ASO targeting SCN10A gene and application thereof
By designing antisense oligonucleotides that specifically bind to exon 7 of the SCN10A gene, the problem of the lack of antisense oligonucleotides targeting the SCN10A gene was solved, enabling effective treatment of pain diseases such as chronic pain.
Patent Information
- Application Number
- CN202511506845.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2024-10-22
- Filing Date
- 2025-10-21
- Publication Date
- 2026-04-24
AI Technical Summary
There is a lack of effective antisense oligonucleotides targeting the SCN10A gene in the current technology, especially for the prevention or treatment of chronic pain.
An antisense oligonucleotide that specifically binds to exon 7 of the SCN10A gene was designed to inhibit the expression of the SCN10A gene by inducing the jumping of exon 7 of the SCN10A premRNA. The antisense oligonucleotide with a specific length and sequence was used and modified with nucleotides to improve stability and binding efficiency.
Effectively inhibiting the expression of the SCN10A gene reduces symptoms of pain-related diseases, including chronic pain, inflammatory pain, and neuropathic pain, providing a new approach to pain treatment.
Smart Images

Figure BDA0005646706660000111 
Figure BDA0005646706660000121 
Figure BDA0005646706660000131
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedicine. Specifically, this invention relates to ASO targeting the SCN10A gene and its applications. Background Technology
[0002] Pain originates from nociceptors in the peripheral nervous system. These are free nerve endings, widely distributed throughout the skin, muscles, joints, and internal organs. They convert perceived thermal, mechanical, or chemical stimuli into nerve impulses (action potentials), which are transmitted via afferent nerve fibers to the cell body of the dorsal root ganglion (DRG), ultimately reaching higher nerve centers and causing pain. The generation and conduction of action potentials in neurons depend on voltage-gated sodium channels (NaV) on the cell membrane. When the cell membrane depolarizes, sodium channels are activated, opening and causing an influx of sodium ions, further depolarizing the cell membrane and leading to the generation of action potentials. Therefore, inhibiting abnormal sodium channel activity can help treat and alleviate pain.
[0003] Human sodium ions are transmembrane ion channel proteins, classified into nine subtypes: Nav1.1–Nav1.9. Nav1.5, Nav1.8, and Nav1.9 are tetrodotoxin (TTX)-insensitive sodium channels. Nav1.5 is primarily found in cardiomyocytes, while Nav1.8 and Nav1.9 are present in the peripheral nervous system. Nav1.8 is a crucial ion channel involved in chronic pain, atrial fibrillation, and Budd-Chiari syndrome, making it a highly selective target for pain management. The Nav1.8 gene, SCN10A, is located on human chromosome 3p21-22 and primarily encodes the α subunit. Studies have shown that the human and rat Nav1.8 genes share up to 93% homology. Nav1.8 is mainly found in trigeminal ganglion neurons and DRG neurons, exhibiting slow inactivation and rapid recovery electrophysiological characteristics. Functionally gain mutations in the human Nav1.8 gene can lead to peripheral neuralgia. Based on a series of animal studies and human genetic evidence, selective inhibition of Nav1.8 has the potential to become a novel analgesic therapy for the treatment of various types of pain, including inflammatory pain, neuropathic pain, postoperative pain, and cancer pain.
[0004] Antisense oligonucleotides (ASOs) are short, chemically synthesized single-stranded oligonucleotides. Modification of their backbone and glycosyl groups can enhance their stability, pharmacological properties, and target binding, while typically exhibiting low toxicity. They are commonly used in cellular and animal gene function studies and the development of ASO nucleic acid drugs. ASOs bind to mRNA or pre-mRNA in a sequence-specific (i.e., complementary) manner. Tightly bound ASOs to mRNA can block the synthesis of ribosomal proteins. Similarly, tightly bound ASOs to pre-mRNA can interfere with splicing and generate splice variants of mRNA.
[0005] No research has been reported on antisense oligonucleotides targeting SCN10A. There is an urgent need for an antisense oligonucleotide that can effectively inhibit SCN10A expression for the prevention or treatment of pain, especially chronic pain. Summary of the Invention
[0006] The purpose of this invention is to provide an antisense oligonucleotide that can effectively inhibit SCN10A expression for the prevention or treatment of pain, especially chronic pain.
[0007] A first aspect of the present invention provides an antisense oligonucleotide that inhibits the expression of the SCN10A gene, wherein the antisense oligonucleotide is an oligonucleotide that specifically binds to exon 7 of the SCN10A gene, and the antisense oligonucleotide inhibits the expression of the SCN10A gene or modifies its expression product by inducing the jumping of exon 7 of the SCN10A premRNA.
[0008] In another preferred embodiment, the antisense oligonucleotide is complementary to a base fragment of length L nucleotides in exon 7 region of the SCN10A transcript, where L is a positive integer ≥10.
[0009] In another preferred embodiment, L ≤ 50, more preferably ≤ 30, and even more preferably ≤ 25.
[0010] In another preferred embodiment, L ≥ 12, more preferably ≥ 15, and even more preferably ≥ 17.
[0011] In another preferred embodiment, L is 15-25, more preferably 17-23, and even more preferably 18-20.
[0012] In another preferred embodiment, the number of mismatched bases in the complementary match is ≤3; preferably ≤2; more preferably ≤1; and even more preferably 0 (i.e., perfectly complementary).
[0013] In another preferred embodiment, the mismatched base is not located at the 5' end or the 3' end.
[0014] In another preferred embodiment, the mismatched base is ≥2nt from the 5' end and ≥2nt from the 3' end.
[0015] In another preferred embodiment, the mismatched base is located in a region of 1-5 nt above and below the central base of the antisense oligonucleotide sequence, more preferably 1-4 nt; and more preferably 1-2 nt.
[0016] In another preferred embodiment, the SCN10A gene is derived from a human or a non-human mammal.
[0017] In another preferred embodiment, the non-human mammals include rodents and primates, preferably mice, rats, rabbits, and monkeys; more preferably rats.
[0018] In another preferred embodiment, the SCN10A transcript is wild-type.
[0019] In another preferred embodiment, the SCN10A transcript is NM-006514.4.
[0020] In another preferred embodiment, the exon 7 sequence of the SCN10A transcript is shown in SEQ ID NO:26.
[0021] In another preferred embodiment, the antisense oligonucleotide is DNA.
