Multifunctional nanoprobe for lung cancer drug resistance diagnosis and treatment as well as preparation method and application of multifunctional nanoprobe

Abstract

The invention discloses a multifunctional nanoprobe for lung cancer drug resistance diagnosis and treatment and a preparation method and application thereof, and relates to the technical field of DNA nanoprobes, the multifunctional nanoprobe comprises a Y-shaped structure formed by self-assembly of three nucleic acid chains S1, S2 and S3 and PTX, the Y-shaped structure and PTX are self-assembled to form a spherical structure, and the particle size of the spherical structure is 80-120nm; the S1 nucleic acid chain is loaded with an anti-ABCB1 sequence, is modified with a Cy5 fluorophore and is subjected to fluoro modification treatment; the S2 nucleic acid chain is loaded with an S6 sequence of a targeted A549 cell membrane surface specific structure; and the S3 nucleic acid chain is loaded with an anti-beta III-tubulin sequence. By integrating multiple functions of targeting recognition, gene silencing and chemotherapy drug delivery, diagnosis and treatment integration of the paclitaxel drug-resistant lung cancer is realized.

Description

Technical Field

[0001] This invention relates to the field of DNA nanoprobe technology, specifically to a multifunctional nanoprobe for the diagnosis and treatment of drug-resistant lung cancer, its preparation method, and its application. Background Technology

[0002] Lung cancer is one of the leading causes of cancer-related morbidity and mortality worldwide, with non-small cell lung cancer (NSCLC) accounting for a major proportion. Paclitaxel (PTX) is a first-line chemotherapy drug for NSCLC, but its efficacy is often significantly limited by multidrug resistance (MDR) in tumor cells. In paclitaxel-resistant cell lines (such as A549 / TAX), MDR is mainly mediated by two key mechanisms: firstly, overexpression of the P-glycoprotein (P-gp) encoded by the ABCB1 gene, which acts as a drug efflux pump, actively expelling intracellular paclitaxel and reducing its effective concentration; secondly, abnormally high expression of βIII-tubulin, which stabilizes microtubule dynamics by altering the isotype composition of cellular microtubules, thereby weakening the binding ability of paclitaxel to microtubules and leading to chemotherapy failure.

[0003] Currently, treatment strategies for lung cancer drug resistance, such as small molecule P-gp inhibitors or single-gene silencing technologies (such as siRNA / antisense oligonucleotides targeting ABCB1 or βIII-tubulin), often have the following limitations: 1. Insufficient Functional Specificity and Synergy: Traditional nanoprobes typically focus on only a single function, such as simply delivering chemotherapy drugs or silencing a single drug resistance gene. This "lone wolf" strategy is insufficient to simultaneously reverse complex drug resistance phenotypes mediated by multiple molecular pathways, resulting in limited therapeutic efficacy. Physically mixing and co-delivering therapeutic components with different functions (such as chemotherapy drugs and different gene-specific drugs) presents challenges such as poor compatibility between components, asynchronous in vivo distribution, and decreased targeting efficiency due to steric hindrance.

[0004] 2. Disconnect between diagnosis and treatment: Existing integrated diagnostic probes often employ "always-on" fluorescent dyes (such as Cy3) for imaging. These dyes continuously emit fluorescence before reaching the target, resulting in high background signal and low signal-to-noise ratio. This makes it impossible to accurately and in real-time reflect the dynamic processes of probe distribution, disassembly, and drug release within target cells. Consequently, it is difficult to establish a precise correlation between imaging information and actual treatment effects, hindering true efficacy monitoring and prediction.

[0005] 3. Complex preparation process and difficulty in individualized adaptation: The construction of multifunctional nanoplatforms usually requires a multi-step and complex chemical modification and assembly process, which not only leads to low yield and large batch-to-batch differences, but also makes it difficult to flexibly adjust the proportion of different therapeutic components according to the differences in drug resistance gene expression profiles among individual patients, thus limiting its application in precision medicine.

