The invention relates to artificial 5apos for improving mRNA translation efficiency. Untranslated regions, constructs and uses thereof

By designing artificially optimized 5' untranslated region sequences, the problems of low translation efficiency, poor universality, and safety risks of mRNA vaccines were solved, achieving efficient antigen expression and improved safety, while reducing vaccine dosage requirements and production costs.

CN121991952APending Publication Date: 2026-05-08WUHAN INST OF BIOLOGICAL PROD CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
WUHAN INST OF BIOLOGICAL PROD CO LTD
Filing Date
2025-12-18
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

Existing mRNA vaccines rely on the natural 5' untranslated region, which leads to bottlenecks in antigen translation efficiency, poor universality, and potential safety risks.

Method used

We designed an artificially optimized 5' untranslated region sequence containing the nucleotide sequence of SEQ ID NO: 1, which has a high identity variant, eliminates complex secondary structures and potential inhibitory elements, is compatible with host cell translation mechanisms, and provides an efficient ribosome scanning channel.

Benefits of technology

It significantly improves mRNA translation efficiency, enhances antigen protein expression, reduces vaccine dosage requirements, improves safety, simplifies vaccine design, and reduces production costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121991952A_ABST
    Figure CN121991952A_ABST
Patent Text Reader

Abstract

The invention provides an artificial 5 '-untranslated region for improving mRNA translation efficiency and a construct and application thereof, the artificial 5'-untranslated region is a separated nucleic acid molecule, and the nucleic acid molecule comprises a nucleotide sequence as shown in SEQ ID NO: 1 or a variant sequence which has at least 90% identity with the SEQ ID NO: 1 and can enhance the mRNA translation efficiency. Through a rationally designed artificial 5 '-untranslated region sequence, adverse secondary structures and inhibitory elements are significantly eliminated, an almost ideal linear channel is created for ribosome scanning, and the antigen expression efficiency is improved; as a standardized modular element, the antibody can be flexibly combined with an antigen coding region, and excellent universality and platform value are shown; due to the completely artificial synthesis characteristic, the hidden uncontrollable regulation risk of a natural sequence is fundamentally avoided, and the internal safety of an mRNA product is remarkably improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to an artificial 5' untranslated region for improving mRNA translation efficiency, its construct, and its applications. Background Technology

[0002] With the development of biomedical technology, messenger RNA (mRNA) vaccines, as a third-generation vaccine platform, have shown great potential in areas such as infectious disease control and tumor immunotherapy. Compared with traditional vaccines, mRNA vaccines have significant advantages such as shorter development cycles, higher production efficiency, better safety profiles, and the ability to simultaneously stimulate humoral and cellular immunity. However, the rapid development in this field has also exposed core technological bottlenecks: mRNA vaccines developed on different platforms exhibit significant differences in efficacy, one of the core reasons being the design of the mRNA molecule itself, particularly its translation efficiency. Therefore, optimizing the mRNA molecular backbone and increasing the expression level of antigen proteins have become crucial for improving the efficacy of mRNA vaccines.

[0003] The function of mRNA molecules depends on their efficient translation into target antigen proteins within host cells. A typical mature mRNA molecule includes several key cis-regulatory elements: a 5' cap structure, a 5' untranslated region (UTR), an open reading frame encoding the antigen, a 3' UTR, and a 3' poly(A) tail. Among these, the 5' UTR is the critical region regulating mRNA translation initiation. Its mechanism of action is as follows: after the small ribosome subunit recognizes the 5' cap structure, it scans along the 5' UTR to find the start codon, thereby initiating the translation process. The sequence characteristics of the 5' UTR, such as its length, nucleotide composition, and the complexity of its secondary structures, profoundly affect the efficiency of ribosome scanning and the accuracy of translation initiation.

[0004] An ideal 5' untranslated region should have the following characteristics: simple secondary structure to avoid forming a stable stem-loop structure that hinders ribosome scanning; no upstream start codon to prevent erroneous translation initiation; and motifs compatible with the host cell's translation mechanism to efficiently recruit translation initiation factors.

