Bacillus subtilis genetic engineering strain with high yield of starch branching enzyme as well as construction method and application of bacillus subtilis genetic engineering strain

Abstract

The invention discloses a bacillus subtilis genetic engineering strain for high yield of starch branching enzyme (1, 4-alpha-glycan branching enzyme (GBE)), and a construction method and application of the bacillus subtilis genetic engineering strain. According to the bacterial strain, bacillus subtilis DB403 (B.subtilis DB403) is used as an original host, and an optimized host bacterial strain is obtained by knocking out an upp gene, an alpha-amylase gene amyA, an autolysis key gene sigD and the like; the method comprises the following steps: screening a combination of a bacillus subtilis high-copy vector and a strong promoter through a system to obtain an optimized recombinant expression plasmid; and introducing the expression plasmid into the host strain to construct the engineering strain. The GBE intracellular enzyme activity of the strain reaches 18104.32 U / mL and is improved by 64.58% compared with that of an original system, and the strain has wide application prospects in the fields of starch modification and functional food development.

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and microbial fermentation technology, and relates to a Bacillus subtilis genetically engineered strain that produces high levels of 1,4-α-glucan branching enzyme (GBE), its construction method, and its application. Specifically, it relates to a Bacillus subtilis engineered strain that synergistically enhances GBE expression levels by systematically screening expression vectors and knocking out specific host genes. Background Technology

[0002] Starch branching enzyme, also known as 1,4-α-glucan branching enzyme (GBE, EC2.4.1.18), catalyzes the branching of starch molecules into α-1,6 glycosidic bonds and is a key enzyme for modifying the physicochemical properties of starch (such as anti-aging properties and freeze-thaw stability). GBE derived from hyperthermophilic bacteria (such as Aquifex aeolicus VF5) has potential for industrial applications due to its good thermal stability.

[0003] Bacillus subtilis is a safe expression host, but it faces two major bottlenecks in the efficient expression of heterologous GBE: 1) The host's own secreted α-amylase (mainly encoded by the amyA gene) degrades the reaction substrate starch, which seriously interferes with the enzyme activity assay and application effect of GBE; 2) In the middle and late stages of fermentation, the cell autolysis system regulated by genes such as lytC, lytD, and sigD is activated, which leads to a decrease in cell biomass and degradation of the target protein, thus limiting the yield.

[0004] While existing technologies have attempted to express GBE in Bacillus subtilis, they generally suffer from problems such as strong background interference, short fermentation cycles, and unstable yields. No comprehensive strategy has been reported that systematically knocks out the amyA gene to eliminate background interference, combined with screening for and knocking out key autolysis-related genes to enhance cell stability and protein accumulation, thereby significantly increasing GBE yield. Therefore, developing a genetically engineered strain capable of stably and efficiently expressing GBE in Bacillus subtilis, with easily purified products and minimal background interference, along with its supporting processes, is of great significance for promoting the large-scale application of GBE. Summary of the Invention

[0005] To address the technical problems of strong host background interference, short fermentation cycle, low and unstable yield in existing Bacillus subtilis GBE expression technologies, this invention provides a high-yield amylopectin-branching enzyme-producing Bacillus subtilis genetically engineered strain, its construction method, and its applications. This strain construction strategy has also been shown to universally enhance the expression levels of other glycosyltransferases.

[0006] This invention is the first to propose and validate a strategy combining multi-dimensional optimization of the host chassis with systematic screening of expression elements in Bacillus subtilis to achieve efficient expression of glycoside transferases such as amylase branching enzyme (GBE). The innovation of this concept lies in: clarifying that eliminating background interference from host α-amylase (knockout of amyA) is a necessary prerequisite for accurately evaluating and improving the activity of target glycoside transferases in starch substrate systems; recognizing that simply increasing expression intensity may exacerbate cellular metabolic load and induce premature autolysis, therefore, it is essential to simultaneously enhance host cell stability; experimentally, it was found that among numerous autolysis-related genes, knockout of the transcriptional regulator sigD has the most significant effect on prolonging the fermentation cycle, increasing biomass, and the accumulation of target proteins, providing a new theoretical basis for target selection; and for the first time, matching and screening multi-gene knockout hosts with multi-vector / promoter combinations yielded an optimized "host-vector" expression system, producing a significant synergistic effect.

[0007] In implementing the above concept, this invention mainly overcomes the following technical difficulties: achieving continuous and precise knockout of multiple genes (upp, amyA, sigD, etc.) in Bacillus subtilis, while ensuring the efficiency of gene manipulation and the stability of the genome; rapidly and accurately identifying the key genes that have the greatest impact on the yield of the target protein from a large number of autolysis-related genes; and screening out the combination of various vectors and promoters that best matches the optimized host chassis and has the highest expression efficiency.

[0008] This invention provides a genetically engineered Bacillus subtilis strain that produces high levels of starch branching enzyme (GBE), the strain comprising a host strain and a recombinant expression plasmid, etc.

[0009] The host strain was prepared by knocking out one or more of the following genes: Bacillus subtilis DB403 as the original host: upp gene, α-amylase gene amyA, autolysis-related gene, etc.

[0010] The recombinant expression plasmid includes a vector and a promoter, etc.; wherein the vector includes one or more of pWB980-ori, pHTN07, etc., and the promoter includes one or more of P43, Pspovg, Pbc, Pgrac, etc.

[0011] In one specific embodiment, the present invention provides a genetically engineered Bacillus subtilis strain that produces high levels of branched amylase (GBE). The strain is obtained by multi-step systematic modification using Bacillus subtilis DB403 as the original host: (1) Host chassis optimization: Using Bacillus subtilis DB403 as the starting strain, the upp gene was first knocked out as a subsequent screening marker to obtain strain DU02. Based on DU02, the α-amylase gene amyA was knocked out to obtain strain AU01, in order to eliminate the interference of host amylase on the functional determination of GBE using starch as a substrate. On this basis, multiple autolysis-related genes (including lytC, lytD, lytE, lytF, lytG, lytH, cwlC, cwlS and their transcriptional regulator sigD) were further systematically knocked out, and the performance of each knockout strain in terms of biomass, fermentation stability and intracellular GBE accumulation was comprehensively evaluated through parallel fermentation experiments. Comparative analysis revealed that among the nine autolysis-related genes, knocking out the transcriptional regulator sigD had the most significant effect on increasing the intracellular accumulation of GBE, and was the only gene target that could simultaneously delay cell autolysis, improve fermentation stability, and significantly increase the maximum enzyme activity of GBE. Although knocking out some other genes (such as lytC) could also increase biomass or affect the trend of enzyme activity changes in the later stage of fermentation to a certain extent, their effect on increasing the maximum enzyme activity of GBE was not as good as that of the sigD knockout strain. Therefore, this invention ultimately chose to knock out the sigD gene to obtain the optimized host strain AS03 (DB403Δupp ΔamyA ΔsigD). (2) Screening and optimization of recombinant expression plasmids: This invention constructed a total of 8 recombinant expression plasmids (i.e., pairwise combinations of vectors and promoters) containing two commonly used Bacillus subtilis vectors (pWB980-ori, pHTN07) and 4 different promoters (P43, Pspovg, Pbc, Pgrac). The GBE-encoding gene from Aquifex aeolicus VF5 was inserted downstream of the promoters of the aforementioned plasmids. All eight recombinant expression plasmids successfully expressed GBE in Bacillus subtilis AU01 (DB403Δupp ΔamyA), and the combinations with the highest to lowest GBE expression activity were: pWB980-ori / P43-GBE, pHTN07 / Pspovg-GBE, pHTN07 / P43-GBE, pWB980-ori / Pspovg-GBE, pHTN07 / Pgrac-GBE, pWB980-ori / Pgrac-GBE, pWB980-ori / Pbc-GBE, and pHTN07 / Pbc-GBE. The combination with the highest expression efficiency (recombinant expression plasmid) was finally selected as pWB980-ori / P43-GBE.The optimal recombinant expression plasmid pWB980-ori / P43-GBE was introduced into the optimized host strain AS03 to obtain the preferred high-GBE-producing Bacillus subtilis genetically engineered strain, named AS03(pWB980-ori / P43-GBE).