[0006] Therefore, there is an urgent need in this field to develop a novel multifunctional nanoprobe that can simultaneously achieve precise targeted delivery, silencing of multiple drug resistance genes, chemotherapy sensitization, and precise activation imaging on a highly integrated and structurally controllable platform. This would fundamentally overcome the shortcomings of existing technologies and provide an efficient and visualized integrated diagnostic and therapeutic solution for reversing drug resistance in lung cancer. Summary of the Invention

[0007] To address the aforementioned technical shortcomings, this invention proposes a multifunctional nanoprobe for the diagnosis and treatment of drug-resistant lung cancer. The aim is to integrate multiple functions—targeted recognition, gene silencing, and chemotherapy drug delivery—through a highly integrated and structurally controllable nanoplatform. This allows for the simultaneous realization of tumor-targeted delivery, silencing of multiple drug-resistant genes, chemotherapy sensitization, and precise activation imaging, ultimately achieving integrated diagnosis and treatment of paclitaxel-resistant lung cancer. This addresses the problems of existing technologies, such as insufficient functional diversity and synergy, disconnect between diagnosis and treatment processes, complex manufacturing processes, and difficulties in individualized adaptation.

[0008] The technical solution adopted in this invention is as follows: In a first aspect, the present invention provides a multifunctional nanoprobe for the diagnosis and treatment of drug resistance in lung cancer. The multifunctional nanoprobe comprises a Y-shaped structure formed by the self-assembly of three nucleic acid chains S1, S2, and S3, and a PTX. The Y-shaped structure and the PTX self-assemble to form a spherical structure with a particle size of 80-120 nm. The S1 nucleic acid chain is loaded with an anti-ABCB1 sequence for recognizing and downregulating the drug resistance gene ABCB1, and is modified with a Cy5 fluorescent group and fluorinated. The sequence of the S1 nucleic acid chain is shown in SEQ ID NO:1. The S2 nucleic acid chain is loaded with an S6 sequence targeting a specific structure on the surface of the A549 cell membrane. The sequence of the S2 nucleic acid chain is shown in SEQ ID NO:2. The S3 nucleic acid chain is loaded with an anti-βIII-tubulin sequence for downregulating the expression of βIII-tubulin. The sequence of the S3 nucleic acid chain is shown in SEQ ID NO:3.

[0009] SEQ ID NO:1 AGTTCTGCGC AGCGACGATC CCCTGTAATA GATGCGAGGG TCCA (wherein, the anti-ABCB1 sequence is: AGTTCTGCGC AGCGACGATC CC) SEQ ID NO:2 GGGATCGTCG CAGAGTTGAC CCTTTTTTGT GGCCAGTCAC TCAATTGGGTGTAGGGGTGG GGATTGTGGG TTG (where the S6 sequence is GGGATCGTCG CAGAGTTGAC CCT) SEQ ID NO:3 GGGTCAACTC TTGCGCAGAA CTACCTCCCT CCGCGGAGCA GCC (wherein, the anti-βIII-tubulin sequence is GGGTCAACTC TTGCGCAGAA CT).

[0010] Secondly, this invention discloses a method for preparing the multifunctional nanoprobe described in the first aspect, comprising the following steps: (1) Dissolve the three nucleic acid chains S1, S2 and S3 in RNase-free water to obtain three nucleic acid solutions; (2) Mix the above three nucleic acid solutions with PTX solution in a solution containing Mg 2+ In the buffer solution; (3) Heat the mixture to 90~100℃ and maintain for 25~35min, then let it cool naturally to room temperature to form a stable nanoscale spherical structure; (4) Centrifuge, discard the supernatant, collect the precipitate, and obtain the multifunctional nanoprobe.

[0011] More preferably, the concentration of the three nucleic acid solutions prepared in step (1) is 100 μM.

[0012] More preferably, in the mixed system obtained in step (2), the final concentration of the nucleic acid chain is 5.0 μM and the final concentration of PTX is 0.2 mM.

[0013] Preferably, the final concentration ratio of the nucleic acid chain to the final concentration of PTX is 1:40.

[0014] Preferably, the molar ratio of the three nucleic acid chains S1, S2, and S3 is 1:1:1.

[0015] More preferably, the Mg-containing 2+ In the buffer solution, Mg 2+ The concentration was 4.2 mM, and the pH of the buffer solution was 7.0~7.5.