[0022] In another preferred embodiment, the antisense oligonucleotide is not sgRNA.
[0023] In another preferred embodiment, each nucleotide in the antisense oligonucleotide is independently a modified or unmodified nucleotide.
[0024] In another preferred embodiment, the antisense oligonucleotide inhibits the expression of the SCN10A gene or modifies its expression product.
[0025] In another preferred embodiment, the antisense oligonucleotide specifically hybridizes with exon 7 of the SCN10A pre-mRNA.
[0026] In another preferred embodiment, the antisense oligonucleotide is a single-stranded oligonucleotide.
[0027] In another preferred embodiment, the antisense oligonucleotide is a single-stranded modified oligonucleotide.
[0028] In another preferred embodiment, the antisense oligonucleotide is non-natural.
[0029] In another preferred embodiment, the antisense oligonucleotide comprises artificially synthesized or recombinantly expressed oligonucleotides.
[0030] In another preferred embodiment, the nucleotide sequence of the antisense oligonucleotide is selected from any of the sequences shown in SEQ ID NO.1-20 or their respective corresponding modified sequences.
[0031] In another preferred embodiment, the nucleotide sequence of the antisense oligonucleotide is selected from any of the sequences shown in SEQ ID NO. 1-9, SEQ ID NO. 14-17 or SEQ ID NO. 19-20.
[0032] In another preferred embodiment, each T in the antisense oligonucleotide is independently replaced by U.
[0033] In another preferred embodiment, the modified nucleotide is selected from: 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxynucleotides, 2'-deoxy-2'-fluoro modified nucleotides, 2'-methoxyethyl modified nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, 2'-alkoxy modified nucleotides, phosphate thioester modified nucleotides, debased nucleotides, morpholinonucleotides, locked nucleic acids, methylcytosine, or combinations thereof.
[0034] In another preferred embodiment, the modified nucleotide is selected from: 2'-O-methyl modified nucleotides, locked nucleic acids, methylcytosine modified nucleotides, phosphate thioester modified nucleotides, or combinations thereof.
[0035] In another preferred embodiment, the antisense oligonucleotide comprises a nucleotide having more than 80% (preferably, more than 85%, more preferably, more than 90%, more preferably, more than 95%, more preferably, 98% or more than 99%) homology to SEQ ID NO. 1-20.
[0036] In another preferred embodiment, the antisense oligonucleotide structure comprises moeGs moeTs moemeCs moeAsmoeGs moeAs moeAs moeGs moeTs moeGs moemeCs moemeCs moeTs moemeCs moeGsmoemeCs moeTs moeTs moeAs moeT (SEQ ID NO.1).
[0037] In this context, moe indicates that the 2-position of the ribose is modified with MOE, and me indicates that it is modified with a methyl group.
[0038] In another preferred example, the antisense oligonucleotide structure comprises moeGs moeGs moeTs moemeCsmoeAs moeGs moeAs moeAs moeGs moeTs moeGs moemeCs moemeCs moeTs moemeCs moeGsmoemeCs moeTs moeTs moeA (SEQ ID NO.2).
[0039] In this context, moe indicates that the 2-position of the ribose is modified with MOE, and me indicates that it is modified with a methyl group.
[0040] In another preferred embodiment, the antisense oligonucleotide structure comprises moeGs moeGs moeGs moeGs moeTsmoemeCs moeAs moeGs moeAs moeAs moeGs moeTs moeGs moemeCs moemeCs moeTsmoemeCs moeGs moemeCs moeT (SEQ ID NO.3).
[0041] In this context, moe indicates that the 2-position of the ribose is modified with MOE, and me indicates that it is modified with a methyl group.
[0042] In another preferred example, the antisense oligonucleotide structure comprises moeAs moeGs moeGs moeGs moeTs moemeCs moeAs moeGs moeAs moeGs moeTs moeGs moemeCs moemeCs moeTsmoemeCs moeGs moemeC (SEQ ID NO.4).
[0043] In this context, moe indicates that the 2-position of the ribose is modified with MOE, and me indicates that it is modified with a methyl group.
[0044] In another preferred example, the antisense oligonucleotide structure comprises moeAs moeAs moeGs moeGs moeGs moeTs moemeCs moeAs moeGs moeAs moeGs moeTs moeGs moemeCs moemeCsmoeTs moemeCs moeG (SEQ ID NO.5).
[0045] In this context, moe indicates that the 2-position of the ribose is modified with MOE, and me indicates that it is modified with a methyl group.
[0046] In another preferred example, the antisense oligonucleotide structure comprises moeTs moeAs moeAs moeGs moeGsmoeGs moeGs moeTs moemeCs moeAs moeGs moeAs moeGs moeTs moeGs moemeCsmoemeCs moeTs moemeC (SEQ ID NO. 6).
[0047] In this context, moe indicates that the 2-position of the ribose is modified with MOE, and me indicates that it is modified with a methyl group.
[0048] In another preferred example, the antisense oligonucleotide structure comprises moeGs moeTs moeAs moeAs moeGsmoeGs moeGs moeGs moeTs moemeCs moeAs moeGs moeAs moeGs moeTs moeGsmoemeCs moemeCs moeT (SEQ ID NO.7).
[0049] In this context, moe indicates that the 2-position of the ribose is modified with MOE, and me indicates that it is modified with a methyl group.
[0050] In another preferred embodiment, the antisense oligonucleotide structure comprises moeAs moeGs moeTs moeAs moeGs moeGs moeGs moeGs moeTs moemeCs moeAs moeGs moeAs moeGs moeTsmoeGs moemeCs moemeC (SEQ ID NO. 8).
[0051] In this context, moe indicates that the 2-position of the ribose is modified with MOE, and me indicates that it is modified with a methyl group.
[0052] In another preferred embodiment, the antisense oligonucleotide structure comprises moemeCs moeAs moeGs moeTsmoeAs moeAs moeGs moeGs moeGs moeTs moemeCs moeAs moeGs moeAs moeGs moeTs moeGs moemeC (SEQ ID NO. 9),
[0053] In this context, moe indicates that the 2-position of the ribose is modified with MOE, and me indicates that it is modified with a methyl group.