[0012] In one specific embodiment, the present invention also provides an engineered strain that highly expresses amyloid branching enzyme (GBE), wherein the host AS03 of the strain is obtained by knocking out the amyA and sigD genes of Bacillus subtilis DB403, and contains the recombinant expression vector pWB980-ori / P43-GBE, which can express active amyloid branching enzyme.

[0013] The present invention also provides a method for constructing the genetically engineered Bacillus subtilis strain as described above, the method comprising:

[0014] The host strain and the recombinant expression plasmid described above were constructed respectively, and then the recombinant expression plasmid was introduced into the host strain to construct the Bacillus subtilis genetically engineered strain.

[0015] In one specific embodiment, the present invention also provides a method for constructing the genetically engineered strain, comprising the following steps:

[0016] (1) Construction of host strain AS03:

[0017] a. Using the DB403 genome as a template, the upp gene was knocked out using homologous recombination technology to obtain the basic host DU02.

[0018] b. Using DU02 as the host, the amyA gene was systematically knocked out using the temperature-sensitive plasmid pKSV7 and the upp anti-selection marker. Specifically, the knockout plasmid pKSV7-ΔamyA-upp (constructing an amyA knockout plasmid with upp as the anti-selection marker) was constructed, transformed into DU02, and the amyA knockout strain AU01 was obtained through temperature conversion and 5-fluorouracil (5-FU) resistance selection.

[0019] c. Using the same strategy as in step b, strains with the knockout of nine autolysis-related genes (lytC, lytD, lytE, lytF, lytG, lytH, cwlC, cwlS, sigD) were constructed and screened sequentially in AU01. By comparing the intracellular GBE enzyme activities of the engineered strains carrying the pWB980-ori / P43-GBE plasmid, the strain with the sigD gene knocked out (AS03) was determined to be the optimal host.

[0020] (2) Construction and screening of expression plasmid libraries:

[0021] a. Using pWB980-ori and pHTN07 plasmids as backbones, four promoters, P43, Pspovg, Pbc, and Pgrac, were constructed into the multiple cloning site of the vector through homologous recombination.

[0022] b. The GBE encoding gene (as shown in SEQ ID NO: 1) was cloned downstream of the promoters of the above 8 vectors to construct 8 recombinant expression plasmids.

[0023] c. These eight plasmids were transformed into the host strain AU01, and parallel fermentation was performed, with intracellular GBE enzyme activity measured. The enzyme activity assay results showed that the strain carrying the pWB980-ori / P43-GBE plasmid had the highest enzyme activity, therefore this plasmid was selected as the optimal expression unit.

[0024] (3) Obtaining high-yield engineered strains:

[0025] The verified recombinant plasmid pWB980-ori / P43-GBE was transformed into competent cells of the host strain AS03. The target engineered strain AS03 (pWB980-ori / P43-GBE) was obtained through resistance selection and plasmid verification.

[0026] The present invention also provides a method for producing starch branching enzyme, the method comprising: fermenting the above-mentioned Bacillus subtilis genetically engineered strain (recombinant Bacillus subtilis engineered strain), collecting the cell bodies, dissolving them, and obtaining the starch branching enzyme.

[0027] The fermentation time is 12-156 hours; preferably 36 hours.

[0028] The centrifugation conditions for collecting bacterial cells include: centrifugation at 8000-12000 r / min for 10-20 min;

[0029] The dissolved reagents include Arg, etc.

[0030] The present invention also provides a fermentation method for producing GBE using the genetically engineered strain described above.

[0031] In one specific embodiment, the fermentation production method includes:

[0032] a. Seed culture: Take 20 μL of AS03 (pWB980-ori / P43-GBE) engineered strain culture from a glycerol tube and inoculate it into 10 mL of LB medium (conventional bacterial medium) containing kanamycin (50 μg / mL). Incubate at 37℃ and 200~220 rpm for 12 hours with shaking.

[0033] b. Fermentation culture: 600 μL of the above seed culture was inoculated into 30 mL of TB fermentation medium (conventional Bacillus fermentation medium) containing kanamycin (50 μg / mL), and cultured at 37℃ with shaking at 200 rpm. Samples were taken for analysis at 12h, 24h, 36h, 48h, 60h, 84h, 108h, and 156h.

[0034] c. Cell collection and processing: Take 1 mL of fermentation broth and centrifuge at 12000 r / min for 10 min to obtain cell precipitate. Resuspend the precipitate in 1 mL of 0.1 M L-arginine (Arg) solution.

[0035] d. Preparation of intracellular enzyme solution: The bacterial cell suspension was sonicated in an ultrasonic homogenizer for 5 minutes on ice. After homogenization, the suspension was centrifuged at 12000 rpm for 10 minutes, and the supernatant was collected as the crude intracellular enzyme solution. This enzyme solution can be used directly for enzyme activity assay or further purification. Resuspension with 0.1M Arg solution and subsequent homogenization helps maintain the activity and stability of GBE.

[0036] e. GBE enzyme activity assay: In a 2 mL EP tube, add 45 μL of ultrapure water and 50 μL of 0.4% (w / v) potato starch solution (dissolved in 50 mM sodium acetate buffer, pH 8.0), mix, and preheat at 80℃ for 2.5 minutes to obtain the substrate system. Dilute the intracellular crude enzyme solution 10-fold with ultrapure water. Take 5 μL of the diluted enzyme solution and add it to the preheated 95 μL substrate system, mix quickly, and react precisely at 80℃ for 7 minutes. After the reaction, immediately add 2 mL of iodine colorimetric solution (0.02% I2, 0.2% KI) to terminate the reaction and develop color. Take 200 μL of the colorimetric reaction solution into a 96-well plate and measure the absorbance (OD) at 660 nm using a microplate reader. 660 Enzyme activity calculation: Enzyme activity is calculated as the decrease in absorbance of the reaction system (relative to the blank control without enzyme solution). One unit of enzyme activity (U) can be defined as the amount of OD that the substrate catalyzes per minute under the above assay conditions. 660 The amount of enzyme required to decrease by 0.001. Final enzyme activity is expressed as units (U / mL) per milliliter of fermentation stock.

[0037] In one specific embodiment, the method includes the following steps: fermenting the Bacillus subtilis genetically engineered strain as described above in TB medium for 36 h, centrifuging at 12000 r / min for 10 min, transferring the bacterial cells to 0.1 M Arg for disruption, centrifuging at 12000 r / min for 10 min, and obtaining the supernatant, which is a large amount of amylase.

[0038] In the method described, the 0.1M Arg solution can create an alkaline environment to promote the autonomous dissolution of inclusion bodies, which is beneficial for the transformation of starch branching enzyme into a soluble form with the correct folding conformation.

[0039] In the method described, the intracellular soluble GBE can be effectively released by transferring the bacterial cells to a 0.1M Arg solution and then lysing the cells for 5 minutes.

[0040] The present invention also provides a primer, the nucleotide sequence of which includes one or more of the nucleotide sequences shown in SEQ ID NO: 17-122.

