Application of ZNF710 gene in preparation of preparation for hepatocellular carcinoma diagnosis and / or prognosis evaluation

Abstract

The invention relates to the technical field of biological medicines, in particular to application of a ZNF710 gene in preparation of a preparation for hepatocellular carcinoma diagnosis and / or prognosis evaluation. The invention finds and verifies that ZNF710 is closely related to prognosis of liver cancer for the first time and is a key gene for occurrence and development of tumors, and patients with low expression of the ZNF710 gene have higher survival rate. Therefore, compared with the prior art, a novel liver cancer diagnosis and treatment scheme taking the ZNF710 gene as the molecular marker has relatively high clinical application value and potential.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to... ZNF710 Application of genes in the preparation of formulations for the diagnosis and / or prognostic assessment of hepatocellular carcinoma. Background Technology

[0002] Primary liver cancer mainly includes three different pathological types: hepatocellular carcinoma (HCC), intrahepatic cholangiocarcinoma (ICC), and combined hepatocellular-cholangiocarcinoma (cHCC-CCA). These three types differ significantly in their pathogenesis, biological behavior, pathological histology, treatment methods, and prognosis. HCC accounts for 75%–85% of cases, while ICC accounts for 10%–15%. Low early diagnosis rates are a major reason for the poor prognosis of liver cancer patients in my country. Improving early diagnosis rates and enabling more liver cancer patients to undergo radical resection is key to improving treatment efficacy and 5-year survival rates. Exploring clinically feasible and easily implemented early screening and diagnosis methods is currently an urgent task.

[0003] Serum AFP is a commonly used indicator for diagnosing liver cancer and monitoring treatment efficacy. A serum AFP level ≥400 μg / L, after excluding pregnancy, chronic or active liver disease, germ cell tumors of the gonads, and gastrointestinal tumors, is highly suggestive of liver cancer. Mildly elevated serum AFP levels should be combined with imaging examinations or dynamic observation, and compared with changes in liver function to aid in diagnosis. However, a major problem with using AFP for tumor screening is the low positive rate in the early stages. In particular, approximately 30% of liver cancer patients in my country are AFP-negative, and using AFP alone may miss these patients. Currently, relevant liver cancer guidelines in countries such as the United States no longer recommend AFP as a screening indicator for hepatocellular carcinoma. Therefore, developing new diagnostic biomarkers and therapeutic targets for liver cancer is of great significance for early screening and diagnosis research. Summary of the Invention

[0004] The purpose of this invention is to provide ZNF710 The application of genes in the preparation of formulations for the diagnosis and / or prognostic assessment of hepatocellular carcinoma provides molecular markers for the effective clinical diagnosis of liver cancer, provides molecular targets for the clinical search of effective drugs and strategies for the treatment of liver cancer, and thus improves the overall prognosis of liver cancer.

[0005] A first aspect of the present invention provides ZNF710Application of the gene in the preparation of formulations for the diagnosis and / or prognostic assessment of hepatocellular carcinoma, ZNF710 zinc finger protein 710, Homo sapiens (human), Gene ID: 374655.

[0006] ZNF710, as an important member of the zinc finger protein family, contains a characteristic zinc finger domain in its structure, which mediates specific binding to DNA, RNA, or various proteins. In current life science research, the zinc finger protein family has been widely recognized as a protein family playing a central role in transcriptional regulation, epigenetic modification, and cell signal transduction. They deeply participate in and regulate a series of crucial life activities, such as cell differentiation, proliferation, apoptosis, stress response, and cell cycle progression, by precisely regulating gene expression networks. However, compared to some members of the family that have been extensively studied, research on ZNF710 in the field of liver cancer remains largely unexplored. This invention is the first to... ZNF710 Placed within the scope of liver cancer research. Clarify ZNF710 The expression and function of this substance in liver cancer can not only fill knowledge gaps in this field and deepen our understanding of the molecular mechanisms of liver cancer pathogenesis, but also provide a new and powerful molecular tool and theoretical basis for the early diagnosis, prognostic assessment and development of targeted therapy strategies for liver cancer.

[0007] A second aspect of the present invention provides a liver cancer diagnostic and / or prognostic agent comprising quantitative detection. ZNF710 Reagents for gene expression levels.

[0008] Furthermore, the quantitative detection ZNF710 Reagents for gene expression quantification include those suitable for at least one of the following methods: fluorescent dye method, digital PCR, resonance light scattering method, real-time quantitative PCR, sequencing, or biomolecular mass spectrometry.

