Primer probe group for detecting fusion genes of three leukemia, namely BCR-ABL1, ETV6-RUNX1 and TCF3-PBX1, and application of primer probe group

By using primer-probe combinations and real-time PCR, the problem of existing technologies being unable to simultaneously and efficiently detect three leukemia fusion gene isoforms—BCR-ABL1, ETV6-RUNX1, and TCF3-PBX1—has been solved. This enables highly sensitive, low-cost single-tube multi-gene detection, supporting the selection of leukemia diagnosis and treatment options.

CN121992085APending Publication Date: 2026-05-08BEIJING CHILDRENS HOSPITAL AFFILIATED TO CAPITAL MEDICAL UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
BEIJING CHILDRENS HOSPITAL AFFILIATED TO CAPITAL MEDICAL UNIV
Filing Date
2025-10-16
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

Existing technologies cannot detect multiple isoforms of the three leukemia fusion genes BCR-ABL1, ETV6-RUNX1, and TCF3-PBX1 with high sensitivity and specificity in the same reaction system. Furthermore, the detection methods are complex and costly, failing to meet the needs of leukemia diagnosis and treatment selection.

Method used

A detection method based on capture and ligation combined real-time PCR was designed, using a specific primer and probe composition, including ligation probes, capture probes and Taq-Man probes, to cover multiple fusion gene isoforms, avoid cross-reactions, and achieve single-tube detection of multiple genes.

Benefits of technology

It achieves highly sensitive and specific single-tube detection, reduces detection costs and time, provides a basis for leukemia diagnosis, subtyping, and treatment selection, and is suitable for direct detection of whole blood, dried blood smears, and bone marrow samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121992085A_ABST
    Figure CN121992085A_ABST
Patent Text Reader

Abstract

The invention provides a primer probe group for detecting three leukemia fusion genes BCR-ABL1, ETV6-RUNX1 and TCF3-PBX1 and application of the primer probe group, and establishes a method for simultaneously detecting RNA of the three fusion genes based on capture and ligation reaction combined with multiple fluorescent quantitative PCR. The primer probe group comprises a capture probe, a connection probe, an amplification primer and a Taq-Man probe which are respectively used for detecting multiple types and reference genes of three fusion genes. Nucleic acid extraction and reverse transcription are not needed, target RNA in whole blood, dried blood spots or bone marrow samples can be directly split and captured, and three fusion genes are simultaneously detected in the same fluorescent quantitative PCR reaction system. The detection sensitivity is that the copy / reaction of BCR-ABL1 is 75, the copy / reaction of ETV6-RUNX1 is 6, and the copy / reaction of TCF3-PBX1 is 29.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gene detection technology, and in particular to a primer and probe set for detecting three leukemia fusion genes, BCR-ABL1, ETV6-RUNX1 and TCF3-PBX1, and their applications. Background Technology

[0002] Acute lymphoblastic leukemia (ALL) is the most common type of cancer in children, accounting for 70%–80% of childhood acute leukemia cases and approximately 27.3% of childhood cancers. It is the most common cause of cancer death before the age of 20. Fusion genes are common and important molecular biological abnormalities in leukemia. BCR-ABL1, ETV6-RUNX1 (also known as TEL-AML1), and TCF3-PBX1 (also known as E2A-PBX1) are the three most common fusion gene types in ALL patients.

[0003] Fusion genes exhibit heterogeneity, resulting in multiple isoforms due to variations in gene breakpoints and fusion sites. For example, the BCR-ABL1 fusion gene is formed by the t(9;22)(q34;q11) translocation. Depending on the breakpoint location in the BCR gene, the main isoform types include p210 (e13a2 or e14a2), p190 (e1a2), and p230 (e19a2). Besides these three typical fusion types, other fusion variants exist, such as e1a3, e6a2, and e8a2, but their relative frequency is lower. Current research has also identified multiple isoforms for ETV6-RUNX1 and TCF3-PBX1. Accurate detection of fusion genes can provide crucial molecular evidence for leukemia diagnosis, subtyping, prognostic assessment, treatment selection, and minimal residual disease monitoring.

