages:
[0033] (1) The inventors of this invention screened out a molecular marker Gm_Chr05_5125320 that is related to the number of branches in soybean. This molecular marker is located on chromosome 5. Using the molecular marker Gm_Chr05_5125320 of this invention, the number of branches in soybean plants can be quickly predicted.
[0034] (2) Using markers linked to the number of soybean branches for screening is beneficial for molecular marker-assisted selection breeding. The method is simple and feasible, which can improve efficiency and save costs.
[0035] (3) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity. They can be easily, quickly and with high throughput applied to molecular marker-assisted breeding practices and material prediction for soybean branch number. Attached Figure Description
[0036] Figure 1The QTL mapping results for soybean branch number are genome-wide signals obtained based on qtl / r software analysis. The red arrows indicate the SNP locations associated with this invention.
[0037] Figure 2 The results of KASP analysis on soybean materials used to develop KASP molecular markers are shown. Two negative controls were used to exclude typing errors.
[0038] Figure 3 This is a violin plot showing the genotype distribution of branch number at the Gm_Chr05_5125320 locus in the soybean population of Example 1 of this invention. 0 / 0 indicates a homozygous high-branch genotype at the Gm_Chr05_5125320 locus, 1 / 1 indicates a homozygous low-branch genotype at the Gm_Chr05_5125320 locus, and 0 / 1 indicates a heterozygous low-branch genotype at the Gm_Chr05_5125320 locus. Multiple comparisons (Tukey HSD) were used to determine the significance of the data.
[0039] Figure 4 The genotyping results and the correspondence between the number of branches phenotypes of 71 soybean germplasm resources located at the Gm_Chr05_5125320 locus were obtained using this invention. Detailed Implementation
[0040] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.
[0041] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.
[0042] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.
[0043] Example 1: Development of molecular markers related to soybean branch number
[0044] This invention analyzed 142 soybean recombinant inbred lines, examining the number of branches at maturity and performing QTL mapping using genetic maps. A linkage region containing a single SNP locus, named Gm_Chr05_5125320, was located in the soybean reference genome. Glycine max The SNP locus in Wm82.a4.v1 (downloadable from https: / / phytozome-next.jgi.doe.gov / ) is located at position 5125320 on chromosome 5. This SNP locus contains a T / C base mutation. The nucleotide sequence of this SNP locus is shown in SEQ ID NO. 1, and it is located at position 25 (counting from the first base at the 5' end as position 1). When the base at this locus is T (0 / 0 genotype), the soybean has a high number of branches; when the base at this locus is C (1 / 1 genotype), the soybean has a low number of branches. A violin plot showing the branch number distribution corresponding to the genotype at the Gm_Chr05_5125320 locus in the population is shown below. Figure 3 Among them, soybean materials with genotype 0 / 0 showed a phenotype with a large number of branches, while soybean materials with genotypes 0 / 1 and 1 / 1 showed a phenotype with a small number of branches. Furthermore, soybean materials with genotypes 0 / 1 and 1 / 1 had fewer branches than soybean materials with genotype 0 / 0, and the difference in the number of branches was significant.
[0045] Based on this SNP site and its upstream and downstream sequences, markers for KASP detection were developed, and the following primer set was designed using SnapGene:
[0046] Gm_Chr05_5125320-F1: GAAGGTGACCAAGTTCATGCTTCTTTTTTTCATTCATTTTTTTTAT (shown in SEQ ID NO.2);
[0047] Gm_Chr05_5125320-F2: GAAGGTCGGAGTCAACGGATTTCTTTTTTTCATTCATTTTTTTTAC (shown in SEQ ID NO.3);
[0048] Gm_Chr05_5125320-R: TAAAATTTAATGTTTGGATAAAAAAAACT (shown as SEQ ID NO.4).
[0049] Using this primer set, quantitative real-time PCR amplification was performed on the sample. The results showed that if the PCR product only detected the FAM fluorescence signal corresponding to primer Gm_Chr05_5125320-F1 with the fluorescent adapter sequence, the detection site indicated a 0 / 0 genotype, classifying it as a homozygous type with a large number of branches. If the PCR product only detected the VIC fluorescence signal corresponding to primer Gm_Chr05_5125320-F2 with the fluorescent adapter sequence, the detection site indicated a 1 / 1 genotype, classifying it as a homozygous type with a small number of branches. If both FAM and VIC fluorescence signals corresponding to primers Gm_Chr05_5125320-F1 and Gm_Chr05_5125320-F2 with the fluorescent adapter sequence were detected simultaneously, the detection site indicated a 0 / 1 genotype, classifying it as a heterozygous type with a small number of branches. Figure 2 ).
[0050] This study developed markers in 142 soybean accessions. Of these, 79 accessions had a genotype of 0 / 0 at the Gm_Chr05_5125320 locus; 58 accessions had a genotype of 1 / 1 at the Gm_Chr05_5125320 locus; and 5 accessions had a genotype of 0 / 1 at the Gm_Chr05_5125320 locus. Multiple testing showed significant differences between the 0 / 0 genotype and the 0 / 1 and 1 / 1 genotypes. These results corresponded consistently with the genotypes at the Gm_Chr05_5125320 locus and the actual number of branches determined. Figure 3 It also has a high classification accuracy rate (98.7%).