[0041] The present invention also provides a primer pair, wherein the nucleotide sequence of the primer pair includes one or more of the nucleotide sequences shown in SEQ ID NO: 17-122.

[0042] The present invention also provides a plasmid, the plasmid including one or more of pWB980-ori / P43-GBE, pHTN07 / Pspovg-GBE, pHTN07 / P43-GBE, pWB980-ori / Pspovg-GBE, pHTN07 / Pgrac-GBE, pWB980-ori / Pgrac-GBE, pWB980-ori / Pbc-GBE, pHTN07 / Pbc-GBE, etc.

[0043] This invention also provides the application of the Bacillus subtilis genetically engineered strains, methods, primers, primer pairs, and plasmids described above in high-yield starch branching enzymes, preparation of Bacillus subtilis genetically engineered strains with high starch branching enzyme production, low-cost / stable / high-efficiency production of GBE enzyme preparations, starch modification and functional food development, large-scale application of GBE, development of genetically engineered strains with easily purified products and low background interference, and their supporting processes.

[0044] In one specific embodiment of the present invention, the carrier includes one or more of pWB980-ori, pHTN07, etc., and the promoter includes one or more of P43, Pspovg, Pbc, Pgrac, etc.

[0045] In one specific embodiment of the present invention, the knockout of amyA eliminates the influence of non-target amylases in the GBE-modified starch process; the knockout of sigD delays the autolysis process of the host bacteria, increases cell biomass, and increases GBE expression.

[0046] In one specific embodiment of the present invention, the knockout of the amyA and sigD genes is achieved by using the upp gene as a reverse selection marker through homologous recombination technology.

[0047] In one specific embodiment of the present invention, the original vector pWB980-ori is a high-copy Bacillus subtilis expression vector.

[0048] In one specific embodiment of this invention, the gene encoding the starch branching enzyme is derived from the hyperthermophilic bacterium VF5 (Aquifex aeolicus VF5). The nucleotide sequence of the gene encoding GBE is shown in SEQ ID NO: 1; the nucleotide sequence of the P43 promoter is shown in SEQ ID NO: 2; the nucleotide sequence of the Pspovg promoter is shown in SEQ ID NO: 3; the nucleotide sequence of the Pgrac promoter is shown in SEQ ID NO: 4; the nucleotide sequence of the Pbc promoter is shown in SEQ ID NO: 5; the nucleotide sequence of the upp is shown in SEQ ID NO: 6; the nucleotide sequence of the amyA is shown in SEQ ID NO: 7; the nucleotide sequence of lytC is shown in SEQ ID NO: 8; the nucleotide sequence of lytD is shown in SEQ ID NO: 9; the nucleotide sequence of lytE is shown in SEQ ID NO: 10; the nucleotide sequence of lytF is shown in SEQ ID NO: 11; the nucleotide sequence of lytG is shown in SEQ ID NO: 12; and the nucleotide sequence of lytH is shown in SEQ ID NO: 1. As shown in NO: 13, the nucleotide sequence of cwlC is shown in SEQ ID NO: 14, the nucleotide sequence of cwlS is shown in SEQ ID NO: 15, and the nucleotide sequence of sigD is shown in SEQ ID NO: 16.

[0049] In one specific embodiment of the present invention, the nucleotide sequence described above further includes a nucleotide sequence having at least 85% sequence identity with the nucleotide sequence; or a nucleic acid sequence having the same function as the nucleotide sequence formed by substitution, deletion or addition of one or more nucleic acid bases; or a nucleotide sequence that hybridizes with the nucleotide sequence or its full-length complement under stringent conditions; or a nucleotide sequence that is distinct from the nucleotide sequence due to the degeneracy of the genetic codon.

[0050] Compared with existing technologies, this invention has at least the following beneficial effects: The synergistic effect of dual gene knockout is clearly defined: knocking out amyA fundamentally eliminates background amylase interference, ensuring the accuracy of target enzyme activity assays and the authenticity of application effects; knocking out sigD effectively delays cell autolysis, significantly increasing biomass and the accumulation window of the target protein in the later stages of fermentation. The combination of these two methods solves the core problems of background interference and unstable yield. Systematic screening ensures optimal solution: This invention is not based on empirical selection, but rather on systematic screening through the construction of autolysis gene knockout libraries and expression plasmid libraries, thereby accurately identifying sigD as the most critical autolysis regulatory target and pWB980-ori / P43 as the optimal expression element, ensuring the scientific rigor and efficiency of the technical solution. Innovative process details: The fermentation and enzyme activity assay processes are described in detail, especially the use of 0.1M Arg solution to treat the cells and optimized ultrasonic disruption conditions, which ensure improved GBE activity recovery rate and detection accuracy, resulting in strong reproducibility. Significantly Improved Technical Efficacy: Data from the examples show that the final constructed engineered strain AS03 (pWB980-ori / P43-GBE) achieved an intracellular GBE enzyme activity of 18104.32 U / mL, a 64.58% increase compared to the original control strain, demonstrating a remarkably significant improvement. Strong Applicability and Broad Application Prospects: The construction strategy of this strain has been preliminarily verified to also be applicable to increasing the expression levels of other glycosyltransferases (such as 4-α-glycosyltransferase and maltotriose transferase), indicating its potential as a universal high-yield glycosyltransferase Bacillus subtilis chassis cell. It has significant industrial application value in starch modification, functional foods, and glycoengineering. Attached Figure Description

[0051] Figure 1 Electrophoresis images of PCR verification for key steps in the host strain construction process. A: Upp gene knockout verification (DU02); B: AmyA gene knockout verification (AU01); C: sigD gene knockout verification (AS03).

[0052] Figure 2 Comparison of intracellular enzyme activity of GBE expressed by eight different expression plasmids in host AS03 (sampled at 36h of fermentation).

[0053] Figure 3 Figure: Effect of Bacillus subtilis amyA gene knockout on host basal amylase expression.

[0054] Figure 4 Comparative figure showing the effects of knocking out different autolysis-related genes on intracellular enzyme activity of GBE.

[0055] Figure 5 Effect of knocking out different autolysis-related genes on dry weight during fermentation.

[0056] Figure 6 Knocking out different autolysis-related genes affects biomass (OD) during fermentation. 600 Impact diagram. Detailed Implementation

[0057] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available; and unless otherwise specified, the experimental methods are conventional methods in the art.

[0058] This invention discloses a genetically engineered Bacillus subtilis strain producing high levels of 1,4-α-glucan branching enzyme (GBE) and its construction method. First, using Bacillus subtilis DB403 as the initial strain, the upp gene was knocked out to obtain strain DU02, and the α-amylase gene amyA was knocked out to obtain strain AU01, eliminating its influence in the GBE-modified starch process. Based on this, the autolysis-related gene sigD was knocked out to obtain strain AS03, increasing cell biomass and GBE expression. Simultaneously, the starch branching enzyme gene was inserted into the high-copy plasmid pWB980-ori. The successfully constructed pWB980-ori / P43-GBE plasmid was introduced into AS03, achieving high GBE expression. After fermentation, the intracellular enzyme activity of this engineered strain reached 18104.32 U / mL, an increase of 64.58% compared to the original expression system. The engineered strain constructed in this invention can be used to produce GBE enzyme preparations at low cost and high efficiency, and has important application value in the fields of starch modification and functional food development.