[0009] Furthermore, the PCR detection mentioned above ZNF710 The gene expression quantification reagent contains the following primer sequences:

[0010] ZNF710 F: 5'-AGTGTGACAAGTCCTTCCACTACC-3';

[0011] ZNF710 R: 5'-GGTGGTGAATCTGGCTGAACTC-3'.

[0012] A third aspect of the present invention provides an inhibition ZNF710 Application of gene expression reagents in the preparation of agents for treating liver cancer.

[0013] Furthermore, the reagent for inhibiting ZNF710 gene expression includes shRNA.

[0014] The shRNA sequence is as follows:

[0015] shZNF710-#1: GAAGTCCTTCAACCGCATGTA

[0016] or:

[0017] shZNF710-#2: CACGAAGTGAAGCATGAGAGT

[0018] The present invention also provides an agent for treating liver cancer, comprising inhibiting... ZNF710 Reagents for gene or protein expression.

[0019] Furthermore, the aforementioned inhibition ZNF710 Reagents for gene expression include shRNA.

[0020] This invention uses molecular markers ZNF710 Tumor subtype classification, drug screening, and treatment strategies targeting (zinc finger protein 710) are clearly defined. ZNF710 It is a target molecule for improving the overall prognosis of liver cancer and effectively treating the disease; ZNF710 Intervening in the expression of genes as the core target is a feasible approach for the effective treatment of liver cancer.

[0021] Compared with existing technologies, the advantages of this invention are:

[0022] This invention is the first to be discovered and verified. ZNF710 It is closely related to the prognosis of liver cancer and is a key gene in tumor development and progression, with low expression. ZNF710 Patients with genetic predispositions have a higher survival rate. Therefore, compared to existing technologies, [the following is likely a separate, unrelated sentence:] ZNF710 A new approach to the diagnosis and treatment of liver cancer using genes as molecular markers has significant clinical application value and potential. Attached Figure Description

[0023] Figure 1 For TCGA LIHC database ZNF710 Graph showing the differential expression results in liver cancer patients;

[0024] Figure 2 For liver cancer patients ZNF710 Progression-free survival (PFS) of patients with high and low expression;

[0025] Figure 3 For TCGA LIHC database ZNF710Diagnostic ROC curve (Receiver Operating Characteristic Curve);

[0026] Figure 4 The protein expression level of ZNF710 in clinical liver cancer tissues and normal tissues;

[0027] Figure 5 The graph shows the protein expression levels of ZNF710 in six hepatocellular carcinoma cell lines.

[0028] Figure 6 Figure showing the comparison of cell proliferation and migration ability after ZNF710 knockdown in liver cancer cells;

[0029] Figure 7 This figure shows the comparison of cell proliferation and migration abilities in liver cancer cells after overexpression of ZNF710. Detailed Implementation

[0030] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0032] The specific embodiments provided by the present invention will be described in detail below with reference to the accompanying drawings.

[0033] Example 1

[0034] Depend on Figure 1-3 Analysis of the TCGA-LIHC database revealed a significant difference in ZNF710 expression levels between hepatocellular carcinoma (HCC) and normal tissues. Kaplan-Meier curve analysis of HCC patients from the TCGA database showed that patients with high ZNF710 expression had significantly shorter progression-free survival than those with low ZNF710 expression, indicating that high ZNF710 expression is associated with poor prognosis in HCC and suggesting that ZNF710 may play a proto-oncogene role in the development and progression of HCC. Receiver operating characteristic (ROC) curve analysis showed that the area under the curve (AUC) for ZNF710 in distinguishing HCC from normal tissues was 0.774 (95% CI: 0.724–0.824), demonstrating its excellent discriminative power as a novel diagnostic biomarker for HCC.

[0035] Therefore, the relationship between ZNF710 and the occurrence and development of liver cancer was further investigated using the following experimental methods.

[0036] Experimental Method 1: Western blot was used to detect the expression of ZNF710 in liver cancer tumor tissues and normal tissues;

[0037] 1) Proteins were extracted from 5 liver cancer tissues (T) and adjacent normal tissues (N) using a whole protein extraction kit (all liver cancer samples were from the Department of Hepatobiliary Surgery, Shanghai First People's Hospital, with patient consent obtained for sample collection, and the tumors were differentiated into moderate and low differentiation).

[0038] 2) Western blot analysis of ZNF710 protein expression in 5 cases of hepatocellular carcinoma tissue (T) and adjacent normal tissue (N) (ZNF710-Antibody-Polyclonal, catlog:bs-4373R).

[0039] Test results as follows Figure 4 As shown, the expression level of ZNF710 protein in liver cancer tissue (T) is significantly higher than that in adjacent normal tissue (N).