[0054] In another preferred example, the antisense oligonucleotide structure comprises moemeCs moemeCs moeTs moeGsmoeAs moeGs moeTs moemeCs moeAs moeGs moeAs moeTs moemeCs moemeCs moeAs moeTsmoeTs moeGs moemeCs moemeC (SEQ ID NO.10).
[0055] In this context, moe indicates that the 2-position of the ribose is modified with MOE, and me indicates that it is modified with a methyl group.
[0056] In another preferred example, the antisense oligonucleotide structure comprises moeGs moeAs moeGs moeTsmoemeCs moeAs moeGs moeAs moeTs moemeCs moemeCs moeAs moeTs moeTs moeGsmoemeCs moemeCs moeAs moemeCs moeA (SEQ ID NO.11).
[0057] In this context, moe indicates that the 2-position of the ribose is modified with MOE, and me indicates that it is modified with a methyl group.
[0058] In another preferred example, the antisense oligonucleotide structure comprises moeTs moemeCs moeAs moeGsmoeAs moeTs moemeCs moemeCs moeAs moeTs moeTs moeGs moememeCs moemeCs moeAsmoemeCs moeAs moeG (SEQ ID NO.12).
[0059] In this context, moe indicates that the 2-position of the ribose is modified with MOE, and me indicates that it is modified with a methyl group.
[0060] In another preferred example, the antisense oligonucleotide structure comprises moeGs moeAs moeTs moemeCsmoemeCs moeAs moeTs moeTs moeGs moemeCs moemeCs moeAs moemeCs moeAs moemeCsmoeAs moeGs moeTs moeAs moeA (SEQ ID NO.13).
[0061] In this context, moe indicates that the 2-position of the ribose is modified with MOE, and me indicates that it is modified with a methyl group.
[0062] In another preferred example, the antisense oligonucleotide structure comprises moemeCs moemeCs moeAs moeTsmoeTs moeGs moemeCs moemeCs moeAs moemeCs moeAs moemeCs moeAs moeGs moeTsmoeAs moeAs moeGs moeGs moeGs (SEQ ID NO.14).
[0063] In this context, moe indicates that the 2-position of the ribose is modified with MOE, and me indicates that it is modified with a methyl group.
[0064] In another preferred example, the antisense oligonucleotide structure comprises D-moemeCs moemeCs moeAs moeTsmoeTs moeGs moemeCs moemeCs moeAs moemeCs moeAs moemeCs moeAs moeGs moeTsmoeAs moeAs moeGs moeGs moeG (SEQ ID NO.14).
[0065] Wherein, D represents cholesterol, which is linked by a phosphodiester bond; moe indicates that the 2-position of the ribose is modified with MOE, and me indicates methyl modification.
[0066] In another preferred example, the antisense oligonucleotide structure comprises moeGs moeAs moeAs moeGs moeTsmoeGs moemeCs moemeCs moeTs moeCs moeGs moemeCs moeTs moeTs moeAs moeTs moeTsmoeTs moeTs moeTs moeTs moeTs moeTs moeAs moeT (SEQ ID NO.15).
[0067] In this context, moe indicates that the 2-position of the ribose is modified with MOE, and me indicates that it is modified with a methyl group.
[0068] In another preferred example, the antisense oligonucleotide structure comprises moeGs moeTs moeGs moemeCsmoemeCs moeTs moemeCs moeGs moemeCs moeTs moeTs moeAs moeTs moeTs moeTs moeAsmoeTs moeGs moeTs moeA (SEQ ID NO.16).
[0069] In this context, moe indicates that the 2-position of the ribose is modified with MOE, and me indicates that it is modified with a methyl group.
[0070] In another preferred example, the antisense oligonucleotide structure comprises moemeCs moemeCs moeTs moemeCsmoeGs moemeCs moeTs moeTs moeAs moeTs moeTs moeTs moeAs moeTs moeGs moeTsmoeAs moeGs moeTsmoeAs moeT (SEQ ID NO.17).
[0071] In this context, moe indicates that the 2-position of the ribose is modified with MOE, and me indicates that it is modified with a methyl group.
[0072] In another preferred example, the antisense oligonucleotide structure comprises moemeCs moemeCs moeAs moemeCsmoeAs moemeCs moeAs moeGs moeTs moeAs moeAs moeGs moeGs moeGs moeGs moeTsmoemeCs moeAs moeGs moeA (SEQ ID NO.18).
[0073] In this context, moe indicates that the 2-position of the ribose is modified with MOE, and me indicates that it is modified with a methyl group.
[0074] In another preferred example, the antisense oligonucleotide structure comprises moeGs moeGs moeGs moeTsmoemeCs moeAs moeGs moeAs moeAs moeGs moeTs moeGs moemeCs moemeCs moeTsmoemeCs moeGs moemeCs moeTs moeT (SEQ ID NO.19).
[0075] In this context, moe indicates that the 2-position of the ribose is modified with MOE, and me indicates that it is modified with a methyl group.
[0076] In another preferred embodiment, the antisense oligonucleotide structure comprises G(LNA)s G(LNA)s gs ts mecs asgs meas as gs ts gs mecs cs ts mecs gs mecs T(LNA)s T(LNA) (SEQ ID NO.19), where me represents methyl modification, uppercase A, T, G and C represent ribonucleotides, lowercase a, t, g and c represent deoxyribonucleotides, and T(LNA) and G(LNA) represent LNA structures.
[0077] In another preferred example, the antisense oligonucleotide structure comprises moemeCs moemeCs moeAs moeTsmoeTs moeGs moemeCs moemeCs moeGsmoemeCs moeAs moemeCs moeAs moeGs moeTsmoeAs moeAs moeGs moeGs moeGs (SEQ ID NO.20),
[0078] In this context, moe indicates that the 2-position of the ribose is modified with MOE, and me indicates that it is modified with a methyl group.
[0079] In another preferred embodiment, the antisense oligonucleotide is coupled with a functionalized modifying group.
[0080] In another preferred embodiment, the functionalized modifying group is selected from the group consisting of molecules that enhance cell membrane permeability.
[0081] In another preferred embodiment, the molecule that enhances cell membrane permeability is selected from the group consisting of cholesterol, tocopherol, fatty acids, or combinations thereof.
[0082] In another preferred embodiment, the antisense oligonucleotide is linked to a phosphodiester bond by a nucleotide to a molecule that enhances cell membrane permeability.