[0059] This invention discloses a genetically engineered Bacillus subtilis strain producing high levels of 1,4-α-glucan branching enzyme (GBE), its construction method, and its applications. The strain uses Bacillus subtilis DB403 as the initial host. By knocking out the α-amylase gene amyA to eliminate substrate background interference and knocking out the key autolysis gene sigD to significantly delay cell autolysis in the mid-to-late stages of fermentation and increase biomass, the optimized host AS03 (DB403Δupp ΔamyA ΔsigD) was obtained. Simultaneously, through systematic screening of high-copy vectors and strong promoter combinations for Bacillus subtilis, pWB980-ori / P43 was identified as the optimal recombinant expression plasmid. This recombinant expression plasmid was introduced into AS03 to construct the engineered strain AS03 (pWB980-ori / P43-GBE). Fermentation experiments showed that the intracellular enzyme activity of this strain GBE reached 18104.32 U / mL, an increase of 64.58% compared to the original system. The construction strategy of this strain is universal and also applicable to the efficient expression of other glycosyltransferases (such as 4-α-glycosyltransferase and maltotriose transferase), showing broad application prospects in the fields of starch modification and functional food development.

[0060] In this embodiment of the invention, the gene encoding the starch branching enzyme is derived from the hyperthermophilic bacterium VF5 (Aquifexaeolicus VF5). The nucleotide sequence of the gene encoding GBE is shown in SEQ ID NO: 1; the nucleotide sequence of the P43 promoter is shown in SEQ ID NO: 2; the nucleotide sequence of the Pspovg promoter is shown in SEQ ID NO: 3; the nucleotide sequence of the Pgrac promoter is shown in SEQ ID NO: 4; the nucleotide sequence of the Pbc promoter is shown in SEQ ID NO: 5; the nucleotide sequence of upp is shown in SEQ ID NO: 6; the nucleotide sequence of amyA is shown in SEQ ID NO: 7; the nucleotide sequence of lytC is shown in SEQ ID NO: 8; the nucleotide sequence of lytD is shown in SEQ ID NO: 9; the nucleotide sequence of lytE is shown in SEQ ID NO: 10; the nucleotide sequence of lytF is shown in SEQ ID NO: 11; the nucleotide sequence of lytG is shown in SEQ ID NO: 12; and the nucleotide sequence of lytH is shown in SEQ ID NO: 11. As shown in NO: 13, the nucleotide sequence of cwlC is shown in SEQ ID NO: 14, the nucleotide sequence of cwlS is shown in SEQ ID NO: 15, and the nucleotide sequence of sigD is shown in SEQ ID NO: 16.

[0061] Example 1: Construction of expression plasmid library

[0062] Using the laboratory-preserved pHT07 plasmid (which introduced the point mutation C2813T into the publicly available commercial plasmid pHT01) as a template, PCR was performed with pHT-F / R as primers to obtain a linearized large fragment of the plasmid. Using GBE-TF / GBE-TR as primers and the synthesized Aquifex aeolicus VF5 GBE gene (SEQ ID NO: 1) as a template, the GBE fragment was obtained by PCR; using P43-TF / P43-TR as primers and pWB980-ori containing the P43 fragment as a template, the P43 fragment was obtained by PCR; using Pspovg-TF / Pspovg-TR as primers and Bacillus subtilis DB403 bacterial culture as a template, the Pspovg fragment was obtained by PCR; using Pgrac-TF / Pgrac-TR as primers and Bacillus subtilis DB403 bacterial culture as a template, the Pgrac fragment was obtained by PCR; using Pbc-TF / Pbc-TR as primers and Bacillus cereus bacterial culture as a template, the Pbc fragment was obtained by PCR. The above four promoters were subjected to overlap PCR with the GBE gene to obtain P43-GBE, Pspovg-GBE, Pgrac-GBE, and Pbc-GBE fragments. The PCR reaction system (50 μL) consisted of: 1 μL template DNA, 1.5 μL each of forward and reverse primers, 25 μL Taq enzyme buffer, and 21 μL ddH2O. The reaction conditions were: 95℃ pre-denaturation for 3 min; 95℃ for 15 s, 55-65℃ (5℃ lower than the primer Tm value) for 15 s, 72℃ for 30 s / kb, for 30 cycles; and 72℃ extension for 5 min. Homologous recombination was used to ligate the above four promoter-gene fragments with the pHT07 linearized fragment to construct recombinant plasmids pHT / P43-GBE, pHT / Pspovg-GBE, pHT / Pbc-GBE, and pHT / Pgrac-GBE.

[0063] Using the pWB980-ori plasmid (a publicly available commercial plasmid) preserved in the laboratory as a template, and pWB-F / R as primers, PCR was performed to obtain the linearized large fragment of pWB980-ori. Using GBE-BF / GBE-BR as primers and the synthesized Aquifexaeolicus VF5 GBE gene (SEQ ID NO: 1) as a template, the GBE fragment was obtained by PCR; using P43-BF / P43-BR as primers and pWB980-ori containing the P43 fragment as a template, the P43 fragment was obtained by PCR; using Pspovg-BF / Pspovg-BR as primers and Bacillus subtilis DB403 bacterial culture as a template, the Pspovg fragment was obtained by PCR; using Pgrac-BF / Pgrac-BR as primers and Bacillus subtilis DB403 bacterial culture as a template, the Pgrac fragment was obtained by PCR; using Pbc-BF / Pbc-BR as primers and Bacillus cereus bacterial culture as a template, the Pbc fragment was obtained by PCR. Four promoters were overlapped with the GBE gene using PCR to obtain P43-GBE, Pspovg-GBE, Pgrac-GBE, and Pbc-GBE fragments. The PCR reaction system and procedure were the same as above. Homologous recombination was used to ligate the four promoter-gene fragments with the linearized pWB980-ori fragment to construct recombinant plasmids pWB980-ori / P43-GBE, pWB980-ori / Pspovg-GBE, pWB980-ori / Pbc-GBE, and pWB980-ori / Pgrac-GBE.

[0064] In this embodiment, the primers mentioned are shown in Table 2 (SEQ ID NO: 17-40).

[0065] Example 2: Screening for optimal expression plasmids

[0066] Preparation of competent cells of Bacillus subtilis and transformation of plasmids: The eight plasmids obtained in Example 1 of this invention were transformed into AU01 (DU02 ΔamyA) to obtain eight engineered strains. The specific methods are as follows: First, Bacillus subtilis preserved in glycerol tubes was streaked and purified on LB agar plates. After incubation at 37°C for 12 hours, single colonies were transferred to Erlenmeyer flasks containing 10 mL of LB liquid medium and amplified for 12 hours on a shaker (37°C, 200 rpm). Subsequently, the activated bacterial solution was transferred to 8 mL of SPI medium (prepared according to the formula in Table 1) at a 2% inoculum for secondary culture, and the cell density was continuously monitored until OD600≈1.0. Mix 200 μL of bacterial suspension with 2 mL of preheated SPII medium (prepared according to Table 1), and incubate at 37°C and 150 rpm for 90 minutes. Then, add 20 μL of EGTA solution (prepared according to Table 1) and continue incubation with shaking for 10 minutes to obtain B. subtilis DB403 competent cells with genetic transformation capability. Aliquot the competent cells into 500 μL tubes for later use. Add 1.0 μg of plasmid to each tube of competent cells, and incubate at 37°C and 200 rpm for 60 minutes with shaking. Then, add 100 μL of preheated LB liquid medium (37°C) and continue incubation for 90 minutes. After incubation, spread 100 μL of the bacterial suspension onto LB agar plates (containing the corresponding antibiotic) and incubate upside down at 37°C for 16 hours.