[0016] Thirdly, this invention discloses the application of the multifunctional nanoprobe described in the first aspect in the preparation of integrated reagents or drugs for the diagnosis and treatment of lung cancer drug resistance.

[0017] Compared with the prior art, the present invention has achieved the following beneficial effects: 1. This invention delivers anti-ABCB1 and anti-βIII-tubulin double antisense oligonucleotides through a DNA nanoplatform, achieving dual gene silencing, increasing intracellular PTX concentration, and significantly reversing drug resistance.

[0018] 2. This invention utilizes the integrated design of Y-DNA self-assembly "groove insertion + base pairing" to deliver PTX, anti-ABCB1, and anti-βIII-tubulin synchronously in precise doses using the same vector, and release them synchronously under the triggering of nucleases in tumor cells, achieving spatiotemporal consistency of "imaging-gene silencing-chemotherapy".

[0019] 3. This invention introduces a “Cy5 self-quenching-target dissociation-fluorescence recovery” mechanism into the Y-DNA backbone, making the fluorescence signal intensity at the tumor site linearly correlated with the silencing efficiency of ABCB1 / βIII-tubulin, thus achieving simultaneous diagnosis and treatment with “one injection, real-time imaging, and efficacy prediction”, filling the visualization gap in drug-resistant lung cancer models.

[0020] 4. This invention adopts a modular Y-DNA design. By simply changing the length or ratio of the antisense region sequence of the S1 / S3 strand, the drug loading of anti-ABCB1 and anti-βIII-tubulin can be continuously adjusted within the range of 0 to 100%. According to the UV spectrophotometer detection experiment, the optimal ratio of DNA:PTX is determined to be 1:40, providing a general technical platform for clinical personalized precision medicine. Attached Figure Description

[0021] Figure 1 This is a schematic diagram of the S1 nucleic acid chain.

[0022] Figure 2 This is a schematic diagram of the S2 nucleic acid chain.

[0023] Figure 3 This is a schematic diagram of the S3 nucleic acid chain.

[0024] Figure 4 This is a schematic diagram of a Y-shaped structure formed by the self-assembly of three nucleic acid chains, S1, S2, and S3. Figure 5 This is a schematic diagram of the structure of a multifunctional nanoprobe; Figures 1-5 The labels in the text are as follows: 1. anti-ABCB1 sequence, 2. F-DNA, 3. cy5 fluorescent group, 4. F atom, 5. S1 chain, 6. S6 sequence, 7. S2 chain, 8. anti-βIII-tubulin sequence, 9. S3 chain, 10. Y-shaped structure, 11. PTX, 12. spherical structure. Figure 6Transmission electron microscopy image of the Y-DNA / PTX nanoprobe (TEM, ×30,000, scale bar = 500 nm); Figure 7 High-magnification transmission electron microscopy image of the Y-DNA / PTX nanoprobe (TEM, ×150,000, scale bar = 100 nm). Figure 8 Figure 1 shows the results of flow cytometry experiments incubating A549 / TAX cells with different probes for 15 min. Figure 9 Figure 1. Flow cytometry results of different probes incubated with A549 / TAX cells for 30 minutes. Figure 10 Figure 1. Flow cytometry results of A549 / TAX cells incubated with the same probe for 45 min. Detailed Implementation

[0025] The present invention will be described in detail below with reference to specific embodiments and examples, thereby making the advantages and various effects of the present invention more clearly apparent. Those skilled in the art should understand that these specific embodiments and examples are for illustrative purposes only and are not intended to limit the present invention.

[0026] Throughout this specification, unless otherwise specified, the terminology used herein should be understood to have the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the event of any conflict, this specification shall prevail.

