Primer and probe for fluorescent PCR method for identifying and detecting African swine fever wild strain and gene-deleted attenuated strain

By designing gene-specific primers and probes for ASFV P49, 9GL, and MGF360-14L, a triple TaqMan real-time PCR method was established, which solved the problem of identifying and detecting wild-type African swine fever strains and gene-deleted attenuated strains, achieving rapid and accurate identification and detection results.

CN121874402APending Publication Date: 2026-04-17HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY
Filing Date
2025-09-29
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

Existing technologies struggle to quickly and accurately distinguish between wild-type African swine fever strains and gene-deleted attenuated strains, there is a lack of effective commercial vaccines, and detection methods lack sufficient sensitivity and specificity.

Method used

We designed specific primers and fluorescently labeled probes based on the conserved regions of the ASFV P49, 9GL, and MGF360-14L genes, and established a triple TaqMan real-time PCR method to identify wild-type strains and gene-deleted attenuated strains through triple detection.

Benefits of technology

It enables rapid identification and detection of African swine fever wild-type strains and gene-deleted attenuated strains in a single reaction, with high sensitivity and specificity. The detection can be completed within 70 minutes, reducing costs and improving detection efficiency. It is suitable for the simultaneous diagnosis of multiple pathogenic microorganisms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121874402A_ABST
    Figure CN121874402A_ABST
Patent Text Reader

Abstract

The invention discloses a primer and a probe for a fluorescent PCR method for identifying and detecting an African swine fever wild strain and a gene-deleted attenuated strain. The nucleotide sequence of the detection primer is as shown in SEQ ID NO.1-9. The detection kit provided by the invention can specifically detect the wild strain and the gene-deleted attenuated strain of the African swine fever virus, and has a remarkable application value for epidemiological monitoring of the African swine fever virus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of animal pathogen detection, specifically relating to primers and probes for a fluorescent PCR method for identifying and detecting wild-type and gene-deleted attenuated strains of African swine fever. Background Technology

[0002] African swine fever (ASF) is caused by the African swine fever virus (ASF), characterized by its extremely high transmissibility, pathogenicity, and mortality rate. Typical clinical manifestations include high fever and widespread hemorrhage; the mortality rate is very high, and the onset is extremely rapid. This virus is primarily transmitted among domestic and wild pigs via soft ticks and does not infect humans; therefore, it is not considered a zoonotic disease.

[0003] ASFV belongs to the genus *African swine fevervirus* within the family African swine feverviridae. ASFV is an icosahedral, enveloped, double-stranded DNA virus. Its natural hosts include wild boars and soft ticks, and monocytes / macrophages are the primary host cells for ASFV. The ASFV genome is large, ranging from 170kb to 190kb, and encodes over 180 open reading frames and more than 168 proteins. The differences between different genotypes can sometimes be very significant.

[0004] ASFV was first discovered in Kenya in 1921. Highly contagious, it spread across the African and European continents in just 36 years, being discovered in Portugal in 1957 and rapidly spreading throughout Europe. In my country, ASF was first discovered in Liaoning Province in August 2018, and its spread has been extremely rapid. The predominant strain is genotype II, which is characterized by high virulence, strong infectivity, and high mortality.

[0005] Currently, there are no officially approved commercial vaccines available for the prevention and control of African swine fever (ASF). Therefore, prevention and control measures primarily rely on efficient detection technologies and direct virus elimination methods. Real-time quantitative PCR (qPCR) technology, due to its high efficiency and accuracy, has become a commonly used method for detecting ASF. In the ASFV genome, the P49 gene is highly conserved, encoding the precursor of the capsid protein P72, which participates in viral assembly and plays an indispensable role in the integrity and stability of the viral particle structure. The 9GL (B119L) gene is an important virulence gene of ASFV; deletion of this gene leads to weakened viral virulence. MGF360-14L is one of the ASFV multigene family (MGF) and also an important virulence gene of ASFV, making it one of the key targets for deletion when constructing gene-deleted vaccines.