[0005] Currently, common mRNA vaccine designs in this field typically borrow directly from the 5' untranslated region of endogenous human genes, with the most widely used being the 5' untranslated region of the human α-globin or β-globin gene. For example, approved COVID-19 mRNA vaccines (such as Comirnaty) utilize the 5' untranslated region of human α-globin. While these naturally occurring 5' untranslated regions can mediate basic protein translation, as products of natural evolution, they were not designed to maximize antigen expression in vaccine applications, and therefore have the following inherent defects and limitations: 1. Translation efficiency is not optimal: The natural 5' untranslated region is not rationally designed to maximize translation efficiency. They may contain potential repressive sequence elements or form stable secondary structures that are unfavorable to ribosome scanning, thus limiting the expression level of antigen proteins and constituting the ceiling of mRNA vaccine efficacy.

[0006] 2. Poor versatility: Some natural 5' untranslated regions function well when expressing their native proteins, but when used to drive the expression of antigen proteins from different sources and with different structures, their efficiency may be significantly reduced due to context-dependent effects, lacking the universality and stability of a platform technology.

[0007] 3. Potential safety risks: Some natural 5' untranslated regions may contain regulatory elements that are not yet fully understood. These elements may interact unpredictably with specific intracellular factors, potentially affecting mRNA stability or even triggering unwanted innate immune responses, thus increasing the safety risks of vaccines.

[0008] Therefore, there is an urgent need in this field for a novel, rationally designed 5' untranslated region sequence to overcome the defects of the natural 5' untranslated region and promote the advancement of mRNA vaccine technology. Summary of the Invention

[0009] Based on the above description, the purpose of this invention is to overcome the shortcomings of the prior art and solve the technical problems of existing mRNA vaccines relying on the natural 5' untranslated region, resulting in bottlenecks in antigen translation efficiency, poor universality, and potential risks.

[0010] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: In a first aspect, the present invention provides an artificial 5' untranslated region for improving mRNA translation efficiency, wherein the artificial 5' untranslated region is an isolated nucleic acid molecule containing a nucleotide sequence as shown in SEQ ID NO: 1.

[0011] Furthermore, this invention also covers variant sequences that have high identity with SEQ ID NO: 1 and retain its functional activity. Specifically, the variant sequences have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 1 and are capable of enhancing mRNA translation efficiency.

[0012] Preferably, the nucleic acid molecule is a DNA molecule or an RNA molecule.

[0013] The artificial 5' untranslated region (AUT) protected by this invention for improving mRNA translation efficiency has the most direct and fundamental beneficial effect stemming from its unique sequence design. Compared with existing technologies, it has the following specific advantages: (1) Ultra-high translation efficiency: This sequence is rationally designed to minimize complex secondary structures and potential inhibitory regulatory elements, providing a near-ideal linear pathway for ribosome scanning.

[0014] (2) Functional modularity and versatility: As an independent functional module, this sequence can be flexibly and efficiently linked with open reading frames encoding any target protein, demonstrating excellent versatility and not being limited by specific antigen types.

[0015] (3) Enhanced intrinsic safety: As a completely artificially synthesized sequence, it fundamentally eliminates the unpredictable regulatory risks that may be hidden in the natural sequence, reducing the possibility of triggering unexpected immune responses.

[0016] Secondly, the present invention provides an mRNA molecule.

[0017] The mRNA molecule comprises, from the 5' end to the 3' end, the following: 5' hat structure; According to the artificial 5' untranslated region described in the first aspect; Open reading frames encoding the target protein; 3' Non-translated area; and poly(A) tail.

[0018] In a preferred embodiment, the 3' untranslated region is derived from a globin gene (such as the human β-globin gene).

[0019] The beneficial effects of this invention are as follows: (1) Synergistic effect: The optimized 5' untranslated region and the stable 3' untranslated region work together to significantly prolong the half-life of mRNA and greatly increase the cumulative expression of antigen protein.

[0020] (2) Simplified vaccine design: It provides a "plug-and-play" efficient mRNA backbone template, which greatly simplifies the development process of mRNA vaccines against different pathogens or tumor antigens.

[0021] Thirdly, the present invention provides a DNA construct comprising a nucleotide sequence encoding the mRNA molecule described in the second aspect. This DNA construct may be in the form of a plasmid, a linear DNA fragment, or a viral vector.

[0022] The beneficial effects of this invention are as follows: the structure of the DNA construct is well-defined, it can be rapidly prepared using mature molecular biology techniques (such as enzyme digestion and ligation), and it can stably and efficiently produce high-quality mRNA products with consistency through in vitro transcription.