[0083] In a second aspect of the invention, a pharmaceutical composition is provided, the pharmaceutical composition comprising:
[0084] (a) the antisense oligonucleotide described in the first aspect of the present invention; and
[0085] (b) Pharmaceutically acceptable carriers.
[0086] In a third aspect of the invention, the use of the antisense oligonucleotide described in the first aspect of the invention or the pharmaceutical composition described in the second aspect of the invention is provided for:
[0087] Preparation of drugs that inhibit and / or reduce the expression of the SCN10A gene in vivo or in vitro; and / or,
[0088] Preparation of drugs that induce exon skipping of SCN10A pre-mRNA; and / or,
[0089] Prepare medicines for the prevention and / or treatment of pain-related diseases.
[0090] In another preferred embodiment, the exon is exon 7.
[0091] In another preferred embodiment, the pain-related disease is selected from primary pain or idiopathic pain.
[0092] In another preferred embodiment, the pain-related disease is selected from: acute pain, chronic pain, inflammatory pain, cancer pain, neuropathic pain, musculoskeletal pain, intestinal pain, postoperative pain, visceral pain, multiple sclerosis, Sharma-Tutan syndrome, incontinence, pathological cough, or arrhythmia.
[0093] In another preferred embodiment, the inflammatory pain includes rheumatoid arthritis pain.
[0094] In another preferred embodiment, the neuropathic pain includes postherpetic neuralgia, diabetic neuropathic pain, painful HIV-associated sensory neuropathy, trigeminal neuralgia, burning mouth syndrome, post-amputation pain, phantom pain, painful neuroma, traumatic neuroma, Morton's neuroma, nerve compression injury, spinal stenosis, carpal tunnel syndrome, radicular pain, sciatica, nerve avulsion, brachial plexus avulsion, complex regional pain syndrome, drug-induced neuropathic pain, cancer chemotherapy-induced neuropathic pain, antiretroviral therapy-induced neuropathic pain, post-spinal cord injury pain, idiopathic small fiber neuropathy, idiopathic sensory neuropathy, or trigeminal autonomic headache.
[0095] In another preferred embodiment, the musculoskeletal pain includes osteoarthritis pain, back pain, cold pain, burn pain, or toothache.
[0096] In another preferred embodiment, the intestinal pain includes pain from inflammatory bowel disease, Crohn's disease, or interstitial cystitis.
[0097] In another preferred embodiment, the idiopathic pain includes fibromyalgia.
[0098] In a fourth aspect of the invention, a method for inhibiting SCN10A expression in SCN10A-expressing cells is provided, the method comprising the steps of:
[0099] In the presence of the antisense oligonucleotide described in the first aspect of the present invention, cells are cultured to induce exon 7 skipping of the SCN10A premRNA to suppress the expression of the SCN10A gene.
[0100] In another preferred embodiment, the method is an in vitro method.
[0101] In another preferred embodiment, the method is non-diagnostic and non-therapeutic.
[0102] In another preferred embodiment, the cells include nerve cells.
[0103] In a fifth aspect of the invention, a method for preventing and / or treating pain-related diseases is provided, comprising the step of administering a therapeutically effective amount of the antisense oligonucleotide of the first aspect of the invention, or the pharmaceutical composition of the second aspect of the invention, to a subject.
[0104] In another preferred embodiment, the subject is a human or a non-human mammal.
[0105] In a sixth aspect of the invention, a method for inducing exon jumping of SCN10A pre-mRNA is provided, the method comprising: delivering to a cell the antisense oligonucleotide of the first aspect of the invention or the pharmaceutical composition of the second aspect of the invention, thereby inducing exon jumping of SCN10A pre-mRNA.
[0106] In another preferred embodiment, the exon is exon 7.
[0107] In another preferred embodiment, the cell is a mammalian cell.
[0108] In another preferred embodiment, the cells include nerve cells.
[0109] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description
[0110] The following figures are used to illustrate specific embodiments of the present invention and are not intended to limit the scope of the invention as defined by the claims.
[0111] Figure 1 Sanger sequencing data showing PCR product bands with no skipping or skipping in exon 7 after SCN10A cells were treated with 0 nM (negative control) or 100 nM ASO. Detailed Implementation
[0112] Through extensive and in-depth research, the inventors have developed, for the first time, an antisense oligonucleotide with a specific structure. After extensive screening, the inventors unexpectedly discovered that antisense oligonucleotides of 20 nt in length targeting exon 7 of the SCN10A gene can specifically skip exon 7 of the SCN10A gene and can effectively treat pain-related diseases. Based on this, the present invention was completed.
[0113] the term
[0114] To facilitate understanding of the invention, certain technical and scientific terms are specifically defined below. Unless otherwise expressly defined herein, all other technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains. Before describing the invention, it should be understood that the invention is not limited to the specific methods and experimental conditions described, as such methods and conditions can vary. It should also be understood that the terminology used herein is intended only to describe particular embodiments and is not intended to be restrictive; the scope of the invention will be limited only by the appended claims.
[0115] As used herein, when referring to a specific enumerated value, the term “about” means that the value can vary by no more than 1% from the enumerated values. For example, as used herein, the expression “about 100” includes all values between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).
[0116] As used herein, the terms “comprising,” “including,” and “containing” are used interchangeably and include not only closed definitions but also semi-closed and open definitions. In other words, the terms include “consisting of” and “substantially consisting of”.
[0117] As used herein, the term "pharmaceutically acceptable carrier" refers to a substance that is suitable for use in humans and / or animals without excessive adverse side effects (such as toxicity, irritation, and allergic reactions), i.e., a reasonable benefit / risk ratio.
[0118] As used herein, the term "therapeutic effective amount" refers to an amount that is functional or active in humans and / or animals and is acceptable to humans and / or animals. Those skilled in the art will understand that the "therapeutic effective amount" can vary depending on the form of the pharmaceutical composition, the route of administration, the excipients used, the severity of the disease, and whether it is used in combination with other drugs.
[0119] As used herein, the term "oligonucleotide" generally refers to a molecule containing two or more covalently linked nucleosides. Such covalently linked nucleosides may also be called nucleic acid molecules or oligomers. Oligonucleotides are typically prepared in the laboratory by solid-phase chemical synthesis followed by purification. When referring to the sequence of an oligonucleotide, reference is made to the sequence or order of the nucleobase portion of the covalently linked nucleotide or nucleoside or its modifications. The oligonucleotides of this disclosure are artificially prepared and chemically synthesized, and are generally purified or isolated. The disclosed oligonucleotides may contain one or more modified nucleosides or nucleotides.