[0006] To rapidly and accurately distinguish between wild-type ASFV strains and potential vaccine strains (9GL and MGF360-14L gene deletion strains), this study designed specific primers and TaqMan probes with different fluorescent labels based on the conserved regions of the P49, 9GL, and MGF360-14L genes of ASFV. A triple TaqMan quantitative PCR method was established to achieve precise differentiation and diagnosis of wild-type ASFV strains and potential gene-deleted vaccine strains. Summary of the Invention

[0007] The first objective of this invention is to provide primers and probes for a fluorescent PCR method for simultaneously detecting wild-type and gene-deleted attenuated strains of African swine fever.

[0008] The second objective of this invention is to provide primers and probes for a fluorescent PCR method capable of distinguishing between wild-type African swine fever virus strains and gene-deleted attenuated strains.

[0009] To achieve the above objectives, the technical solution adopted by this invention is as follows: Primers and probes for a fluorescent PCR method to identify and detect wild-type and gene-deleted attenuated strains of African swine fever virus. Based on the conserved regions of the P49, 9GL, and MGF360-14L genes of African swine fever virus, primers and probes that can cover the vast majority of strains and are suitable for triple detection are designed and screened, including 3 pairs of specific primers and 3 specific probes, with amplified target fragment lengths of 190bp, 129bp, and 155bp, respectively. The sequences of the primers and probes are as follows: P49 gene: Upstream primer P49-F (SEQ ID No. 1): 5'- GCTATTAGCGGATTATAGGTC -3' Downstream primer P49-R (SEQ ID No. 2): 5'-GTTACGTAGATCACTGAGTTGC-3' Probe P49-P (SEQ ID NO.3): 5'- GATAATATACTAAATTCCCGGTAC -3' 9GL gene: Upstream primer 9GL-F (SEQ ID No. 4): 5'-GTTGCATTGGGGACCTAAATTC -3' Downstream primer 9GL-R (SEQ ID No. 5): 5'-CATGGCAGCGACTCGATAAAAC -3' Probe 9GL-P (SEQ ID No. 6): 5'-GCTATCTTTTTTTCAGACACTC -3' MGF 360-14L-F gene: Upstream primer MGF 360-14L-F (SEQ ID No. 7): 5'- GTTGTCTTTACAAACGTTGG -3' Downstream primer MGF 360-14L-R (SEQ ID No. 8): 5'-GTAAATGTTTTATACGAAAAAATTTG -3' Probe MGF 360-14L-P (SEQ ID No. 9): 5'- GATTATACGCTGCAGCGTTTTGG -3' The probes P49-P, 9GL, and MGF 360-14L-P are each labeled with a different fluorescent reporter group at the 5' end and a different fluorescent quencher group at the 3' end.

[0010] Furthermore, the fluorescent reporter group is FAM, ROX, and VIC, and the fluorescent quencher group is BHQ1, BHQ2, and BHQ3.

[0011] Furthermore, the probe P49-P is marked with FAM at the 5' end and BHQ1 at the 3' end; the probe 9GL-P is marked with ROX at the 5' end and BHQ2 at the 3' end; and the MGF 360-14L-P is marked with VIC at the 5' end and BHQ3 at the 3' end.

[0012] Furthermore, the premixed qPCR enzyme (2×) is Premix Ex Taq™ (Probe qPCR) (2×); furthermore, the positive control is an in vitro recombinant plasmid of the African swine fever gene synthesis fragment; and the negative control is sterile deionized water.

[0013] Primers and probes for a fluorescent PCR method to identify and detect wild-type and gene-deleted attenuated strains of African swine fever, comprising the following steps: Step 1: Extract DNA from the sample to be tested; Step 2: Using the DNA described in Step 1 as a template, perform triple fluorescent PCR amplification using the method in claim 4; Step 3: Analyze the PCR products and determine whether the sample to be tested contains African swine fever wild-type virus strains or gene-deficient attenuated strains based on the amplification reaction results.