[0023] Fourthly, the present invention provides a pharmaceutical composition comprising an effective dose of the mRNA molecule described in the second aspect, or the DNA construct described in the third aspect, and a pharmaceutically acceptable carrier.

[0024] The above-mentioned pharmaceutical composition is preferably formulated as a vaccine.

[0025] The beneficial effects of this invention are as follows: Due to the significant improvement in mRNA translation efficiency, only a lower dose of mRNA is needed to induce a strong protective immune response. This directly means that the potential side effects of vaccination (such as fever, local redness and swelling) will be reduced, and the safety of clinical application will be higher. The reduction in dosage directly translates into a decrease in production costs, enabling highly effective mRNA vaccines or drugs to benefit a wider range of people at a lower price.

[0026] Fifthly, the present invention provides uses for the aforementioned nucleic acid molecules, mRNA molecules, DNA constructs, or pharmaceutical compositions. These applications also possess the technical effects described in the four aspects above, which will not be elaborated upon here. Attached Figure Description

[0027] Figure 1 Figure a shows a comparison of the predicted secondary structure of the artificial 5' untranslated region sequence provided in Example 1 of the present invention and the comparative sequence; Figure a is the predicted secondary structure of SEQ ID NO: 1 of the present invention; Figure b is the predicted secondary structure of the comparative example (β-globin 5' untranslated region); Figure 2 This is a flow cytometry result of HEK293T cells 24 h after in vitro transcribed mRNA transfection, as provided in Example 2 of the present invention. Figure 3 This is a full-field cell imaging analysis result provided in Example 2 of the present invention after transfecting HEK293T cells, A549 cells, and HEp2 cells with in vitro transcribed mRNA; Figure 4 This is a Western Blot result of HEK293T cells 24 h after in vitro transcribed mRNA transfection, as provided in Example 2 of the present invention. Figure 5 This is a graph showing the titer of hemagglutination inhibition antibodies in a mouse immunization experiment provided in Example 3 of the present invention; Figure 6 This is a schematic diagram of the mRNA molecule structure according to an embodiment of the present invention. Detailed Implementation

[0028] To facilitate understanding of this application, a more complete description will be provided below with reference to the accompanying drawings, which illustrate embodiments of the present application. However, the present application can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that the disclosure of this application will be thorough and complete.

[0029] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments, but the scope of protection of the present invention is not limited thereto. Unless otherwise specified, the experimental methods used in the present invention are all conventional methods, and the reagents and raw materials used are all commercially available.

[0030] The motivation of this invention is to overcome the limitations of existing technologies that rely on the natural 5' untranslated region. It aims to break with convention and no longer rely on borrowing or fine-tuning the natural 5' untranslated region. Instead, it designs and synthesizes a novel, artificially optimized 5' untranslated region sequence from scratch. Through careful calculation and nucleotide arrangement, it minimizes secondary structures that are detrimental to translation, eliminates inhibitory regulatory elements, and creates a near-ideal ribosome scanning channel, thereby significantly improving the translation initiation efficiency of mRNA and ultimately achieving a significant increase in antigen expression.

[0031] The general mechanism of the 5' untranslated region (5' untranslated region) is that after recognizing the 5' cap structure, the small ribosomal subunit scans along the 5' untranslated region until it finds a suitable start codon, thus initiating translation. This process is profoundly influenced by the sequence characteristics of the 5' untranslated region, including its length, nucleotide composition, and the complexity of its secondary structures. An ideal 5' untranslated region should possess the following characteristics: no complex secondary structures to avoid forming overly stable stem-loop structures that hinder ribosomal scanning; no start codon to prevent misleading translation initiation; and motifs highly compatible with human cellular translation mechanisms to promote the assembly and operation of the translation initiation complex.

[0032] Figure 6 The complete mRNA molecule structure of this invention is shown below. From top to bottom, it consists of: a 5' cap structure, the artificial 5' untranslated region of this invention, an open reading frame encoding the target protein, a 3' untranslated region, and a poly(A) tail. Detailed descriptions follow: Example 1: Sequence Design and Bioinformatics Analysis of Artificial 5' Untranslated Region Method: The sequence of the present invention, SEQ ID NO: 1, was synthesized; the corresponding sequence is: its nucleotide sequence from the 5' end to the 3' end is AGGACUCAUUGUCAUCACACUACUACUACUUAUCUACUCACAUCUACUCACUCACACAGAAUUCGCCACC, with a full length of 70 nt.