[0051] The 142 soybean accessions used for marker development were those published in the article "Liu, L., Cao, H., Yao, H., Zhuang, Y., Chen, B., Zhang, C., Li, X., & Zhang, D. (2025). Identification of a major QTL and its candidate genes controlling stem strength in soybean via QTL mapping and GWAS. The Crop Journal, 13(6), 1805–1815."
[0052] Example 2: Accuracy verification of the molecular markers described in this invention
[0053] In addition, this invention also uses the above-mentioned molecular markers to predict 71 random soybean germplasm resources in the germplasm resource bank. The specific number of branches of the soybean germplasm materials used and the genotype corresponding to the Chr05_5125320 locus are shown in Table 4:
[0054] Table 4. Number of branches and genotypes corresponding to the Chr05_5125320 locus in 71 soybean germplasm materials.
[0055]
[0056]
[0057] Using the genomic DNA of the soybean to be predicted as a template, the primer set was used for real-time PCR amplification to obtain the real-time PCR product;
[0058] The reaction system for real-time PCR amplification is as follows: 1 μL genomic DNA, 5 μL 2×PCR Mix, and SNP-specific primers. a 0.063 μL, add sterile distilled water to bring the volume to 10 μL;
[0059] The preferred reaction program for quantitative real-time PCR amplification is as follows: initial denaturation at 95℃ for 15 min; denaturation at 95℃ for 20 s, annealing and extension at 61℃ for 1 min, 10 cycles (cooling down by 0.6℃ per cycle); denaturation at 95℃ for 20 s, annealing and extension at 55℃ and fluorescence reading for 1 min, 33 cycles; final fluorescence reading at 30℃ for 1 min.
[0060] Predicting the number of soybean branches based on quantitative real-time PCR signals:
[0061] From Table 4 and Figure 4 As can be seen from the predictions made in this study among 71 soybean germplasm resources, 54 soybean germplasm resources had a genotype of 0 / 0 at the Gm_Chr05_5125320 locus, and 17 soybean germplasm resources had a genotype of 1 / 1 at the Gm_Chr05_5125320 locus. The t-test showed a significant difference between the 0 / 0 and 1 / 1 genotypes. P <0.05). The detection results are basically consistent with the genotype at the Gm_Chr05_5125320 locus and the actual branch number statistics. Therefore, the KASP marker of this invention can effectively predict the number of soybean branches and can be used for the prediction and screening of the number of branches in soybean materials.
[0062] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the present invention.
Claims
1. The application of a molecular marker located on chromosome 5 and associated with the number of soybean branches in predicting or assisting in the prediction of the number of soybean branches, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein there is a T / C base mutation at position 25 of the sequence shown in SEQ ID NO.
1. When the base at this position is T, the soybean material has a large number of branches, and when the base at this position is C, the soybean material has a small number of branches.
2. The application according to claim 1, characterized in that, The molecular marker is the KASP marker.
3. The application of the primer set of the molecular marker described in claim 1 or a kit containing said primer set in predicting or assisting in the prediction of the number of branches in soybeans, characterized in that, The primer set is as follows: Gm_Chr05_5125320-F1: GAAGGTGACCAAGTTCATGCTTCTTTTTTTCATTCATTTTTTTTAT; Gm_Chr05_5125320-F2:GAAGGTCGGAGTCAACGGATTTCTTTTTTTCATTCATTTTTTTTAC; Gm_Chr05_5125320-R: TAAAATTTAATGTTTGGATAAAAAAAACT; The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein there is a T / C base mutation at position 25 of the sequence shown in SEQ ID NO.
1. When the base at this position is T, the soybean material has a large number of branches, and when the base at this position is C, the soybean material has a small number of branches.
4. The application according to claim 3, characterized in that, The two forward primers are connected to different fluorescent adapter sequences; the 5' end of the forward primer Gm_Chr05_5125320-F1 is connected to the FAM fluorescent adapter sequence, and the 5' end of the forward primer Gm_Chr05_5125320-F2 is connected to the VIC fluorescent adapter sequence.
5. The application according to claim 4, characterized in that, A method for predicting the number of branches in soybeans using the primer set or the kit includes the following steps: (1) Extract soybean genomic DNA for testing; (2) Using the genomic DNA extracted in step (1) as a template, perform real-time PCR amplification using the primer set or kit, and analyze the results of real-time PCR amplification. (3) Make a judgment based on the result of step (2), and the specific criteria are as follows: If only FAM fluorescence signal is detected in the PCR product of the sample, the locus is a 0 / 0 genotype, which is determined to be a homozygous type with a large number of branches; if only VIC fluorescence signal is detected in the PCR product of the sample, the locus is a 1 / 1 genotype, which is determined to be a homozygous type with a small number of branches; if both FAM and VIC fluorescence signals are detected simultaneously, the locus is a 0 / 1 genotype, which is determined to be a heterozygous type with a small number of branches.