[0120] SCN10A
[0121] SCN10A (gene ID: 6336) is located in the 3p21-22 region of human chromosome 1 and encodes the Nav1.8 protein. The full-length genome of the SCN10A gene is 119411 bp (accession number, NG_031891.3), and the full-length mRNA sequence of its transcript is 6626 bp (accession number, NM_006514.4). The base sequence of the region between exon 6 and exon 8 of the SCN10A transcript (including exon 6-intron 6-exon 7-intron 7-exon 8) is shown in SEQ ID NO. 28.
[0122] target
[0123] As used herein, the term "target" refers to the human sodium voltage-gated channel α subunit 10 (SCN10A) and the nucleic acid encoding human SCN10A. The SCN10A nucleic acid encodes the α subunit of a sodium channel called Nav1.8.
[0124] target nucleic acid
[0125] According to the present invention, the target nucleic acid is a nucleic acid encoding human SCN10A, and can be, for example, a gene, RNA, mRNA and precursor mRNA, mature mRNA, or cDNA sequence. This target can therefore be referred to as the SCN10A target nucleic acid. For in vitro and in vivo use, the preferred target nucleic acid is precursor mRNA or mRNA encoding SCN10A. If the oligonucleotides of the present invention are used in research or diagnostics, the target nucleic acid can be cDNA or a synthetic nucleic acid derived from DNA or RNA.
[0126] The preferred target gene is human SCN10A, such as human SCN10A precursor mRNA.
[0127] In some implementations, the base sequence of exon 7 is:
[0128] 5'-cagatatctacataaataagcgaggcacttctgaccccttatactgtgtggcaatggatctgactcagg-3' (SE Q ID NO 26).
[0129] The antisense oligonucleotides of the present invention comprise a continuous nucleotide sequence that is complementary to and hybridizes with a target nucleic acid (such as the target sequence described herein).
[0130] Single-molecule guide RNA (sgRNA)
[0131] sgRNA is a post-transcriptional modification process called RNA editing that occurs within the kinetoplastid. It is also a small non-coding RNA. It can pair with pre-mRNA and insert uracil (U) to produce functional mRNA. The guide RNA-edited RNA molecule is approximately 60–80 nucleotides long, transcribed from a single gene, and has a 3' oligo-U tail with a sequence in the middle precisely complementary to the edited mRNA. Its 5' end is an anchoring sequence complementary to the unedited mRNA sequence.
[0132] As will be understood by those skilled in the art, each guide RNA is designed to contain at least one spacer sequence complementary to its genomic target sequence. For example, each spacer sequence may be placed in a single RNA chimera or crRNA (and the corresponding tra crRNA). See Jinek et al., Science, 337, 816-821 (2012) and Deltcheva et al., Nature, 471, 602-607 (2011).
[0133] antisense oligonucleotides
[0134] The term “antisense oligonucleotide” or “ASO” includes single-stranded RNAs (e.g., mature miRNAs, ssRNAi oligonucleotides, ssDNAi oligonucleotides) that, when the antisense oligonucleotide is in the same cell as the target gene or sequence, can reduce or inhibit the expression of the target gene or sequence (e.g., by mediating degradation and inhibiting the translation of mRNA complementary to the antisense oligonucleotide sequence).
[0135] In one embodiment, the antisense oligonucleotide is chemically synthesized. The antisense oligonucleotide of the present invention is capable of silencing the expression of a target sequence in vitro and / or in vivo. In other embodiments, the antisense oligonucleotide comprises at least one modified nucleotide, for example, the antisense oligonucleotide contains one, two, three, four, five, six, seven, eight, nine, ten or more modified nucleotides in the double-stranded region.
[0136] Typically, the majority of the nucleotides in an antisense oligonucleotide are ribonucleotides, but as detailed herein, it may also include one or more non-ribonucleotides, such as deoxyribonucleotides and / or modified nucleotides. Additionally, as used herein, "antisense oligonucleotide" can include chemically modified ribonucleotides; antisense oligonucleotides can include substantial modifications at multiple nucleotides. As used herein, the term "modified nucleotide" refers to a nucleotide that independently has a modified sugar moiety, a modified internucleotide link, and / or a modified nucleobase. Thus, the term modified nucleotide encompasses substitution, addition, or removal of, for example, a functional group or atom, from the internucleotide link, sugar moiety, or nucleobase. Modifications suitable for use in this invention include all types of modifications disclosed herein or known in the art.
[0137] In this invention, the antisense oligonucleotide disclosed herein is an antisense polynucleotide designed to specifically hybridize with a target region (e.g., exon 7) of the SCN10A gene, such that the antisense polynucleotide inhibits the expression of the SCN10A gene by inducing exon skipping in SCN10A pre-mRNA or mature mRNA. In this invention, the antisense polynucleotide is at least about 8 nucleotides in length and at most about 30 or more nucleotides in length.
[0138] Modified nucleotides
[0139] This invention provides antisense oligonucleotides for inhibiting SCN10A gene expression or modifying its expression product. In some embodiments, the antisense oligonucleotide contains one or more modified nucleotides. In some embodiments, the modified nucleotides include, but are not limited to: 2'-O-methyl modified nucleotides, 2'-fluorine modified nucleotides, 2'-fluorine, 2'-deoxy modified nucleotides, 2'-deoxy nucleotides, 2'-methoxyethyl modified nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, 2'-alkoxy modified nucleotides, 2'-F-arabinonucleotides, debased nucleotides, morpholinonucleotides, methylcytosine, and locked nucleotides. Not all positions in a given compound need to be modified uniformly. Instead, more than one modification may be added to a single antisense oligonucleotide or even to a single nucleotide. The modification of one nucleotide is independent of the modification of another nucleotide.
[0140] In some embodiments, one or more nucleotides of the antisense oligonucleotide are linked by a non-standard linker or backbone (i.e., a modified internucleotide linker or modified backbone). Modified internucleotide links or backbones include, but are not limited to, thiophosphate groups, chiral thiophosphates, thiophosphates, dithiophosphates, phosphate triesters, aminoalkyl-phosphate triesters, chiral phosphonates, hypophosphonates, aminophosphates, thioalkylphosphonates, thioalkyl phosphate triesters, and morpholino linkages.