[0033] The corresponding DNA coding strand from the 5' end to the 3' end is AGGACTCATTGTCATCACACTACTACTACTTATCTACTCACATCTACTCACTCACTCAGAATTCGCCACC; the DNA template strand from the 3' end to the 5' end is TCCTGAGTAACAGTAGTGTGATGATGATGAATAGATGAGTGTAGATGAGTGAGTGAGTCTTAAGCGGTGG, with a total length of 70 bp.

[0034] As a comparative example, a commonly used sequence in existing technologies was selected: the 5' untranslated region of β-globin.

[0035] Using specialized RNA secondary structure prediction software (RNAfold), the minimum free energy of all sequences was predicted under the same physiological conditions (e.g., 37°C, 1M NaCl).

[0036] The corresponding results are as follows: like Figure 1 As shown, the minimum free energy (ΔG) predicted by SEQ ID NO: 1 of this invention is -2.40 kcal / mol.

[0037] The ΔG for the comparative example (β-globin 5' untranslated region) was -10.10 kcal / mol.

[0038] Comparative analysis shows that the artificial 5' untranslated region sequence of the present invention has a more open and less stable secondary structure (the absolute value of ΔG is significantly smaller), which is theoretically more conducive to the smooth scanning of ribosomes and lays the foundation for high translation efficiency.

[0039] Example 2: Validation of in vitro reporter gene expression levels 1. Plasmid construction Open reading frames encoding enhanced green fluorescent protein and IVR-238 (A / Victoria / 4897 / 2022) HA were linked downstream of the following 5' untranslated regions: experimental group (SEQ ID NO: 1 of this invention) and comparative group (β-globin 5' untranslated region). All constructs used the same human β-globin 3' untranslated region and poly(A) tail.

[0040] 2. In vitro transcription After linearizing the above plasmids, mRNAs with the same 5' cap structure were synthesized using the same in vitro transcription kit and capping process.

[0041] The DNA template strand “TCC” corresponding to the 1st to 3rd nucleotide residues “AGG” in the 5' untranslated region has the function of binding to cap analogs and can be used for co-transcriptional capping of mRNA in vitro transcription; the DNA coding strand “GAATTC” corresponding to the 59th to 64th nucleotide residues “GAAUUC” in the 5' untranslated region is the restriction site of the DNA restriction endonuclease EcoRI and can be used to replace the open reading frame encoding the antigen protein; the 65th to 70th nucleotide residues “GCCACC” in the 5' untranslated region is part of the Kozak sequence and is used to improve translation efficiency.

[0042] Furthermore, this 5' untranslated region can be used in combination with the 3' untranslated region of β-globin mRNA, inserting an open reading frame encoding the antigen protein between them, and together with the 5' cap and poly(A) tail, forming a complete mRNA. 3. Cell transfection and detection Equal amounts (e.g., 2.5 μg) of mRNAs encoding enhanced green fluorescent protein (GFP) were transfected into HEK293T cells (human embryonic kidney cells) using liposome transfection. The mean fluorescence intensity was measured by flow cytometry 24 hours after transfection. Equal amounts (e.g., 0.5 μg) of mRNAs encoding GFP were transfected into HEK293T cells (human embryonic kidney cells), A549 cells (human alveolar basal epithelial cells for lung cancer), and HEp2 cells (human laryngeal squamous cell carcinoma cells) using liposome transfection. The mean integrated fluorescence intensity was measured using a full-field cell imaging analyzer at 6, 12, 24, 48, 72, and 96 hours post-transfection. Equal amounts (e.g., 2.5 μg) of mRNAs encoding IVR-238 (A / Victoria / 4897 / 2022) HA were transfected into HEK293T cells (human embryonic kidney cells) using liposome transfection. HA expression was detected by Western blotting.

[0043] Figure 2 The results of flow cytometry 24 h after transfection with HEK293T cells are shown. The flow cytometry results show that the average fluorescence intensity of the experimental group (in this invention) was significantly higher than that of the control group (p<0.0001), which was about 29.0% higher than that of the control group.