[0040] Experimental Method 2: The expression of ZNF710 in liver cancer cells was detected by Western blot.

[0041] 1) Proteins were extracted from liver cancer cell lines PLC / PRF / 5, Hep3B, Huh7, HCCLM3, Hep1, and MHCC97H using a total protein extraction kit.

[0042] 2) Western blot analysis of ZNF710 protein expression in three hepatocellular carcinoma cell lines (ZNF710-Antibody-Polyclonal, catlog:bs-4373R).

[0043] Test results as follows Figure 5 As shown, ZNF710 is expressed in all three hepatocellular carcinoma cell lines: PLC / PRF / 5, Hep3B, and Huh7, with higher levels of ZNF710 expression in PLC / PRF / 5 and Huh7.

[0044] Experimental Method 3: Detecting changes in cell proliferation ability by knocking down ZNF710 expression in liver cancer cell lines.

[0045] 1) Transfect Huh7 cells with shRNA and construct shNC group (group without target shRNA);

[0046] 2) EdU was used to label liver cancer cells in the shZNF710 and shNC groups. After cell fixation, EdU staining and DAPI staining were performed respectively. The proliferation of liver cancer cells in the shZNF710 and shNC groups was observed under a fluorescence microscope.

[0047] a) Cell seeding and treatment

[0048] Collect cells in the logarithmic growth phase, adjust the cell density to 60,000 cells per mL with complete culture medium, and seed them into 24-well plates. Add 500 µL of cell suspension to each well, so that the cell count per well is approximately 3 × 10⁶ cells. 4 Cells were placed in a 37°C, 5% CO2 incubator and cultured overnight for adhesion.

[0049] b) EdU Marking

[0050] Dilute EdU to 10 µM with complete culture medium. Add 100 µL of EdU-containing medium to each well. Incubate at 37°C and 5% CO2 for 24 hours to allow proliferating cells to take up EdU and incorporate it into their DNA.

[0051] c) Cell fixation and permeabilization

[0052] Discard the culture medium, add 500 µL of pre-cooled 4% paraformaldehyde (PFA) to each well, and fix at room temperature for 15 minutes. Discard the fixative, wash twice with PBS for 5 minutes each time.

[0053] Add 500 µL of 0.5% Triton X-100 permeabilization buffer to each well and incubate gently on a shaker at room temperature for 10 minutes. Discard the permeabilization buffer and wash once with PBS.

[0054] d) Apollo staining

[0055] Add 100 µL of Click-iT staining solution to each well and incubate at room temperature in the dark for 30 minutes. Discard the staining solution and wash three times with PBS for 5 minutes each time.

[0056] e) Nuclear counterstaining

[0057] Add 100 µL of Hoechst 33342 staining solution to each well and incubate at room temperature in the dark for 30 minutes. Discard the staining solution and wash three times with PBS for 5 minutes each time.

[0058] f) Fluorescence Imaging and Analysis

[0059] Images were observed and acquired under a fluorescence microscope: all cell nuclei were observed using the Hoechst channel (blue light, Ex / Em ~350 / 460 nm), and EdU-positive cells were detected using the kFluor647 channel (red light, Ex / Em ~650 / 670 nm). Multiple fields of view were randomly selected from each well for image acquisition, and the proportion of EdU-positive cells was calculated using ImageJ to assess cell proliferation activity.

[0060] 3) The CCK8 method was used to detect the difference in the proliferative activity of hepatocellular carcinoma cells in the shZNF710 and shNC groups.

[0061] a) Take cells in the logarithmic growth phase, add 1 mL of trypsin to each 6 cm dish, shake well, place in a 37°C incubator for static digestion, and when digestion is complete, add 1 mL of complete culture medium to the well to stop digestion, and blow the cell suspension well.

[0062] b) Take a clean hemocytometer and coverslips, count the cells, dilute with complete culture medium to a cell suspension containing 10,000 cells per mL, add 100 μL of cell suspension to each well of a 96-well plate so that the number of cells in each well is 1,000, set up three replicates for each group, and incubate at 37°C and 5% CO2 incubator.

[0063] c) Prepare CCK-8 reagent medium by diluting CCK-8 reagent at a ratio of 1:10 with cell growth medium. Discard the supernatant in the 96-well plate and add 100 μL of the prepared CCK-8 solution to each well at the same time point on different days. Incubate in a cell culture incubator at 37°C for 1 h.

[0064] d) Measure the absorbance at 450 nm using an enzyme-linked immunosorbent assay (ELISA) reader.