[0014] Furthermore, in step two, primers and probes for a fluorescent PCR method for identifying and detecting African swine fever wild-type strains and gene-deleted attenuated strains are prepared in a total volume of 25 μL. The upstream and downstream primers and probes of P49, 9GL, and MGF360-14L are diluted to 10 μmol / L, with 0.5 μL of each of the three primer pairs and 0.3 μL of the probe.

[0015] Furthermore, in step two, the triple fluorescent PCR program is as follows: 95℃ for 30s; 95℃ for 5s, 60℃ for 30s, for a total of 45 cycles.

[0016] Table 1 shows the repeatability test results of the triple fluorescence quantitative PCR detection method in this invention.

[0017] Table 2 shows the results of the triple fluorescence quantitative PCR concordance rate test in this invention.

[0018] Table 1

[0019] Table 2

[0020] Excellent coverage and versatility: The primers and probes involved in this invention are designed to target the conserved genes and virulence genes of African swine fever virus, covering the sequences of the vast majority of strains of this virus in Genebank. Furthermore, the amplification conditions formed by the primers and probes of this invention are the same as those for several other important swine infectious diseases, allowing for simultaneous experiments with other diseases on the same platform. This high versatility facilitates the simultaneous diagnosis of multiple pathogens; this is the main innovation of this invention.

[0021] Multiplex and high throughput: This triple fluorescent PCR system enables rapid identification and detection of both wild-type African swine fever virus strains and gene-deleted vaccine strains in a single reaction, completing the detection within 70 minutes, saving both time and cost. It meets the requirements for large-scale testing, facilitating rapid diagnosis of diseases, especially mixed infections, and buying valuable time for disease prevention and control.

[0022] High sensitivity: The detection limit of this triple fluorescent PCR detection method can be as low as 10. 2 copies / μL.

[0023] High specificity: When designing specific primers and probes, the potential for interference between pathogens was fully considered. Experiments have shown that this triple fluorescent PCR does not react with the cDNA of other common and important infectious diseases in pigs, such as porcine circovirus type 2, porcine respiratory and reproductive syndrome virus, porcine seneca virus, porcine pseudorabies virus, porcine epidemic diarrhea virus, classical swine fever, and porcine parvovirus.

[0024] Good repeatability: within-group coefficient of variation ranges from 0.03% to 0.5%, and between-group coefficient of variation ranges from 0.04% to 1.2%. Attached Figure Description

[0025] Figure 1 This is a primer and probe design diagram for the triple fluorescence quantitative PCR detection method in this invention.

[0026] Figure 2 This is the specific amplification curve of the triple fluorescence quantitative PCR detection method in this invention.

[0027] Figure 3 This is the standard extension curve of the triple fluorescence quantitative PCR detection method in this invention.

[0028] Figure 4 This is the sensitivity amplification curve of the triple fluorescence quantitative PCR detection method in this invention. Detailed Implementation

[0029] The technical solution of the present invention will be further described below with reference to the accompanying drawings and examples, but it is not limited thereto. Any modifications or equivalent substitutions to the technical solution of the present invention that do not depart from the spirit and scope of the present invention should be covered within the protection scope of the present invention. Unless otherwise specified, the following embodiments are conventional methods, and the experimental materials used are conventional biochemical reagents unless otherwise specified. Example 1

[0030] Establishment of a real-time quantitative PCR detection method for detecting and identifying wild-type African swine fever virus strains and gene-deleted vaccine strains.

[0031] The first step is the design and synthesis of primers and probes for African swine fever wild-type strains and gene-deleted vaccine strains.