[0044] Figure 3 The results of the full-field cell imaging analysis are shown in the figure. As can be seen from the figure, the average fluorescence intensity of HEK293T cells in the experimental group (the present invention) was significantly higher than that in the control group starting from 24 hours; the average fluorescence intensity of A549 cells and HEp2 cells in the experimental group (the present invention) was significantly higher than that in the control group starting from 48 hours.

[0045] Figure 4The results shown are Western Blot results 24 h after transfection of HEK293T cells. After grayscale analysis, the results of Western Blot showed that the HA expression level in the experimental group (in this invention) was about 1.5 times that of the internal reference (β-actin) compared with the control group.

[0046] The artificial 5' untranslated region provided in this invention can significantly improve the translation efficiency of mRNA in various cell types, and its effect exceeds that of the commonly used natural 5' untranslated region. The efficiency of kinesin expression of the 5' untranslated region of this invention can be directly verified at the cellular level.

[0047] Example 3: Immunogenicity evaluation in mice This embodiment aims to provide a method for validating the effectiveness of the 5' untranslated region of this invention in practical vaccine applications using animal models. The corresponding evaluation method is as follows: 1. mRNA vaccine preparation The sequence encoding IVR-238 (A / Victoria / 4897 / 2022) HA was linked to the experimental group (5' untranslated region of this invention) and the comparative group (5' untranslated region of β-globin) and prepared into an LNP-encapsulated mRNA vaccine.

[0048] 2. Animal immunization BALB / c mice were randomly divided into 7 groups (n=10): experimental group 1 (intramuscular injection of 5 μg of the mRNA vaccine of this invention), experimental group 2 (intramuscular injection of 10 μg of the mRNA vaccine of this invention), experimental group 3 (intramuscular injection of 20 μg of the mRNA vaccine of this invention), control group 1 (intramuscular injection of 5 μg of comparative mRNA vaccine), control group 2 (intramuscular injection of 10 μg of comparative mRNA vaccine), control group 3 (intramuscular injection of 20 μg of comparative mRNA vaccine), and blank control group (injection of Tris-HCl). Primary immunization was performed on day 0, and booster immunization was performed on day 21.

[0049] 3. Serological testing Blood was collected on day 21 after booster immunization, and the titer of hemagglutination inhibition antibody against IVR-238(A / Victoria / 4897 / 2022)HA in mouse serum was detected using the hemagglutination inhibition assay (HI).

[0050] Experimental results: such as Figure 5The results of the HA hemagglutination inhibition antibody titers shown indicate that, on day 21 after booster immunization, the geometric mean titer (GMT) of hemagglutination inhibition antibody in experimental group 1 (5 μg of the present invention) was significantly different from that in control group 1 (5 μg comparative sample) (p<0.01), but not significantly different from that in control group 2 (10 μg comparative sample) and control group 3 (20 μg comparative sample); experimental group 2 (10 μg of the present invention) was significantly different from that in control group 1 (5 μg comparative sample) (p<0.0001), significantly different from that in control group 2 (10 μg comparative sample) (p<0.01), but not significantly different from that in control group 3 (20 μg comparative sample); experimental group 3 (20 μg of the present invention) was significantly different from that in control group 1 (5 μg comparative sample) (p<0.0001), significantly different from that in control group 2 (10 μg comparative sample) (p<0.0001), and significantly different from that in control group 3 (20 μg comparative sample) (p<0.0001).

[0051] Specifically, the geometric mean titer (GMT) of hemagglutination inhibition antibody in experimental group 1 was 1:5129, while that in control group 1 was 1:3584; in experimental group 2 it was 1:8192, while that in control group 2 was 1:5632; and in experimental group 3 it was 1:10496, while that in control group 3 was 1:6144. 5 μg of the mRNA vaccine of this invention can achieve the effect of 10 μg of the comparative mRNA vaccine, and 10 μg of the mRNA vaccine of this invention can achieve the effect of 20 μg of the comparative mRNA vaccine.

[0052] At the same dosage, the mRNA vaccine using the 5' untranslated region of this invention can induce a stronger humoral immune response; at the same immunogenicity, the present invention can reduce the mRNA vaccine dosage by half compared with the comparative example, demonstrating that it can effectively improve vaccine efficacy and has the potential to reduce the dosage.

[0053] Example 4: Functional Verification of Sequence Variants This embodiment aims to provide another "variant sequence with at least 90% identity and capable of enhancing mRNA translation efficiency".