[0004] Existing methods for detecting fusion genes mainly include chromosome karyotype analysis, fluorescence in situ hybridization (FISH), immunohistochemical staining, next-generation sequencing (NGS), and reverse transcription quantitative PCR. Chromosome karyotype analysis is simple and intuitive, but has low sensitivity and is affected by the number of mitotic phases. FISH is the gold standard for detecting fusion genes, with high specificity, but it is complex to operate, requires high-quality slide preparation, and has a limited number of sites that can be detected in a single run. Immunohistochemistry requires low sample volume and is technically simple, but it is complex to operate, has few types of fusion protein antibodies, and requires high sample integrity. NGS can achieve comprehensive and unbiased detection and has the potential to detect unknown fusion genes, but it generates large amounts of data, is expensive, and has complex data analysis and long reporting cycles. Quantitative RT-PCR is highly operable and sensitive, but it is limited by fluorescence channels and probes, and cannot cover different isoforms of fusion genes in a single reaction system. To comprehensively detect multiple possible isoforms of fusion genes, more reaction wells are needed, significantly increasing costs and workload. Currently, there is no method to simultaneously detect multiple isoforms of these three leukemia fusion genes in the same reaction system. Therefore, there is an urgent need to establish a highly sensitive, specific, simple, and rapid new detection technology. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides a scheme for detecting different isoforms of three fusion genes based on capture and ligation combined with real-time quantitative PCR. This method eliminates the need for nucleic acid extraction and reverse transcription, and can use a single set of primers and probes to detect multiple transcripts of the fusion gene, enabling the simultaneous detection of the presence of three fusion genes, BCR-ABL1, ETV6-RUNX1, and TCF3-PBX1, in a single tube.

[0006] The first object of the present invention is to provide a primer-probe composition comprising: The first bridging probe group shown in SEQ ID NO.3-4, the second bridging probe group shown in SEQ ID NO.14-15, and the third bridging probe group shown in SEQ ID NO.27-28; The first capture probe group shown in SEQ ID NO.7-13, the second capture probe group shown in SEQ ID NO.20-24, and the third capture probe group shown in SEQ ID NO.31-35; The Taq-Man probe sets shown in SEQ ID NO.45, SEQ ID NO.47 and SEQ ID NO.48; Primer sets for amplifying the fusion genes BCR-ABL1, ETV6-RUNX1, and TCF3-PBX1.

[0007] To overcome the shortcomings of existing detection technologies, this invention designs a method for detecting leukemia fusion genes based on primer-probe combinations combined with multiplex quantitative real-time PCR, particularly focusing on the screening and optimization of ligation probes, capture probes, and Taq-Man probes. Specifically, ligation and capture probes are designed using conserved regions of different fusion gene variants, and a series of designed ligation and capture probes are screened to select the probe group with the highest binding efficiency and detection sensitivity. Regarding Taq-Man probes, this invention differs from existing quantitative PCR methods. Our designed Taq-Man probes are not target-specific but universal, and after screening, they do not hybridize with currently known human genes, and they produce strong signals and low background in this method. Furthermore, the fusion genes BCR-ABL1, ETV6-RUNX1, and TCF3-PBX1 are the three most common fusion genes in acute lymphoblastic leukemia, ranking among the top three in positive rates, making simultaneous detection essential. Existing commercially available kits can only detect one splice form of the fusion gene, with sensitivities of only 100 cps or even 1000 cps; our method, however, covers most splice variants of this fusion gene. The composition of the present invention does not have cross-influence when used for the detection of these three fusion genes, and the sensitivity is improved by at least one order of magnitude.

[0008] Furthermore, the primer sets used for amplifying the fusion genes BCR-ABL1, ETV6-RUNX1, and TCF3-PBX1 are shown in SEQ ID NO. 43-44. Using the same pair of amplification primers avoids competition for advantages among the three fusion genes and ensures the same amplification efficiency.

[0009] Furthermore, the primer-probe composition also includes probes and primers for detecting an internal reference gene; the internal reference gene includes the ABL1 gene.