[0032] Based on NCBI sequence alignment analysis, primers and probes suitable for triple detection were designed and screened for conserved regions of the African swine fever virus (ASFV) P49, 9GL, and MGF360-14L genes. These primers and probes cover most strains and are suitable for triple detection. The results include three pairs of specific primers and three specific probes (see [link to relevant documentation]). Figure 1 The target fragment lengths amplified were 190bp, 129bp, and 155bp, respectively. The primer and probe sequences are as follows: P49 gene Upstream primer P49-F (SEQ ID No. 1): 5'- GCTATTAGCGGATTATAGGTC -3' Downstream primer P49-R (SEQ ID No. 2): 5'-GTTACGTAGATCACTGAGTTGC-3' Probe P49-P (SEQ ID NO.3): 5'- GATAATATACTAAATTCCCGGTAC -3' 9GL gene Upstream primer 9GL-F (SEQ ID No. 4): 5'-GTTGCATTGGGGACCTAAATTC -3' Downstream primer 9GL-R (SEQ ID No. 5): 5'-CATGGCAGCGACTCGATAAAAC -3' Probe 9GL-P (SEQ ID No. 6): 5'-GCTATCTTTTTTTCAGACACTC -3' MGF 360-14L-F gene Upstream primer MGF 360-14L-F (SEQ ID No. 7): 5'- GTTGTCTTTACAAACGTTGG -3' Downstream primer MGF 360-14L-R (SEQ ID No. 8): 5'-GTAAATGTTTTATACGAAAAAATTTG -3' Probe MGF 360-14L-P (SEQ ID No. 9): 5'- GATTATACGCTGCAGCGTTTTGG -3' The probe P49-P is marked with FAM at the 5' end and BHQ1 at the 3' end; the probe 9GL-P is marked with ROX at the 5' end and BHQ2 at the 3' end; the MGF 360-14L-P is marked with VIC at the 5' end and BHQ3 at the 3' end.

[0033] The second step is the preparation of positive controls for the African swine fever virus P49, 9GL, and MGF360-14L genes: The P49, 9GL, and MGF360-14L gene sequences of African swine fever virus were compared on the NCBI website. A conserved sequence containing the aforementioned primers was selected and sent to Sangon Biotech (Shanghai) Co., Ltd. for synthesis. The synthesized fragment was ligated with a cloning vector and transformed into DH5α Escherichia coli. Positive clone colonies were picked, and positive clone plasmids were extracted. The copy number was calculated using a formula to obtain a positive control with a known copy number concentration.

[0034] The third step is to optimize the triple fluorescent PCR reaction system and amplification conditions. The primer and probe concentrations determined in the first step were diluted to 10 μmol / L with sterile water, and the addition amounts of 0.1 μL, 0.3 μL, 0.5 μL, 0.7 μL, and 1.0 μL were screened.

[0035] Using Premix Ex Taq™ (Probe qPCR) reagents and recommended reaction amplification conditions, a fluorescence PCR matrix method screening experiment was conducted on a Tianlong Gentier 96R PCR instrument to screen primers and labeled probes with different addition amounts. Based on the comprehensive criteria of obtaining the minimum Ct value, a high relative fluorescence intensity (RFU) value, and a typical S-shaped amplification curve, the optimal upstream and downstream primer addition amounts for triple fluorescence quantitative PCR were ultimately determined to be 0.5 μL, and the optimal probe addition amount was 0.3 μL.

[0036] Under the conditions of optimal primer and probe addition and universal fluorescent PCR amplification reagent, screening experiments were conducted within the range of 52℃-64℃ for annealing extension temperature, and the final annealing extension temperature was determined to be 60℃.

[0037] In the optimized 25 μL PCR reaction system, the upstream and downstream primers and probes for triple quantitative PCR were all diluted to 10 μmol / L. The final addition volume of the upstream and downstream primers was 0.5 μL, and the final addition volume of the probe was 0.3 μL. The optimized PCR amplification conditions were: 95℃ for 30 s; 95℃ for 5 s, 60℃ for 30 s, for a total of 40 cycles.

[0038] Result determination Quality control standards: The positive control showed a specific S-shaped amplification curve with a Ct value of around 20-25; the negative control showed no amplification curve and no Ct value.

[0039] If this condition is met, the test result is considered valid.

[0040] Result determination: If the sample to be tested shows specific amplification curves in the FAM, ROX, and VIC channels, and the Ct value is ≤35, then the sample to be tested is determined to contain the nucleic acid of the wild-type African swine fever virus.