[0141] Exemplary antisense oligonucleotide (unmodified) DNA sequences (as shown in SEQ ID NO. 1-22) and their respective modified sequences are shown in Table 1 below.
[0142] Table 1
[0143]
[0144]
[0145]
[0146]
[0147] In this context, all the links mentioned above are phosphate thioesters, MOE indicates that the 2-position of the ribose is modified with MOE, me indicates methyl modification, uppercase ATGC indicates ribonucleotide, lowercase atgc indicates deoxyribonucleotide, and A... (LNA) T (LNA) G (LNA) C (LNA) Represents the LNA structure.
[0148] To improve the membrane permeability of ASOs, they can be linked to molecules that enhance cell membrane permeability, including but not limited to cholesterol, tocopherol, and fatty acids. The modified oligonucleotides ASO1-24 are designated by their respective numbers.
[0149] The structures of 2'-methoxy-ribose (2'-OMe) and 2'-O-methoxyethyl-ribose (2'-O-MOE) are as follows:
[0150]
[0151] Locking in nucleic acid (LNA)
[0152] "LNA nucleotides" are 2'-modified nucleotides containing a C2' and C4' bipolar junction (also known as a "2'-4' bridge") that restricts or locks the conformation of the ribose ring. These nucleotides are also referred to in the literature as bridging nucleic acids or bicyclic nucleic acids (BNAs). When LNAs are incorporated into oligonucleotides of complementary RNA or DNA molecules, the locking of the ribose conformation is associated with enhanced hybridization affinity (double-strand stabilization).
[0153] Other non-limiting exemplary LNA nucleosides include: (β-D-oxyLNA used in this invention)
[0154]
[0155] Pharmaceutical Compositions and Administration
[0156] As used herein, the term “effective amount” or “effective dose” means an amount that is functional or active in humans and / or animals and is acceptable to humans and / or animals.
[0157] As used herein, the term "pharmaceuticalally acceptable" refers to a substance suitable for human and / or mammalian use without excessive adverse side effects (such as toxicity, irritation, and allergic reactions), i.e., a reasonable benefit / risk ratio. The term "pharmaceuticalally acceptable carrier" refers to a carrier used for the administration of a therapeutic agent, including various excipients and diluents.
[0158] The pharmaceutical compositions of the present invention contain a safe and effective amount of the active ingredient of the present invention and a pharmaceutically acceptable carrier.
[0159] In this invention, the expression vector can be applied directly to the target, or the expression vector can be combined with a pharmaceutically acceptable carrier to form a drug combination for administration.
[0160] Synthesis of antisense oligonucleotides
[0161] 1. Solid-phase synthesis: Oligonucleotides (sequences shown in SEQ ID NO. 1-22) were synthesized on an automated synthesizer using conventional phosphoramide chemistry methods. The 2' MOE monomer and synthetic reagents were obtained from Wuhan Tangzhi Chemical Co., Ltd. Universal CPG was used. The starting solid support is used, and the specific synthesis parameters are as follows:
[0162] step Operation process reagents time 1 Detrimethyl 3% DCA / Toluene (8 mL) 150s 2 Acetonitrile washing Acetonitrile (10 mL) 30s 3 Couplet Activator(1.2mL),Amidite(0.8mL) 180s 4 Couplet Activator(0.6mL),Amidite(0.4mL) 180s 5 Couplet Activator(0.6mL),Amidite(0.4mL) 180s 6 Acetonitrile washing Acetonitrile (3.5 mL) 6s 7 vulcanization 0.2M XH (3.5mL) 210s 8 Acetonitrile washing Acetonitrile (5.5 mL) 8s 9 Add a hat CAP A + CAP B (1.5mL + 1.5mL) 80s 11 Acetonitrile washing Acetonitrile (3.5 mL) 6s
[0163] After the solid-phase synthesis was terminated, the de-Fmoc protecting group was removed by treating with an acetonitrile solution containing 20% diethylamine for 10 minutes. The crude compound containing the CPG support was then subjected to ammonolysis with concentrated ammonia (55°C, 16 h) to remove the support and protecting groups on the bases. After filtration, a solution containing the product (modified oligonucleotide) was obtained.
[0164] 2. Purification and Characterization of Oligonucleotides: The resulting solutions containing the products were purified by HPLC using a NanoQ anion exchange column (Macherey-Nagel). The separation method was as follows: (Column: NanoQ 15L; Wavelength: 260 nm; Solvent: A = 20 mM sodium hydroxide solution, B = 20 mM sodium hydroxide solution + 3 M sodium chloride; Gradient: 0–60% B for 20 CV). All samples were characterized by ESI mass spectrometry on a Thermo Fisher Q-Exactive.
[0165] The prepared oligonucleotides were desalted by ultrafiltration using a 3.5kD Vivacon membrane (Sartorius), and the samples were then vacuum centrifuged to obtain the target oligonucleotide samples (as shown in Table 1). All oligonucleotide samples were lyophilized and stored at -20°C.
[0166] Example 1: PCR detection of ASO exon skipping activity
[0167] HEK293 Nav1.8 high-expression monoclonal cells (with endogenous Nav1.8 protein expression enhanced using Crispra technology; cell construction method reference: Nat. Methods. issue 4, vol 12, 326-328 (2015)) were cultured in 12-well plates containing 1 mL of DMEM medium (gibco, catalog number: C11995500BT). The cells were treated with 0 nM (negative control) and 100 nM of the target oligonucleotide sample (modified oligonucleotides as shown in Table 1). After incubation with the target oligonucleotide sample (modified oligonucleotides as shown in Table 1) for 24 h, total RNA was extracted using the "Tissue RNA Extraction Kit 2.0 Plus" (Novizan, catalog number R411-C3) according to the manufacturer's instructions. Then, using the "AccurSTART U+One Step RT-qPCR Probe Kit (Glycerol-free)" (Novazia, catalog number QL227-01) kit with exon-specific primers, 200 ng of RNA template was subjected to a one-step PCR in a 20 μL system.