[0065] Test results as follows Figure 6 As shown, knocking down ZNF710 in liver cancer cells significantly reduced cell proliferation, suggesting that downregulating ZNF710 can inhibit the proliferation of liver cancer cells.

[0066] Experimental Method 4: Transwell assay to detect changes in the invasive ability of hepatocellular carcinoma cells in the shZNF710 and shNC groups.

[0067] Transfer experiment:

[0068] 1) Add a certain number of hepatocellular carcinoma cells from the shZNF710 and shNC groups into the Transwell chamber. Add DMEM culture medium (containing 10% fetal bovine serum) to the 12-well culture wells outside the Transwell chamber. Take care to avoid generating air bubbles in the outer chamber. Place the 24-well plate into the incubator and continue culturing at 5% CO2 and 37°C.

[0069] 2) After culturing for 24 hours, remove the 24-well plate, add sterile PBS to wash 2-3 times, and gently wipe away the cells in the chambers with a cotton swab, being careful not to puncture the chambers.

[0070] 3) Fix the subcellular cells in the transwell chambers with 4% paraformaldehyde at room temperature for 15 min. Discard the 4% paraformaldehyde, stain the cells with crystal violet for 30 min, air dry at room temperature, and wash away excess crystal violet with PBS. Place the crystal violet-stained Transwell chambers under an inverted microscope to observe the cells and take pictures. Randomly select 5 fields of view and count the number of cells.

[0071] See results Figure 6 Compared with the NC group, the number of liver cancer cells that passed through the Transwell chamber in the Transwell migration experiment of the shZNF710 group was significantly reduced, indicating that downregulating the expression level of ZNF710 can inhibit the migration ability of liver cancer cells.

[0072] Experimental Method 5: Detection of changes in cell proliferation ability in hepatocellular carcinoma cell lines by overexpressing ZNF710.

[0073] 1) Lentiviral transfection of LM3 cells, and simultaneous construction of Vector groups (groups without transfection of the target protein);

[0074] 2) EdU was used to label liver cancer cells in the ZNF710-OE and Vector groups. After cell fixation, EdU staining and DAPI staining were performed respectively. The proliferation of liver cancer cells in the ZNF710-OE and Vector groups was observed under a fluorescence microscope.

[0075] a) Cell seeding and treatment.

[0076] Collect cells in the logarithmic growth phase, adjust the cell density to 60,000 cells per mL with complete culture medium, and seed them into 24-well plates. Add 500 µL of cell suspension to each well, so that the cell count per well is approximately 3 × 10⁶ cells. 4 Cells were placed in a 37°C, 5% CO2 incubator and cultured overnight for adhesion.

[0077] b) EdU Marking

[0078] Dilute EdU to 10 µM with complete culture medium. Add 100 µL of EdU-containing medium to each well. Incubate at 37°C and 5% CO2 for 24 hours to allow proliferating cells to take up EdU and incorporate it into their DNA.

[0079] c) Cell fixation and permeabilization

[0080] Discard the culture medium, add 500 µL of pre-cooled 4% paraformaldehyde (PFA) to each well, and fix at room temperature for 15 minutes. Discard the fixative, wash twice with PBS for 5 minutes each time.

[0081] Add 500 µL of 0.5% Triton X-100 permeabilization buffer to each well and incubate gently on a shaker at room temperature for 10 minutes. Discard the permeabilization buffer and wash once with PBS.

[0082] d) Apollo staining

[0083] Add 100 µL of Click-iT staining solution to each well and incubate at room temperature in the dark for 30 minutes. Discard the staining solution and wash three times with PBS for 5 minutes each time.

[0084] e) Nuclear counterstaining

[0085] Add 100 µL of Hoechst 33342 staining solution to each well and incubate at room temperature in the dark for 30 minutes. Discard the staining solution and wash three times with PBS for 5 minutes each time.

[0086] f) Fluorescence Imaging and Analysis

[0087] Images were observed and acquired under a fluorescence microscope: all cell nuclei were observed using the Hoechst channel (blue light, Ex / Em ~350 / 460 nm), and EdU-positive cells were detected using the kFluor647 channel (red light, Ex / Em ~650 / 670 nm). Multiple fields of view were randomly selected from each well for image acquisition, and the proportion of EdU-positive cells was calculated using ImageJ to assess cell proliferation activity.

[0088] 3) The CCK8 method was used to detect the difference in the proliferation activity of liver cancer cells in the ZNF710-OE and Vector groups.