[0041] If a specific amplification curve appears in the FAM channel of the sample to be tested, and no amplification curve appears in one or both of the other two channels, and the Ct value is >40, then it is determined that the sample to be tested contains only the nucleic acid of the African swine fever gene deletion vaccine strain.

[0042] If no specific amplification curve is observed in the FAM, ROX, and VIC channels of the sample to be tested, and the Ct value is >40 or there is no Ct value, then the sample to be tested is determined to contain African swine fever virus.

[0043] If a curve appears after testing a positive sample but 35 < Ct value ≤ 40, the test needs to be repeated. If the repeated result is positive, the sample is considered positive; otherwise, it is considered negative.

[0044] The fourth step is a triple quantitative PCR specificity assay: Using the optimal reaction system and expansion conditions determined in step three, nucleic acids of porcine circovirus type 2, porcine respiratory and reproductive syndrome virus, porcine seneka virus, porcine pseudorabies virus, porcine epidemic diarrhea virus, classical swine fever virus, and porcine parvovirus were detected. The results showed that no specific amplification curves were observed for any of them. Experimental results are shown below. Figure 2 .

[0045] The fifth step is to establish the sensitivity and standard curve for triple PCR: Porcine circovirus type 2 ORF1 gene positive control was serially diluted 10-fold, and fluorescent PCR amplification was performed using the optimal reaction system and amplification conditions determined in step 3. The kinetic curve of fluorescent PCR amplification was obtained. Standard curves were plotted based on the amplification curves. The regression linear equation for the P49 standard curve was: Y = -3.1197X + 39.456, with a correlation coefficient (R²) of 0.9958; the regression linear equation for the 9GL standard curve was: Y = -3.4697X + 41.276; and the regression linear equation for the MGF360-14L standard curve was: Y = -3.4197X + 38.4996. (See...) Figure 3 .

[0046] Three positive controls for African swine fever virus genes were serially diluted 10-fold, and fluorescent PCR amplification was performed using the optimal reaction system and amplification conditions determined in step three. The kinetic curves of the fluorescent PCR amplification are shown in [reference needed]. Figure 4 .

[0047] The African swine fever virus gene plasmid standard was serially diluted, and experiments were conducted using plasmids at concentration levels of 10⁷, 10⁶, and 10⁵ copies / µL. The coefficient of variation was calculated. The results showed that this experimental method exhibited extremely low variability within the same sample group, with an average coefficient of variation ranging from 0.03% to 0.5%. The coefficient of variation between different sample groups ranged from 0.04% to 1.2%, demonstrating that this method has good reproducibility (see Table 1). Example 2

[0048] Conformity test of the fluorescence quantitative PCR detection method used to detect and identify African swine fever wild-type strains and gene-deleted vaccine strains.

[0049] Based on this invention, a triple fluorescent PCR method for identifying wild-type African swine fever virus (ASFV) strains and gene-deleted vaccine strains was established. Three commercially available ASFV detection kits were then used to test collected environmental samples from pig farms. These kits were from Mingri Technology, Yirui Biotechnology, and Bori Technology. In the 125 environmental samples tested, the method established in this study yielded consistent results with the three commercial ASFV kits, achieving a 100% concordance rate. This demonstrates that the kits can accurately detect wild-type ASFV strains (see Table 2).

[0050] The above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is impossible to exhaustively list all the implementation methods here. All obvious variations or modifications derived from the technical solutions of the present invention are still within the protection scope of the present invention.