[0168] The primer information is as follows: Exon 6_forward: (5'→3')GCAACTCTTCAAGGGCAACC (SEQ ID NO.23); Exon 10_reverse: (5'→3')TGTTGTCTTCTGTGGAGCCC (SEQ ID NO.24). The PCR reaction cycling conditions were as follows: 50℃ for 15 min and 95℃ for 30 s, followed by 35 cycles of 95℃ for 10 s, 55℃ for 30 s, and 60℃ for 30 s. After diluting the first-round PCR product 100-fold, a second-round nested PCR amplification reaction was performed using 1 μL of 2×Taq Master Mix (Dye Plus) high-purity thermostable DNA polymerase (Novizan, catalog number P112-01) with 20 μL of the diluted product.
[0169] The primer information for the amplification reaction is as follows: Exon 6_forward: (5'→3')GCAACTCTTCAAGGGCAACC (SEQ ID NO.23); and Exon 9_reverse: (5'→3')GGGCCTCCTGGAACTTCTTC (SEQ ID NO.25). The nested PCR amplification reaction cycling conditions were as follows: 95℃ for 3 min, followed by 35 cycles of 95℃ for 15 s, 55℃ for 15 s, and 72℃ for 45 s, with a final cycle of 72℃ for 5 min. The PCR products were then subjected to agarose gel electrophoresis on a 1.5% agarose gel to separate the target bands. The target size bands were collected and analyzed using Sanger sequencing.
[0170] The sequencing results of the representative sequence (the modified sequence corresponding to SEQ ID NO.17, moemeCs moemeCs moeTs moemeCsmoeGs moemeCs moeTs moeTs moeAs moeTs moeTs moeTs moeAs moeGs moeTsmoeAs moeGs moeTsmoeAs moeT)(ASO10) are as follows: Figure 1 As shown, Sanger sequencing confirmed that the negative control (cells without the modified oligonucleotides shown in Table 1) PCR product bands expressed exon 7, while after treatment with the "modified oligonucleotides shown in Table 1", exon 7 was completely skipped. Figure 1 This means that the exon-jugating PCR product is exon 7 skipping.
[0171] The results of the antisense oligonucleotide modified sequences for skipping exon 7 activity at a concentration of 100 nM are shown in Table 2:
[0172] Table 2
[0173]
[0174]
[0175] Note: In Table 2, √ indicates that the corresponding antisense oligonucleotide has the activity of skipping exon 7 at a concentration of 100 nM; × indicates that the corresponding antisense oligonucleotide does not have the activity of skipping exon 7 at a concentration of 100 nM.
[0176] This indicates that, at a concentration of 100 nM, all ASO1-22 assays exhibited activity in inducing exon 7 skipping in SCN10A pre-mRNA; while ASO23 and ASO24 did not. After exon 7 skipping, the open reading frame of SCN10A undergoes a frameshift, prematurely terminating protein translation. The newly translated mutant protein (as shown in SEQ ID NO. 27) retains only a small portion of the N-terminal domain of the wild-type protein. This mutant protein lacks the transmembrane sodium ion transport function of the wild-type protein, thus blocking the neurotransmission of pain and achieving pain relief.
[0177] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.
[0178] Other relevant sequence information involved in this invention is as follows:
[0179] The base sequence of exon 7 (SEQ ID NO.26):
[0180] CAGATATCTACATAAATAAGCGAGGCACTTCTGACCCCTTACTGTGTGGC
[0181] AATGGATCTGACTCAGG
[0182] The base sequence of the protein expressed after exon 7 skipping (SEQ ID NO).27):ATGGAATTCCCCATTGGATCCCTCGAAACTAACAACTTCCGTCGCTTTACTCCGGAGTCACTGGTGGAGATAGAGAAGCAAATTGCTGCCAAGCAGGGAACAAAGAAAGCCAGAGAGAAGCATAGGGAGCAGAAGGACCAAGAAGAGAAGCCTCGGCCCCAGCTGGACTTGAAAGCCTGCAACCAGCTGCCCAAGTTCTATGGTGAGCTCCCAGCAGAACTGATCGGGGAGCCCCTGGAGGATCTAGATCCGTTCTACAGCACACACCGGACATTTATGGTGCTGAACAAAGGGAGGACCATTTCCCGGTTTAGTGCCACTCGGGCCCTGTGGCTATTCAGTCCTTTCAACCTGATCAGAAGAACGGCCATCAAAGTGTCTGTCCACTCGTGGTTCAGTTTATTTATTACGGTCACTATTTTGGTTAATTGTGTGTGCATGACCCGAACTGACCTTCCAGAGAAAATTGAATATGTCTTCACTGTCATTTACACCTTTGAAGCCTTGATAAAGATACTGGCAAGAGGATTTTGTCTAAATGAGTTCACGTACCTGAGAGATCCTTGGAACTGGCTGGATTTTAGCGTCATTACCCTGGCATATGTTGGCACAGCAATAGATCTCCGTGGGATCTCAGGCCTGCGGACATTCAGAGTTCTTAGAGCATTAAAAACAGTTTCTGTGATCCCAGGCCTGAAGGTCATTGTGGGGGCCCTGATTCACTCAGTGAAGAAACTGGCTGATGTGACCATCCTCACCATCTTCTGCCTAAGTGTTTTTGCCTTGGTGGGGCTGCAACTCTTCAAGGGCAACCTCAAAAATAAATGTGTCAAGAATGACATGGCTGTCAATGAGACAACCAACTACTCATCTCACAGAAAACCCACTGCCCTGATGGTTATATCTGCCTTAAAACTTCTGACAACCCGGATTTTAACTACACCAGCTTTGATTCCTTTGCTTGGGCTTTCCTCTCACTGTTCCGCCTCATGA.