[0067] Table 1. Preparation of Bacillus subtilis conversion reagent

[0068]

[0069] Fermentation screening: Each engineered strain was fermented according to the following steps: 20 μL of bacterial culture was taken from the glycerol tube and inoculated into 10 mL LB / K 50 Culture medium, incubated at 37℃ and 200 rpm for 12 h. Inoculate 600 μL of seed culture with 30 mL of TB / K solution. 50 Culture medium, 37℃, 200 rpm shaking culture. Each strain was set up in 3 replicates. After 36 h of culture, 1 mL of fermentation broth was taken from each culture, centrifuged at 12000 rpm for 10 min, the precipitate was resuspended in 1 mL of 0.1 M Arg solution, sonicated for 5 min, centrifuged at 12000 rpm for 10 min, and the supernatant was collected as intracellular enzyme solution.

[0070] Enzyme activity assay and results: The activity of each intracellular enzyme solution was detected according to the "GBE enzyme activity assay" method described above. Results are as follows: Figure 2As shown, the engineered strain carrying the pWB980-ori / P43-GBE plasmid had significantly higher intracellular GBE enzyme activity than the other seven combinations, and was therefore identified as the optimal expression plasmid.

[0071] Example 3: Construction of host strain AS03 (DU02 ΔamyA ΔsigD)

[0072] I. Construct DU02 (Δupp):

[0073] (1) Constructing the knockout plasmid:

[0074] a. Using upp-LF / upp-LR primers (as shown in Table 2) and Bacillus subtilis DB403 bacterial culture as a template, the upstream homologous arm (500 bp) of the upp gene was amplified; using upp-RF / upp-RR primers (as shown in Table 2) and Bacillus subtilis genome as a template, the downstream homologous arm (500 bp) of the upp gene was amplified. The upstream and downstream homologous arms of upp were then ligated by overlap PCR.

[0075] b. Linearized plasmid pKSV7 was obtained by double digestion with restriction endonucleases PstI and XbaI, and the large fragment (pKSV7 linearized fragment) was recovered by gel extraction.

[0076] c. Homologous recombination method is used to connect the upstream and downstream homologous arms of upp with the linearized fragment of pKSV7 to construct the recombinant plasmid pKSV7-Δupp.

[0077] d. The recombinant plasmid was transformed into E. coli Top10 using the heat shock method, and colonies grew on Amp antibody plates the next day. PCR was performed using different colonies as templates and upp-LF / upp-RR as primers (as shown in Table 2). The bacteria that produced the target 1050bp band by electrophoresis were the transformants.

[0078] e. Activate the transformant and extract the plasmid from the bacterial culture to obtain the recombinant plasmid.

[0079] (2) Transformation of DB403 with recombinant plasmid:

[0080] Take a single colony of Db403 and place it in 1 mL of LB liquid medium. Incubate overnight (8-10 hours) at 37°C with shaking.

[0081] Transfer 160 μl of bacterial culture to 8 mL of SPⅠ medium and incubate at 37°C with shaking at 200 rpm until the end of the logarithmic growth phase, approximately OD=1 (about 4 h).

[0082] Take 0.2 mL of the above bacterial suspension and add it to 2 mL of pre-warmed SPⅡ medium. Incubate at 37℃ for 90 min.

[0083] Immediately add 20 μL of EGTA solution to 2 mL of competent cells and continue culturing at 37°C for 10 min.

[0084] Take 500 μl of bacterial culture and add it to a preheated 37°C test tube containing 1 μg of DNA (volume not exceeding 2% of the bacterial culture, i.e., not exceeding 10 μl). Incubate at 30°C with shaking at 200 rpm for 1 h.

[0085] Add 100 μl LB and continue incubation at 30°C with shaking for 1.5 h.

[0086] Spread 100-150 μl of bacterial suspension onto LB agar plates containing chloramphenicol (5 μg / mL) and incubate overnight at 30°C.

[0087] Using different colonies grown on the plate as templates and upp-LF / upp-RR as primers (as shown in Table 2), PCR was performed. The bacteria that produced the target 1050bp band by electrophoresis were the transformants.

[0088] (3) Screening for recombinant bacteria:

[0089] DB403 single clones containing recombinant plasmids were selected and passaged in LB liquid medium at 42°C to induce plasmid loss and enrichment of recombinant bacteria.

[0090] Streak the bacterial culture onto a plate containing chloramphenicol (5 μg / mL) and incubate overnight at 42°C.

[0091] Select single clones and perform PCR using different colonies grown on plates as templates, with upp-middle-F / pKSV7-F, upp-middle-F / pKSV7-R, upp-middle-R / pKSV7-F, and upp-middle-R / pKSV7-R as primers (as shown in Table 2). If only one of the four primer sets amplifies a band in the PCR system, then the template is a recombinant bacterium.

[0092] (3) Screening for knockout strains

[0093] The recombinant bacteria were plated on a plate containing 1 mM 5-fluorouracil (5-FU) and colonies resistant to 5-FU were screened.

[0094] Using upp-F+ / upp-R+ primers (as shown in Table 2) and the recombinant bacteria as a template, PCR was performed. The strain that amplified a 306 bp band was identified as the knockout strain DU02. The strain that amplified a 1069 bp band was identified as the non-knockout strain. PCR electrophoresis results are shown below. Figure 1A, where 1-5 are experimental groups (recombinant bacterial culture), 6 is the positive control (knockout plasmid pKSV7-Δupp, used to verify the effectiveness of primers and amplification system), 7 is the negative control (wild-type strain DNA), 8 is the blank control (using water as a template, used to detect system contamination), and M is the DNA molecular weight standard. The results show that 1-5 of the recombinant bacteria are all knockout strains.

[0095] II. Constructing the pKSV7-Pbc-upp plasmid containing the upp repeated selection marker:

[0096] Using Pbc-F / PbcR primers (as shown in Table 2) and the *Bacillus cereus* genome as a template, the Pbc sequence (derived from the cis-regulatory region of *Bacillus cereus* uracil phosphatase) was amplified; using upp-F / upp-R primers (as shown in Table 2) and the *Bacillus subtilis* genome as a template, the upp sequence was amplified; the Pbc-upp sequence was obtained by overlap PCR. Colony PCR was used to screen *E. coli* transformants using Pbc-F / upp-R primers (as shown in Table 2). The remaining steps were the same as those for constructing the knockout plasmid DU02(Δupp) in "Construction of DU02(Δupp)". The recombinant plasmid pKSV7-Pbc-upp was obtained.

[0097] III. Construct AU01 (DU02 ΔamyA)

[0098] (1) Constructing the knockout plasmid:

[0099] Using amyA-LF / amyA-LR primers and Bacillus subtilis genome as template, the upstream homologous arm (500 bp) of the amyA gene was amplified; using amyA-RF / amyA-RR primers and Bacillus subtilis genome as template, the downstream homologous arm (500 bp) of the amyA gene was amplified. The upstream and downstream homologous arms of amyA were then ligated by overlap PCR.

[0100] The linearized plasmid pKSV7 was obtained by double digestion of pKSV7 with restriction endonucleases XbaI and KpnI, and the large fragment was recovered by gel extraction.

[0101] Homologous recombination was used to connect the upstream and downstream homologous arms of amyA with the linearized fragment of pKSV7 to construct the recombinant plasmid pKSV7-ΔamyA-upp.

[0102] The recombinant plasmid pKSV7-ΔamyA-upp was transformed into E. coli Top10 using the heat shock method, and the next day LB / Amp was used. 100 Colonies grew on the resistant plate. PCR was performed using different colonies as templates and amyA-LF / amyA-RR as primers. The bacteria that produced the target 1050bp band by electrophoresis were the transformants.