[0027] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0028] like Figures 1-5The diagram shows the structure of the multifunctional nanoprobe provided by the present invention. The multifunctional nanoprobe includes a Y-shaped structure 10 and a PTX 11 formed by the self-assembly of three nucleic acid chains: S1 chain 5, S2 chain 7, and S3 chain 9. The Y-shaped structure 10 and PTX 11 self-assemble to form a spherical structure 12 with a particle size of 80-120 nm. The S1 chain 5 is loaded with an anti-ABCB1 sequence 1 for recognizing and downregulating the drug resistance gene ABCB1, and is modified with a Cy5 fluorescent group 3 and fluorinated to form F-DNA 2. The F-DNA 2 has an F atom 4. The sequence of the S1 chain 5 is shown in SEQ ID NO:1. The S2 chain 7 is loaded with an S6 sequence 6 targeting a specific structure on the surface of the A549 cell membrane. The sequence of the S2 chain 7 is shown in SEQ ID NO:2. The S3 chain 9 is loaded with an anti-βIII-tubulin sequence 8 for downregulating the expression of βIII-tubulin. The sequence of the S3 chain 9 is shown in SEQ ID NO:3.

[0029] The present invention will be further illustrated below with reference to specific embodiments.

[0030] Example 1 This embodiment examines the feasibility of self-assembly of electrophoretic sequences and investigates the assembly efficiency of multifunctional nanoprobes. The nucleic acid sequences of the relevant DNA or RNA fragments in the nanoprobes are shown in Table 1. The relevant DNA or RNA fragments were prepared by Shanghai Sangon Biotech Co., Ltd.

[0031] Table 1. Nucleic acid sequences of relevant DNA or RNA fragments ; The assembly process is as follows: After centrifugation to precipitate S1, S2, and S3 chains, dissolve them in RNase-free water to a concentration of 100 μM, and then use Tri-Mg²⁺ buffer (5 mM, pH 7.4, sterilized at 0.22 μm). Probe assembly: Take Tri-Mg... 2+ Add 84 μL of buffer solution, 5 μL each of S1, S2, and S3 chains (100 μM), and 1 μL of PTX solution (20 mM), for a total volume of 100 μL. Anneal at 95°C for 30 min, then allow to cool naturally to room temperature. Centrifuge at 12000 rpm for 10 min, discard the supernatant, and collect the precipitate, which is the Y-DNA / PTX nanoprobe. Observe the probe morphology using transmission electron microscopy (TEM). Figure 6As shown in Figure 7, the probe exhibits a spherical or near-spherical nanostructure, with a particle size estimated to be approximately 80–120 nm using dynamic light scattering (DLS). Further optimization of the ratios of S1, S2, and S3, and the molar ratio of Y-DNA to PTX, revealed that the probe structure was most stable when the ratio of the three strands was maintained at 1:1:1, and the PTX loading efficiency was highest when the ratio of Y-DNA to PTX was 1:40.

[0032] Example 2 This embodiment investigated the responsiveness of the multifunctional nanoprobe to its targets using fluorescence response experiments. First, the recovery of Cy5 fluorescence signal was examined before and after the probe bound to target mRNAs (ABCB1 and βIII-tubulin). Second, its binding ability in A549 / TAX cells was compared with that of random sequences (Y-radDNA / PTX) or probes without the S6 sequence. Finally, the mRNA and protein levels of ABCB1 and βIII-tubulin under gene silencing were detected by RT-qPCR and Western Blot.

[0033] Results: The results are as follows Figures 8-10 As shown, flow cytometry revealed that after incubation of A549 / TAX cells with the Y-DNA / PTX probe, the Cy5 fluorescence intensity was approximately 3.5 times stronger than that of the random sequence control at 30 min. CLSM assays showed that the Cy5 signal increased over time after the probe entered the cells, with the optimal imaging time being approximately 3 h. RT-qPCR results showed that the levels of ABCB1 and βIII-tubulin mRNA decreased by 65% ​​and 60%, respectively. Western blotting showed that the expression of the corresponding proteins was simultaneously and significantly downregulated, verifying that the probe has good targeting and gene silencing effects.

[0034] Example 3 This embodiment further investigates the imaging and anti-tumor effects of multifunctional nanoprobes on cancer cells.

[0035] Cell imaging: A549 / TAX cells were incubated with Y-DNA / PTX probes, and intracellular fluorescence distribution was observed by CLSM at the optimal imaging time point (3 h).