[0183] The base sequence (SEQ ID NO. 28) located in the region between exon 6 and exon 8 of the SCN10A transcript (NM-006514.4) (containing exon 6-intron 6-exon 7-intron 7-exon 8):
[0184] GCCTGAAGGTCATTGTGGGGGCCCTGATTCACTCAGTGAAGAAACTGGCTGATGTGACCATCCTCACCATCTTCTGCCTAAGTGTTTTTGCCTTGGTGGGGCTGCAACTCTTCAAGGGCAACCTCAAAAATAAATGTGTCAAGAATGACATGGCTGTCA ATGAGACAACCAACTACTCATCTCACAGAAAACGTGAGTGGAGTCTCTTCCATAGGGACCAAGGTCTGGTTGGACCCTTGGTATCATATAGGGACAGGGGATATGGAGCCCCTGTGTGTGTGTATAGACATATATTTTGACTCCCCTTCCTGCCAAAA TGGTTCTCTTGAGTTGTGTTTTACTTTTGGGTATTCTATTTCCTGTTGCTCAGCATCCCTCTTGCAAGGAAATGAGCCATAAATCTAGAGGCAAGTCATTCTACCTCTGCTGGGGGAGATTGAGAGCCGAAGTCACTGCTTAGCTCTTCTCTTTTCAGA TGTGACTTTACAACTTCCATGTGGCCCAGCATGCCCACTGAGTACATGTAGCCAAAGGAGCTCACTTTGGAAGACTTGGGAATATTGCATTCACCACACAAGGCTTGGGTTGGAGGGTTCAGAACCATCTGTGAGGCTTCTTTTCTTCCTTTCTTCAG CAGATATCTACATAAATAAGCGAGGCACTTCTGACCCCTTACTGTGTGG CAATGGATCTGACTCAGG
Claims
1. An antisense oligonucleotide that inhibits the expression of the SCN10A gene, characterized in that, The antisense oligonucleotide is an oligonucleotide that specifically binds to exon 7 of the SCN10A gene, and the antisense oligonucleotide inhibits the expression of the SCN10A gene or modifies its expression product by inducing the jumping of exon 7 of the SCN10A premRNA.
2. The antisense oligonucleotide as described in claim 1, characterized in that, The antisense oligonucleotide is complementary to a base fragment of length L nucleotides in exon 7 region of the SCN10A transcript, where L is a positive integer ≥10. Preferably, L ≤ 50, more preferably ≤ 30, and even more preferably ≤ 25; Preferably, L ≥ 12, more preferably ≥ 15, and even more preferably ≥ 17; Ideally, L is 15-25, even better is 17-23, and still better is 18-20.
3. The antisense oligonucleotide as described in claim 2, characterized in that, The number of mismatched bases in the complementary matching is ≤3; preferably ≤2; preferably ≤1; more preferably 0 (i.e., perfectly complementary matching); Preferably, the mismatched base is not located at the 5' end or the 3' end; Preferably, the distance between the mismatched base and the 5' end is ≥2nt, and the distance between the mismatched base and the 3' end is ≥2nt; Preferably, the mismatched base is located in a region 1-5 nt above and below the central base of the antisense oligonucleotide sequence, more preferably 1-4 nt; even more preferably 1-2 nt.
4. The antisense oligonucleotide as described in claim 1, characterized in that, Each nucleotide in the antisense oligonucleotide is independently either modified or unmodified. Preferably, the modified nucleotide is selected from: 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxynucleotides, 2'-deoxy-2'-fluoro modified nucleotides, 2'-methoxyethyl modified nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, 2'-alkoxy modified nucleotides, phosphate thioester modified nucleotides, debased nucleotides, morpholinonucleotides, locked nucleic acids, methylcytosine, or combinations thereof; Preferably, the modified nucleotide is selected from: nucleotides modified with 2'-O-methyl, locked nucleic acids, nucleotides modified with methylcytosine, nucleotides modified with thiophosphate, or combinations thereof.
5. The antisense oligonucleotide as described in claim 1, characterized in that, The nucleotide sequence of the antisense oligonucleotide is selected from any of the sequences shown in SEQ ID NO.1-20 or their respective corresponding modified sequences; Preferably, the nucleotide sequence of the antisense oligonucleotide is selected from any one of the sequences shown in SEQ ID NO.1-9, SEQ ID NO.14-17 or SEQ ID NO.19-20.
6. The antisense oligonucleotide as described in claim 1, characterized in that, The antisense oligonucleotide comprises a nucleotide having more than 80% (preferably, more than 85%, more preferably, more than 90%, more preferably, more than 95%, more preferably, 98% or more than 99%) homology to SEQ ID NO. 1-20.
7. The antisense oligonucleotide as described in claim 1, characterized in that, The antisense oligonucleotides are coupled with functionalized modifying groups; Preferably, the functionalized modifying groups are selected from the group consisting of molecules that enhance cell membrane permeability; Preferably, the molecules that enhance cell membrane permeability are selected from the group consisting of cholesterol, tocopherol, fatty acids, or combinations thereof; Preferably, in the antisense oligonucleotide, the nucleotide is linked to a phosphodiester bond to a molecule that enhances cell membrane permeability.
8. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises: (a) the antisense oligonucleotide according to any one of claims 1-7; and (b) Pharmaceutically acceptable carriers.
9. The use of the antisense oligonucleotide of claim 1 or the pharmaceutical composition of claim 8, characterized in that, Used for: Preparation of drugs that inhibit and / or reduce the expression of the SCN10A gene in vivo or in vitro; and / or, Preparation of drugs that induce exon 7 skipping in SCN10A pre-mRNA; and / or, Prepare medicines for the prevention and / or treatment of pain-related diseases.
10. The use as described in claim 9, characterized in that, The pain-related diseases mentioned are selected from the following groups: acute pain, chronic pain, inflammatory pain, cancer pain, neuropathic pain, musculoskeletal pain, intestinal pain, postoperative pain, visceral pain, multiple sclerosis, Sharma-Tutan syndrome, incontinence, pathological cough, or arrhythmia. Preferably, the inflammatory pain includes rheumatoid arthritis pain; Preferably, the neuropathic pain includes postherpetic neuralgia, diabetic neuropathic pain, painful HIV-associated sensory neuropathy, trigeminal neuralgia, burning mouth syndrome, post-amputation pain, phantom pain, painful neuroma, traumatic neuroma, Morton's neuroma, nerve compression injury, spinal stenosis, carpal tunnel syndrome, radicular pain, sciatica, nerve avulsion injury, brachial plexus avulsion injury, complex regional pain syndrome, drug-induced neuropathic pain, cancer chemotherapy-induced neuropathic pain, antiretroviral therapy-induced neuropathic pain, post-spinal cord injury pain, idiopathic small fiber neuropathy, idiopathic sensory neuropathy, or trigeminal autonomic headache; Preferably, the musculoskeletal pain includes osteoarthritis pain, back pain, cold pain, burn pain, or toothache; Preferably, the intestinal pain includes pain from inflammatory bowel disease, Crohn's disease, or interstitial cystitis.