[0089] a) Take cells in the logarithmic growth phase, add 1 mL of trypsin to each 6 cm dish, shake well, place in a 37°C incubator for static digestion, and when digestion is complete, add 1 mL of complete culture medium to the well to stop digestion, and blow the cell suspension well.

[0090] b) Take a clean hemocytometer and coverslips, count the cells, dilute with complete culture medium to a cell suspension containing 10,000 cells per mL, add 100 μL of cell suspension to each well of a 96-well plate so that the number of cells in each well is 1,000, set up three replicates for each group, and incubate at 37°C and 5% CO2 incubator.

[0091] c) Prepare CCK-8 reagent medium by diluting CCK-8 reagent at a ratio of 1:10 with cell growth medium. Discard the supernatant in the 96-well plate and add 100 μL of the prepared CCK-8 solution to each well at the same time point on different days. Incubate in a cell culture incubator at 37°C for 1 h.

[0092] d) Measure the absorbance at 450 nm using an enzyme-linked immunosorbent assay (ELISA) reader.

[0093] Test results as follows Figure 7 As shown, overexpression of ZNF710 in liver cancer cells significantly enhanced cell proliferation, suggesting that upregulation of ZNF710 can promote the proliferation of liver cancer cells.

[0094] Experimental Method 6: Transwell assay to detect changes in the invasive ability of ZNF710-OE and Vector group liver cancer cells.

[0095] 1) Add a certain number of ZNF710-OE and Vector group liver cancer cells into the Transwell chamber. Add DMEM culture medium (containing 10% fetal bovine serum) to the 24-well plate culture wells outside the Transwell chamber. Take care to avoid generating air bubbles in the outer chamber. Place the 24-well plate in an incubator and continue to culture at 37°C with 5% CO2.

[0096] 2) After culturing for 24 hours, remove the 24-well plate, add sterile PBS to wash 2-3 times, and gently wipe away the cells in the chambers with a cotton swab, being careful not to puncture the chambers.

[0097] 3) Fix the subcellular cells in the transwell chambers with 4% paraformaldehyde at room temperature for 15 min. Discard the 4% paraformaldehyde, stain the cells with crystal violet for 30 min, air dry at room temperature, and wash away excess crystal violet with PBS. Place the crystal violet-stained Transwell chambers under an inverted microscope to observe the cells and take pictures. Randomly select 5 fields of view and count the number of cells.

[0098] Test results as follows Figure 7 As shown, compared with the Vector group, the number of liver cancer cells that passed through the Transwell chamber in the ZNF710-OE group was significantly increased in the Transwell migration experiment, indicating that upregulating the expression level of ZNF710 can promote the migration ability of liver cancer cells.

[0099] The above description is only a preferred embodiment of the present invention. It should be noted that those skilled in the art can make several improvements and additions without departing from the method of the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention.

Claims

1. ZNF710 Application of genes in the preparation of formulations for the diagnosis and / or prognostic assessment of hepatocellular carcinoma.

2. A formulation for the diagnosis and / or prognostic assessment of liver cancer, characterized in that, Includes quantitative detection ZNF710 Reagents for gene expression levels.

3. The formulation according to claim 2, characterized in that, The quantitative detection ZNF710 Reagents for gene expression quantification include those suitable for at least one of the following methods: fluorescent dye method, digital PCR, resonance light scattering method, real-time quantitative PCR, sequencing, or biomolecular mass spectrometry.

4. The formulation according to claim 3, characterized in that, The PCR detection ZNF710 The gene expression quantification reagent contains the following primer sequences: ZNF710 F: 5'-AGTGTGACAAGTCCTTCCACTACC-3'; ZNF710 R: 5'-GGTGGTGAATCTGGCTGAACTC-3'.

5. A kind of inhibition ZNF710 Application of gene expression reagents in the preparation of agents for treating liver cancer.

6. The application according to claim 5, characterized in that, The suppression ZNF710 Reagents for gene expression include: shRNA.

7. The application according to claim 6, characterized in that, The shRNA sequence is as follows: shZNF710-#1: GAAGTCCTTCAACCGCATGTA, or: shZNF710-#2: CACGAAGTGAAGCATGAGAGT.

8. A preparation for treating liver cancer, characterized in that, Including inhibition ZNF710 Reagents for gene or protein expression.

9. The formulation according to claim 8, characterized in that, The suppression ZNF710 Reagents for gene expression include shRNA.

10. The formulation according to claim 9, characterized in that, The shRNA sequence is as follows: shZNF710-#1: GAAGTCCTTCAACCGCATGTA, or: shZNF710-#2: CACGAAGTGAAGCATGAGAGT.

Images