[0010] Furthermore, the probe for detecting the internal reference gene includes a ligation probe and a Taq-Man probe; wherein, the ligation probe for detecting the internal reference gene is shown in SEQ ID NO.36-41, and the Taq-Man probe for detecting the internal reference gene is shown in SEQ ID NO.46.

[0011] Furthermore, the primers used to detect the internal reference gene ABL1 are shown in SEQ ID NO.42-43.

[0012] Furthermore, the Taq-Man probe is modified with a detectable label. Preferably, both ends of the Taq-Man probe are modified with a fluorescent group and a quencher group, respectively. Of course, to distinguish different target genes, the fluorescent groups modified on different Taq-Man probes are different. In this invention, each TaqMan fluorescent probe is labeled with a fluorescent group at its 5' end and a quencher group at its 3' end.

[0013] Furthermore, Taq-Man probes are modified with locked nucleic acids or have MGB modifications at the 3' end to enhance their binding affinity.

[0014] A second objective of the present invention is to provide a detection kit containing the primer-probe composition.

[0015] Furthermore, the test kit also contains reagents necessary for PCR (such as multiplex quantitative PCR).

[0016] A third objective of this invention is to provide the application of the primer-probe composition or detection kit in the preparation of detection products for at least one of the fusion genes BCR-ABL1, ETV6-RUNX1, and TCF3-PBX1.

[0017] A fourth object of the present invention is to provide the application of the primer-probe composition or detection kit in the preparation of leukemia detection products.

[0018] Furthermore, the detection includes the following steps: (1) Obtain the sample to be tested; (2) Mix the ligation probe and the capture probe with the sample to be tested and incubate to carry out the capture reaction. After the reaction is completed, wash away the unhybridized probe and then add it to the ligation system for incubation to carry out the ligation reaction. After the reaction is completed, mix the product with the primer and Taq-Man probe and carry out PCR. Determine the detection result based on the PCR result (determine whether there is a fusion gene in the sample).

[0019] Furthermore, the detection method is single-tube detection.

[0020] Furthermore, the sample to be tested can be a (peripheral) whole blood sample, a dried blood smear sample, or a bone marrow sample, which can directly capture the target RNA in the sample and achieve detection without extracting nucleic acid.

[0021] By means of the above-described solution, the present invention has at least the following advantages: (1) The present invention designs a unique detection system, wherein: a capture-ligation system is adopted and screened and optimized to capture the RNA of the internal reference gene and the fusion gene simultaneously, without the need for nucleic acid extraction and reverse transcription in whole blood (or dried blood smear or bone marrow sample); the probe design of the present invention covers multiple transcriptional isoforms of the same fusion gene, and can cover different RNA splice versions of these fusion genes, which greatly improves the detection rate; the present invention avoids cross-reaction and competitive advantage among the three fusion genes.

[0022] (2) The detection method of the present invention has the characteristics of high sensitivity and high accuracy; at the same time, it does not require nucleic acid extraction and reverse transcription, which reduces the detection cost and shortens the detection time. It solves the problem that traditional fluorescence quantitative RT-PCR cannot cover multiple transcriptional isoforms of fusion genes in the same reaction system, provides reliable technical support for the detection of fusion genes in leukemia, and provides guidance for the initial diagnosis, prognosis and treatment selection of children with leukemia.

[0023] The above description is merely an overview of the technical solution of the present invention. In order to better understand the technical means of the present invention and to implement it in accordance with the contents of the specification, the following describes the preferred embodiments of the present invention in conjunction with detailed drawings. Attached Figure Description

[0024] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings.

[0025] Figure 1 This is a schematic flowchart of the detection method of the present invention.

[0026] Figure 2 Design diagram for connecting the probe and the capture probe.

[0027] Figure 3 These are the results of the sensitivity test.