[0103] The transformant was activated, and the plasmid was extracted from the bacterial culture to obtain the recombinant plasmid pKSV7-ΔamyA-upp.

[0104] (2) Transformation of DU02

[0105] The recombinant plasmid pKSV7-ΔamyA-upp was transformed into Bacillus subtilis, resulting in DU02. Transformants were identified by PCR using different colonies grown on agar plates as templates and amyA-LF / amyA-RR as primers. The bacteria that produced the target 1050bp band by electrophoresis were considered transformants. The remaining steps were the same as in "Construction of DU02 (Δupp)".

[0106] (3) Screening for recombinant bacteria:

[0107] For the identification of recombinant bacteria, PCR was performed using primers amyA-middle-F / pKSV7-F, amyA-middle-F / pKSV7-R, amyA-middle-R / pKSV7-F, and amyA-middle-R / pKSV7-R, with different colonies grown on plates as templates. If only one of the four primer sets amplifies a band in the PCR system, then that template is a recombinant bacteria. The remaining steps are the same as in "Construction of DU02 (Δupp)".

[0108] (4) Screening for knockout strains

[0109] The recombinant bacteria were plated on a plate containing 1 mM 5-fluorouracil (5-FU) and colonies resistant to 5-FU were screened.

[0110] Colonies grown on 5-FU plates were compared on LB plates and LB / cm5 plates. Those that grew on LB plates but not on chloramphenicol plates were considered recombinant bacteria.

[0111] PCR was performed using amyA-F+ / amyA-R+ primers and the recombinant bacteria as a template. The strain that amplified a 1025 bp band was identified as the knockout strain AU01, while the strain that amplified a 3153 bp band was identified as the non-knockout strain. PCR electrophoresis results are shown below. Figure 1 B, where 1-4 are experimental groups (recombinant bacterial culture), 5 is the negative control (wild-type strain DNA), 6 is the positive control (knockout plasmid pKSV7-ΔamyA-upp, used to verify the effectiveness of primers and amplification system), 7 is the blank control (using water as a template, used to detect system contamination), and M is the DNA molecular weight standard. The results show that recombinant bacteria 2-4 are knockout strains.

[0112] IV. Construction of 9 autolysis gene knockout strains:

[0113] Following the strategy used to construct AU01 (DU02 ΔamyA) ("III. Constructing AU01 (DU02 ΔamyA"), nine knockout plasmids targeting lytC, lytD, lytE, lytF, lytG, lytH, cwlC, cwlS, and sigD were constructed. These plasmids were then transformed into AU01 sequentially, resulting in nine different single-gene knockout strains (autolysis gene knockout strains) obtained through the same procedure.

[0114] Example 4: Screening for the optimal autolysis gene knockout strain

[0115] The nine autolysis gene knockout strains obtained in Example 3 of this invention were each transformed into the same GBE expression plasmid (pWB980-ori / P43-GBE) and then subjected to parallel fermentation (under the conditions described in Example 2 of this invention). Samples were taken at 12, 24, 36, 48, 60, 84, 108, and 156 h to measure the OD of the fermentation broth. 600 (Biomass), dry weight, and intracellular GBE enzyme activity. The results showed that the strain with sigD knockout exhibited the highest intracellular enzyme activity after 36 hours of fermentation; therefore, this strain was selected as the final optimized host and named AS03 (i.e., DU02 ΔamyA ΔsigD). PCR electrophoresis results are shown below. Figure 1 C, where 1-4 are experimental groups (recombinant bacterial culture), 5 is the negative control (wild-type strain DNA), 6 is the positive control (knockout plasmid pKSV7-ΔsigD-upp, used to verify the effectiveness of primers and amplification system), 7 is the blank control (using water as a template, used to detect system contamination), and M is the DNA molecular weight standard. The results showed that all five recombinant bacterial strains were knockout strains. The results are as follows... Figure 5 , Figure 6 As shown, the engineered strain AS03 (pWB980-ori / P43-GBE) maintained a higher biomass and exhibited a significant delay in autolysis throughout the fermentation cycle. Its GBE intracellular enzyme activity peaked at 36 hours, reaching a maximum of 18104.32 U / mL. The peak enzyme activity of the control strain DB403 (pWB980-ori / P43-GBE) was increased by 64.58%, fully demonstrating the significant synergistic effect of host gene knockout (ΔamyA ΔsigD).

[0116] In this invention, the sequence information is as follows:

[0117] The nucleotide sequences involved in this invention are represented by SEQ ID NO: 1 to SEQ ID NO: 122, and specifically include:

[0118] SEQ ID NO: 1: GBE gene coding sequence

[0119]

[0120] SEQ ID NO: 2: P43 promoter gene sequence

[0121] TTTGATAGGTGGTATGTTTTCGCTTGAACTTTTAAATACAGCCATTGAACATACGGTTGATTTAATAACTGACAAACATCACCCTCTTGCTAAAGCGGCCAAGGACGCTGCCGCCGGGGCTGTTTGCGTTTTTGCCGTGATTTCGTGTATCATTGGTTTACTTATTTTTTTGCCAAAGCTGTAATGGCTGAAAATTCTTACATTTATTTTACATTTTTAGAAATGGGCGTGAAAAAAAGCGCGCGATTATGTAAAATATAAAGTGATAGCGGTACCAGGAGGGCTGGAAGAA

[0122] SEQ ID NO: 3: Pspovg promoter gene sequence

[0123] TGCGGAAGTAAACGAAGTGTACGGACAATATTTTGACACTCACAAACCGGCGAGATCTTGTGTTGAAGTCGCGAGACTCCCGAAGGATGCGTTAGTCGAGATCGAAGTTATTGCACTGGTGAAATAATAAGAAAAGTGATTCTGGGAGAGCCGGGATCACTTTTTTATTTACCTTATGCCCGAAATGAAAGCTTTATGACCTAATTGTGTAACTATATCCTATTTTTTCAAAAAATATTTTAAAAACGAGCAGGATTTCAGAAAAAATCGTGGAATTGATaCACTAATGCTTTTATATAG

[0124] SEQ ID NO: 4: Pgrac promoter gene sequence

[0125] GCTATTGTAACATAATCGGTACGGGGGTGAAAAAGCTAACGGAAAAGGGAGCGGAAAAGAATGATGTAAGCGTGAAAAATTTTTTATCTTATCACTTGAAATTGGAAGGGAGATTCTTTATTATAAGAATTGTGGAATTGTGAGCGGATAACAATTCCCA

[0126] SEQ ID NO: 5: Pbc promoter gene sequence

[0127] ATTTTTAAAGTATGTATACAAATGATGAATAAATTTTGGCGATATAATGAAGGATACAGCTCCCATAATTGGTAAAGATACTAGATAGATTCATCGTAAAATCATGATTTTGCCAAATTTGCCCTTGAATATTAGTAGCGTTTTCTTTACAATCGTAAATAGTGTAAAAAAGCGTGCAAACGCATGAATATCATCTAAAGGAGAGATTCACATGGGAAAACTGTATGTATTTGATCCTC