Claims

1. A primer and probe for differentiating detection of African swine fever wild strain and gene deletion attenuated strain fluorescence PCR method, characterized in that: Primers and probes suitable for triple quantitative PCR were designed and screened to target the conserved structural gene P49, the important virulence gene 9GL, and MGF360-14L in wild-type African swine fever virus strains. These primers and probes cover most strains and are suitable for triple quantitative PCR. The primers and probes amplify target fragments of 190 bp, 129 bp, and 155 bp, respectively. The sequences of the primers and probes are as follows: P49 gene: Upstream primer P49-F (SEQ ID No. 1): 5'- GCTATTAGCGGATTATAGGTC -3' Downstream primer P49-R (SEQ ID No. 2): 5'-GTTACGTAGATCACTGAGTTGC-3' Probe P49-P (SEQ ID NO.3): 5'- GATAATATACTAAATTCCCGGTAC -3' 9GL gene: Upstream primer 9GL-F (SEQ ID No. 4): 5'-GTTGCATTGGGGACCTAAATTC -3' Downstream primer 9GL-R (SEQ ID No. 5): 5'-CATGGCAGCGACTCGATAAAAC -3' Probe 9GL-P (SEQ ID No. 6): 5'-GCTATCTTTTTTTCAGACACTC -3' MGF 360-14L-F gene: Upstream primer MGF 360-14L-F (SEQ ID No. 7): 5'- GTTGTCTTTACAAACGTTGG -3' Downstream primer MGF 360-14L-R (SEQ ID No. 8): 5'-GTAAATGTTTTATACGAAAAAATTTG -3' Probe MGF 360-14L-P (SEQ ID No. 9): 5'- GATTATACGCTGCAGCGTTTTGG -3'; The probes P49-P, 9GL, and MGF 360-14L-P are each labeled with a different fluorescent reporter group at the 5' end and a different fluorescent quencher group at the 3' end.

2. The primers and probes for a fluorescent PCR method for identifying and detecting African swine fever wild-type strains and gene-deleted attenuated strains according to claim 1, characterized in that: The fluorescent reporter groups are FAM, ROX, and VIC, and the fluorescent quencher groups are BHQ1, BHQ2, and BHQ3.

3. The primers and probes for a fluorescent PCR method for identifying and detecting wild-type and gene-deleted attenuated strains of African swine fever according to claim 1 or 2, characterized in that: The probe P49-P is marked with FAM at the 5' end and BHQ1 at the 3' end; the probe 9GL-P is marked with ROX at the 5' end and BHQ2 at the 3' end; the MGF 360-14L-P is marked with VIC at the 5' end and BHQ3 at the 3' end.

4. Primers and probes for a fluorescent PCR method to identify and detect wild-type and gene-deleted attenuated strains of African swine fever, characterized in that: It includes the three pairs of specific primers and three specific probes as described in claim 1, 2 or 3.

5. The primers and probes for a fluorescent PCR method for identifying and detecting wild-type and gene-deleted attenuated strains of African swine fever according to claim 4, characterized in that: The kit also includes enzymes, a positive control, and a negative control.

6. The primers and probes for a fluorescent PCR method for identifying and detecting African swine fever wild-type strains and gene-deleted attenuated strains according to claim 5, characterized in that: The enzyme is Premix Ex Taq™ (Probe qPCR) (2×); the positive control is an in vitro recombinant plasmid of the African swine fever gene synthesis fragment; the negative control is sterile deionized water.

7. Primers and probes for a fluorescent PCR method to identify and detect wild-type and gene-deleted attenuated strains of African swine fever, characterized in that, Includes the following steps: Step 1: Extract DNA from the sample to be tested; Step 2: Analyze the PCR amplification products and determine whether the sample contains wild-type African swine fever virus based on the amplification reaction results.

8. The primers and probes for a fluorescent PCR method for identifying and detecting African swine fever wild-type strains and gene-deleted attenuated strains according to claim 7, characterized in that: In step two, the three pairs of primers for amplifying African swine fever virus were all 0.5 μL (concentration of 10 μmol / L), and the probes were all 0.3 μL (concentration of 10 μmol / L).

9. The method for dual fluorescent PCR detection of porcine circovirus type 2 and porcine circovirus type 3 according to claim 7, characterized in that: In step two, the reaction program for dual fluorescent PCR amplification is as follows: pre-denaturation at 95℃ for 5 min; followed by 40 cycles, including 95℃ for 15 s, 60℃ for 15 s, and 72℃ for 20 s.