[0036] Specific imaging: anti-ABCB1 and anti-βIII-tubulin were transfected into A549 / TAX cells, either separately or together, and the changes in probe imaging signals before and after transfection were compared.

[0037] Cytotoxicity assay: A549 / TAX cells were divided into 8 groups (PBS, single PTX, single anti-ABCB1, single anti-βIII-tubulin, PTX+anti-ABCB1, PTX+anti-βIII-tubulin, anti-ABCB1+anti-βIII-tubulin, PTX+anti-ABCB1+anti-βIII-tubulin), and cell viability was detected by MTS method after 24 h of treatment.

[0038] Results: Imaging results showed that the probe could significantly enter A549 / TAX cells, and the fluorescence was mainly distributed in the cytoplasm. After transfection with the antisense sequence, the probe signal was significantly weakened, confirming its specific recognition. Cytotoxicity experiment: The survival rate of A549 / TAX cells in the PTX-only group was about 70%. The survival rate of the PTX+anti-ABCB1 group and the PTX+anti-βIII-tubulin group decreased. The survival rate of the PTX+anti-ABCB1+anti-βIII-tubulin probe group further decreased (p<0.01), which was significantly better than each single treatment group.

[0039] Finally, it should be noted that the terms "comprising," "including," or any other variations are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make further changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0040] The embodiments described above merely illustrate specific implementation methods of this application, and while the descriptions are detailed, they should not be construed as limiting the scope of protection of this application. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the technical solution of this application, and these modifications and improvements all fall within the scope of protection of this application.

Claims

1. A multifunctional nanoprobe for the diagnosis and treatment of drug-resistant lung cancer, characterized in that, The multifunctional nanoprobe comprises a Y-shaped structure formed by the self-assembly of three nucleic acid chains S1, S2, and S3, and a PTX. The Y-shaped structure and PTX self-assemble to form a spherical structure with a particle size of 80-120 nm. The S1 nucleic acid chain is loaded with an anti-ABCB1 sequence for recognizing and downregulating the drug resistance gene ABCB1, and is modified with a Cy5 fluorescent group and fluorinated. The sequence of the S1 nucleic acid chain is shown in SEQ ID NO:

1. The S2 nucleic acid chain is loaded with an S6 sequence targeting a specific structure on the surface of the A549 cell membrane. The sequence of the S2 nucleic acid chain is shown in SEQ ID NO:

2. The S3 nucleic acid chain is loaded with an anti-βIII-tubulin sequence for downregulating βIII-tubulin expression. The sequence of the S3 nucleic acid chain is shown in SEQ ID NO:

3.

2. The method for preparing the multifunctional nanoprobe as described in claim 1, characterized in that, Includes the following steps: (1) Dissolve the three nucleic acid chains S1, S2 and S3 in RNase-free water to obtain three nucleic acid solutions; (2) Mix the above three nucleic acid solutions with PTX solution in a solution containing Mg 2+ In the buffer solution; (3) Heat the mixture to 90~100℃ and maintain for 25~35min, then let it cool naturally to room temperature to form a stable nanoscale spherical structure; (4) Centrifuge, discard the supernatant, collect the precipitate, and obtain the multifunctional nanoprobe.

3. The preparation method according to claim 2, characterized in that, The concentration of the three nucleic acid solutions obtained in step (1) is 100 μM.

4. The preparation method according to claim 2, characterized in that, In the mixed system obtained in step (2), the final concentration of nucleic acid chain is 5.0 μM and the final concentration of PTX is 0.2 mM.

5. The preparation method according to claim 2, characterized in that, The final concentration ratio of the nucleic acid chain to the final concentration of PTX is 1:

40.

6. The preparation method according to claim 2, characterized in that, The molar ratio of the three nucleic acid chains S1, S2, and S3 is 1:1:

1.

7. The preparation method according to claim 2, characterized in that, The Mg-containing 2+ In the buffer solution, Mg 2+ The concentration was 4.2 mM, and the pH of the buffer solution was 7.0~7.

5.

8. The application of the multifunctional nanoprobe as described in claim 1 in the preparation of integrated reagents or drugs for the diagnosis and treatment of lung cancer drug resistance.

Images