[0128] SEQ ID NO: 6: upp gene sequence

[0129] ATGGGAAAGGTTTATGTATTTGATCATCCTTTAATTCAGCACAAGCTGACATATATACGGAATGAAAATACAGGTACGAAGGATTTTAGAGAGTTAGTAGATGAAGTGGCTACACTCATGGCATTTGAAATTACCCGCGATCTTCCTCTGGAAGAAGTGGATATCAATACACCGGTTCAGGCTGCGAAATCGAAAGTCATCTCAGGGAAAAAACTCGGAGTGGTTCCTATCCTCAGAGCAGGATTGGGAATGGTTGACGGCATTTTAAAGCTGATTCCTGCGGCAAAAGTGGGACATGTCGGCCTTTACCGTGATCCAGAAACCTTAAAACCCGTGGAATACTATGTCAAGCTTCCTTCTGATGTGGAAGAGCGTGAATTCATCGTGGTTGACCCGATGCTCGCTACAGGCGGTTCCGCAGTTGAAGCCATTCACAGCCTTAAAAAACGCGGTGCGAAAAATATCCGTTTCATGTGTCTTGTAGCAGCGCCGGAGGGTGTGGAAGAATTGCAGAAGCATCATTCGGACGTTGATATTTACATTGCGGCGCTAGATGAAAAATTAAATGAAAAAGGATATATTGTTCCAGGTCTCGGAGATGCGGGTGACCGCATGTTTGGAACAAAATAA

[0130] SEQ ID NO: 7: amyA gene sequence

[0131]

[0132] SEQ ID NO: 8: lytC gene sequence

[0133]

[0134] SEQ ID NO: 9: lytD gene sequence

[0135]

[0136] SEQ ID NO:10: lytE gene sequence

[0137]

[0138] SEQ ID NO:11: lytF gene sequence

[0139]

[0140] SEQ ID NO:12: lytG gene sequence

[0141] ATGGCCCGTAAAAAACTTAAAAAACGTAAACTCTTGATTTCACTATTTTTCCTTGTATCGATTCCGCTAGCTCTGTTTGTTTTAGCGACAACTTTATCAAAACCGATTGAAATATCCAAAGAAACTGAAGAAATCGATGAACAGCAAGTATTTATAGACAGTCTGTCCGGACATGCCCAAATTTTGTATGAAAAATACCATGTTCTCCCCAGCATCACAATTGCTCAGGCCATTCTCGAATCGGACTGGGGGAACAGTGAACTGGCTGCTAAGGCCAACAACCTTTTTGGCGTAAAAGGGAATTATAAAGGCCATCATGTCACGATGGAAACGGACGAAGTTGAAAAAGGGAAAAGAAAAACCATTCGCGCGAAGTTTCGAAAATACAGCACGTTTTTTGAATCTATGGATGATCACGCCCAATTGTTCGTCCGTGGCACATCGTGGAATAAAAAGAAGTATAAACCGGTGCTTGAGGCAGGGAATTATAAGGAAGCGGCAACCGCCCTGCAAACATCAGGATATGCTACAGACCCTGACTACGCTGACAAAATCAGCGCTATTGTGGAAAAATACGATTTAGATGAGTACGATGAGGTAAATCCATCCCTCAAATCTGTGGATTTAAACGCCTCTATTAAAGACAGTGCCGTTCAAGACGTATGGTCCAAGCCTTCTACTGATGATCGGTCCATAAGGCTTACCTCTGCCCAATCTTACGTCGGCAAAGACATAAAGGTTGTGTCTAAAAAACAGAAAGGCCAGTCTGTATGGTACCAATTCCAAATCAATGATAAACTTATCGGCTGGATTGATGATTCAGCTGTTGAAATAAAGGAGGCAACCTAA

[0142] SEQ ID NO:13: lytH gene sequence

[0143] GTGAAAGTTTTGTTATCCGCTCTTCTTCTCCTTTTGTTTGCATTTGAGCCTTCTGCGTCTGGAAAAAAACTTTCAGATCCAGTGCTGTCGAAACGGATGGAATTATATCATAAAATCGAAGCTGTGACGCAGATCCCTTGGTATGCGCTCGCCGCTGTTGATCAATACGAAGAAAACGTGCGGAGCAACCGGAAAGATCTGCCTGAAAAGGCGGGAATCATCAGCATCTATATACCCGATGATATCTGGAGCGGGCCTGAAAACCCGAATCCGAAAGACGATGCGCCGTTAAGCATTAAAGTGTTTGACGGAATCGGAATGGATGGCGATGGAGACGGGAAAGCCGAGGTCAGCAACGATGAAGATATCTTGTATACGTTCAGCCAATACTTACTGTCGTATGGCACAGATGAAGACAACATCCGGATCGGGCTTTGGAATTATTACCGGCGTGATCAGACAGTGGGGATTATATCTGAATTCATGAAGCTGTTTAAAGCCTACGGCCATATTGATCTGGGCGAGCATGCATTCCCGCTTCCGATCAGAACCGATTACAGCTACCGAAGCACGTGGGGAGATGCCCGCGGCTTCGGTGGAAGGCGGATTCATGAAGGTACGGATATCTTTGCCCATTACGGCCTTCCTGTCAAATCCACATGTTACGGCGTAGTTGAAATGAAGGGCTGGAACCGCTTCGGAGGATGGAGAATCGGCATCAGGGACATTAACAATACGTATCATTATTTTGCCCATCTCAATGGGTTTGCCAAAGGGATTAAAACAGGACAAATCGTTGAGCCTGGCCAAGTGATCGGATCAGTCGGCAGCTCCGGATACGGCCCGCCGGGAACCGCCGGGAAGTTCCCGCCGCATCTGCACTATGGCATGTACAAAGATAACGGAAGAACCGAATGGTCATTTGATCCATACCCGCATTTGAGGGCGTGGGAGCGATATGAATACCAAAAAAAGAAGTAA

[0144] SEQ ID NO:14: cwlC gene sequence

[0145] ATGGTTAAAATTTTTATTGATCCTGGCCATGGCGGGTCTGATCCAGGCGCAACAGGTAATGGCCTTCAGGAGAAAACGTTAACCCTGCAAATCGCTTTAGCCTTACGTACGATATTAACTAATGAATATGAAGGCGTTTCTCTGCTGCTGAGCCGGACAAGCGACCAATATGTCAGCTTAAACGACCGGACAAATGCCGCAAATAACTGGGGAGCAGATTTCTTTTTGTCCATTCACGTTAATTCCGGGGGAGGCACAGGTTTTGAAAGCTATATTTATCCAGATGTAGGAGCCCCGACGACGACTTATCAATCGACAATTCACTCTGAAGTGATACAAGCTGTCGACTTTGCCGATCGCGGCAAAAAAACAGCGAACTTCCACGTCCTAAGGGAGTCGGCAATGCCTGCCCTCTTGACCGAGAACGGCTTCATTGATACCGTTTCCGATGCAAATAAGCTGAAAACGAGCAGTTTTATTCAAAGCTTAGCGAGAGGACATGCAAACGGGCTGGAGCAAGCCTTTAACCTTAAAAAGACTTCCAGCTCAGGGTTATATAAGGTTCAAATCGGCGCATTTAAAGTCAAAGCGAATGCCGACTCGCTCGCAAGTAATGCCGAAGCCAAAGGTTTTGACTCGATTGTCCTTTTAAAGGACGGATTATACAAAGTGCAGATTGGCGCATTTTCATCCAAAGACAATGCAGACACCCTCGCTGCCAGAGCGAAAAATGCCGGCTTTGACGCTATTGTGATCCTAGAATCATAG

[0146] SEQ ID NO:15: cwlS gene sequence

[0147]