[0054] Design two variant sequences with 95% and 98% homology to SEQ ID NO: 1.

[0055] Following the method in Example 2, the efficiency of driving enhanced green fluorescent protein expression was tested, and the results showed that the expression efficiency of the two variant sequences was not significantly different from that of SEQ ID NO: 1 (p>0.05).

[0056] Therefore, variant sequences highly homologous to SEQ ID NO: 1 also possess the characteristic of high translation efficiency, indicating that the effect of the present invention is not sensitive to minor changes in the sequence and has a certain degree of fault tolerance and universality.

[0057] In summary, the technical solution provided by this invention has the following significant beneficial effects: (1) Significantly improved translation efficiency: The artificial 5' untranslated region sequence of this invention is rationally designed to minimize the tendency of the sequence to form unfavorable secondary structures, creating a near-ideal channel for ribosome scanning. Experimental data show that, compared with the conventionally used human β-globin 5' untranslated region, the sequence of this invention can drive an approximately 1.5-fold increase in the expression of downstream reporter genes or antigen genes. This means that, under the premise of achieving the same immunization effect, the dosage of mRNA vaccines can be significantly reduced.

[0058] (2) Excellent versatility and platform value: The 5' untranslated region of this invention is a "plug-and-play" modular element with a universal restriction endonuclease site (such as the EcoRI site) at its 3' end, which can be easily recombinated with open reading frames encoding different antigens. Experiments have shown that when driving the expression of antigens from various sources (such as viral surface proteins and tumor antigens), the 5' untranslated region of this invention can stably maintain high translation efficiency, demonstrating excellent versatility and possessing strong mRNA platform technology value.

[0059] (3) Enhanced safety: The sequence of this invention is completely artificially synthesized, eliminating the regulatory elements with unknown functions that may exist in the natural 5' untranslated region, fundamentally avoiding the risk of unpredictable interactions with intracellular factors, reducing the possibility of triggering unexpected innate immune responses, thereby improving the safety of mRNA products.

[0060] (4) Important clinical application value: Due to the significant improvement in translation efficiency, mRNA vaccines or drugs using the 5' untranslated region of this invention can induce a strong protective immune response at a lower dose. This not only helps to reduce the local or systemic side effects of vaccination, but also significantly reduces production costs and improves vaccine accessibility. It has broad application prospects in the fields of infectious disease prevention and control and tumor immunotherapy.

[0061] In this specification, the specific features, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Furthermore, those skilled in the art can combine and integrate the different embodiments or examples described herein, as well as the features of those different embodiments or examples, without contradiction.

[0062] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. An artificial 5' untranslated region for improving mRNA translation efficiency, characterized in that, The artificial 5' untranslated region is an isolated nucleic acid molecule containing a nucleotide sequence as shown in SEQ ID NO: 1, or a variant sequence having at least 90% identity with SEQ ID NO: 1 and capable of enhancing mRNA translation efficiency.

2. The artificial 5' untranslated region for improving mRNA translation efficiency according to claim 1, characterized in that, The nucleic acid molecule is either a DNA molecule or an RNA molecule.

3. An mRNA molecule, characterized in that, From the 5' end to the 3' end, the following are included sequentially: 5' hat structure; The artificial 5' untranslated region as described in claim 1 or 2; Open reading frames encoding the target protein; 3' Non-translated area; and poly(A) tail.

4. The mRNA molecule according to claim 3, characterized in that, The 3' untranslated region originates from the globin gene.

5. A DNA construct, characterized in that, The DNA construct contains a nucleotide sequence encoding the mRNA molecule of claim 3 or 4.

6. The DNA construct according to claim 5, characterized in that, The DNA construct is a plasmid, a linear DNA fragment, or a viral vector.

7. A pharmaceutical composition, characterized in that, It comprises the mRNA molecule of claim 3 or 4, or the DNA construct of claim 5 or 6.

8. The pharmaceutical composition according to claim 7, characterized in that, The pharmaceutical composition is a vaccine.

9. Use of the artificial 5' untranslated region as described in claim 1 or 2, the mRNA molecule as described in claim 3 or 4, or the DNA construct as described in claim 5 or 6 in the preparation of a medicament for the prevention and / or treatment of a disease.

10. The use according to claim 9, characterized in that, The disease in question is either an infectious disease or a tumor.