[0148] SEQ ID NO:16: sigD gene sequence

[0149] ATGCAATCCTTGAATTATGAAGATCAGGTGCTTTGGACGCGCTGGAAAGAGTGGAAAGATCCTAAAGCCGGTGACGACTTAATGCGCCGTTACATGCCGCTTGTCACATATCATGTAGGCAGAATTTCTGTCGGACTGCCGAAATCAGTGCATAAAGACGATCTTATGAGCCTTGGTATGCTTGGTTTATA TGATGCCCTTGAAAAATTTGACCCCAGCCGGGACTTAAAATTTGATACCTACGCCTCGTTTAGAATTCGGCGGCGCAATCATAGACGGGCTTCGTAAAGAAGATTGGCTGCCCAGAACCTCGCGCGAAAAAACAAAAAAGGTTGAAGCAGCAATTGAAAAGCTTGAACAGCGGTATCTTCGGAATGTATCGC CCGCGGAAATTGCAGAGGAACTCGGAATGACGGTACAGGATTGTCGTGTCAACAATGAATGAAGGTTTTTTTGCAAATCTGCTGTCAATTGATGAAAAGCTCCATGATCAAGATGACGGGGAAAACATTCAAGTCATGATCAGAGATGACAAAAATGTTCCGCCTGAAGAAAAGATTATGAAGGATGAACTG ATTGCACAGCTTGCGGAAAAAATTCACGAACTCTCTGAAAAAGAACAGCTGGTTGTCAGTTTGTTCTACAAAGAGGAGTTGACACTGACAGAAATCGGACAAGTATTAAATCTTTCTACGTCCCGCATATCTCAGATCCATTCAAAGGCATTATTTAAATTAAAGAATCTGCTGGAAAAAGTGATACAATAA

[0150] All primers used in the embodiments of this invention were synthesized by Baishang Biotechnology Co., Ltd., and their sequence information is summarized in Table 2 below.

[0151] Table 2: List of primer sequences used in this invention

[0152]

[0153]

[0154]

[0155]

[0156]

[0157]

[0158] As used in this invention, the terms "comprising" and "including" are open-ended expressions, meaning they include the contents specified in this invention but do not exclude other aspects.

[0159] As used in this invention, the term "and / or" includes any one or more of the related listed items and all combinations thereof.

[0160] As used in this invention, the term "about" when applied to a value indicates that a slight degree of imprecision is permissible in the calculation or measurement of the value (the accuracy of the value by some means; approximately or reasonably close to the value; almost). If, for some reason, the imprecision specified by "about" is not understood in this conventional sense in the art, then "about" as used in this invention at least indicates variation that may be caused by conventional methods of measuring or using such parameters.

[0161] The above description represents the preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

[0162] The scope of protection of this invention is not limited to the above embodiments. Any variations and advantages that can be conceived by those skilled in the art without departing from the spirit and scope of this invention are included in this invention and are protected by the appended claims.

Claims

1. A genetically engineered strain of Bacillus subtilis, characterized in that, The strain includes a host strain and a recombinant expression plasmid; The host strain was prepared by knocking out one or more of the upp gene, α-amylase gene amyA, and autolysis-related genes from Bacillus subtilis DB403 as the original host. The recombinant expression plasmid includes a vector and a promoter.

2. The Bacillus subtilis genetically engineered strain as described in claim 1, characterized in that, The carrier includes one or both of pWB980-ori and pHTN07; and / or, The promoters include one or more of P43, Pspovg, Pbc, and Pgrac.

3. The Bacillus subtilis genetically engineered strain as described in claim 1, characterized in that, The genetically engineered Bacillus subtilis strain includes pWB980-ori / P43-GBE.

4. A method, characterized in that, The method includes one or more of the following: (1) A method for preparing a genetically engineered strain of Bacillus subtilis as described in claim 1, wherein the construction method comprises: constructing a host strain as described in claim 1 and a recombinant expression plasmid as described in claim 1 respectively, and then introducing the recombinant expression plasmid into the host strain to construct the genetically engineered strain of Bacillus subtilis; (2) A method for producing starch branching enzyme, the method comprising: fermenting the recombinant Bacillus subtilis engineered strain as described in any one of claims 1-3, collecting the bacterial cells, dissolving them, and obtaining the starch branching enzyme.

5. The method as described in claim 4, characterized in that, In (2), The fermentation time is 12-156 hours; and / or, The centrifugation conditions for collecting bacterial cells include: centrifugation at 8000-12000 r / min for 10-20 min; and / or, The dissolved reagent includes Arg.

6. A primer, characterized in that, The nucleotide sequence of the primer includes one or more of the nucleotide sequences shown in SEQ ID NO: 17-122.

7. A primer pair, characterized in that, The nucleotide sequences of the primer pairs include one or more of the nucleotide sequences shown in SEQ ID NO: 17-122.

8. A plasmid, characterized in that, The plasmids include one or more of pWB980-ori / P43-GBE, pHTN07 / Pspovg-GBE, pHTN07 / P43-GBE, pWB980-ori / Pspovg-GBE, pHTN07 / Pgrac-GBE, pWB980-ori / Pgrac-GBE, pWB980-ori / Pbc-GBE, and pHTN07 / Pbc-GBE.

9. The application of the Bacillus subtilis genetically engineered strain as described in any one of claims 1-3, or the method as described in claim 4 or 5, or the primers as described in claim 6, or the primer pair as described in claim 7, or the plasmid as described in claim 8 in high-yield starch branching enzyme, preparation of Bacillus subtilis genetically engineered strains with high-yield starch branching enzyme, low-cost / stable / high-efficiency production of GBE enzyme preparations, starch modification and functional food development, large-scale application of GBE, development of genetically engineered strains with easily purified products and low background interference, and their supporting processes.

10. The Bacillus subtilis genetically engineered strain, method, primers, primer pairs, plasmids, and applications as described in any one of claims 1-9, characterized in that, The carrier includes one or more of pWB980-ori and pHTN07; and / or, The promoter includes one or more of P43, Pspovg, Pbc, and Pgrac; and / or, The nucleotide sequences of the encoding gene of GBE are shown in SEQ ID NO: 1, the nucleotide sequences of the P43 promoter are shown in SEQ ID NO: 2, the nucleotide sequences of the Pspovg promoter are shown in SEQ ID NO: 3, the nucleotide sequences of the Pgrac promoter are shown in SEQ ID NO: 4, the nucleotide sequences of the Pbc promoter are shown in SEQ ID NO: 5, the nucleotide sequences of the upp are shown in SEQ ID NO: 6, the nucleotide sequences of the amyA are shown in SEQ ID NO: 7, the nucleotide sequences of the lytC are shown in SEQ ID NO: 8, the nucleotide sequences of the lytD are shown in SEQ ID NO: 9, the nucleotide sequences of the lytE are shown in SEQ ID NO: 10, the nucleotide sequences of the lytF are shown in SEQ ID NO: 110, the nucleotide sequences of the lytG are shown in SEQ ID NO: 12, the nucleotide sequences of the lytH are shown in SEQ ID NO: 13, the nucleotide sequences of the cwlC are shown in SEQ ID NO: 14, and the nucleotide sequences of the cwlS are shown in SEQ ID NO:

15. As shown in ID NO: 15, the nucleotide sequence of the sigD is shown in SEQ ID NO: 16; and / or, The Bacillus subtilis genetically engineered strain is an engineered strain that highly expresses the amylase GBE; and / or, The knockout of amyA eliminates the influence of non-target amylases in the starch branching enzyme GBE-modified starch process; and / or, The knockout of sigD delays the autolysis process of the host bacteria, increases cell biomass, and increases the expression level of the amylase GBE; and / or, The knockout of the amyA gene and the sigD gene is achieved using homologous recombination technology with the upp gene as a reverse selection marker; and / or, The Arg solution can create an alkaline environment that promotes the autonomous dissolution of inclusion bodies, which is beneficial for the transformation of starch branching enzyme into a soluble form with the correct folding conformation.

Images