[0028] Figure 4 This is a specific result indicating a positive result for a dual fusion gene. Detailed Implementation

[0029] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0030] The materials involved in this invention are as follows: (1) Main reagents and instruments Proteinase K (Tiangen Biotech Beijing Co., Ltd.); DNA ligase (Beijing Kangwei Century Biotechnology Co., Ltd.); PCR premix (Suzhou Xinhai Biotechnology Co., Ltd.); Filter paper (Whatman 903); RNA rapid quantification kit (Sangon Biotech Shanghai Co., Ltd.); Eppendorf metal bath shaker (Thermo Mixer); Real-time PCR instrument (Roche Light Cycler 96) (2) Clinical samples and in vitro transcribed RNA (IVT-RNA) 195 peripheral whole blood samples, 29 dried blood smears, and 74 bone marrow samples were collected from newly diagnosed ALL patients and anticoagulated with EDTA. IVT-RNAs of three fusion genes and the internal reference gene ABL1 were constructed in vitro.

[0031] (3) The sequence involved in this invention is shown below.

[0032] Table 1 Primers and probes used in the detection In this diagram, UP-F represents the universal forward primer for the internal reference gene; FG-F represents the universal forward primer for the fusion gene; FG-R represents the universal reverse primer for both the internal reference gene and the fusion gene; FAM, HEX, Texas-Red, and Cy5 represent the fluorescent groups at the 5' end of the TaqMan probe; BHQ1, BHQ2, and BHQ3 are the quenching groups at the 3' end of the TaqMan probe; CP is the capture probe; and LP is the ligation probe. 5'P- indicates phosphorylation modification at the 5' end of the ligation probe. + indicates locked nucleic acid modification on the TaqMan probe. Bold text indicates the best-performing pair of ligation probes selected through experimental screening and optimization.

[0033] IVT-RNA sequence of the fusion gene: The BCR-ABL1 IVT-RNA sequence is 2750 nt in total, with the split points at nt 2276 and 2277. LP binding location (the final LP B pair used after experimental optimization, i.e., SEQ ID 3 and 4 in Table 1): 486-524nt Location of CP binding (7 CPs): 2322-2506 nt The IVT-RNA sequence of ETV6-RUNX1: 912 nt in total, with the cutoff point between 364 and 365 nt. LP binding site: (After experimental optimization, a pair of LP A were finally used, namely SEQ ID 14 and 15 in Table 1), 577-612nt CP binding sites: (5 CPs), 129-225nt GCTAGCCTCAGGGACCCAGGCCGCACCAGGAGAACAACCACCAGGAGTCCTACCCTCTGTCAGTGTCTCCCATGGAGAATAATCACTGCCCAGCGTCCTCCGAGTCCCACCCGAAGCCATCCAGCCCCCGGCAGGAGAGCACACGCGTGATCCAGCTGATGCCCAGCCCCATCATGCACCCTCTGATCCTGAACCCCCGGCACTCCGTGGATTTCAAACAGTCCAGGCTCTCCGAGGACGGGCTGCATAGGGAAGGGAAGCCCATCAACCTCTCTCATCGGGAAGACCTGGCTTACATGAACCACATCATGGTCTCTGTCTCCCCGCCTGAAGAGCACGCCATGCCCATTGGGAGAATAGCAGATGCCAGCACGAGCCGCCGCTTCACGCCGCCTTCCACCGCGCTGAGCCCAGGCAAGATGAGCGAGGCGTTGCCGCTGGGCGCCCCGGACGCCGGCGCTGCCCTGGCCGGCAAGCTGAGGAGCGGCGACCGCAGCATGGTGGAGGTGCTGGCCGACCACCCGGGCGAGCTGGTGCGCACCGACAGCCCCAACTTCCTCTGCTCCGTGCTGCCTACGCACTGGCGCTGCAACAAGACCCTGCCCATCGCTTTCAAGGTGGTGGCCCTAGGGGATGTTCCAGATGGCACTCTGGTCACTGTGATGGCTGGCAATGATGAAAACTACTCGGCTGAGCTGAGAAATGCTACCGCAGCCATGAAGAACCAGGTTGCAAGATTTAATGACCTCAGGTTTGTCGGTCGAAGTGGAAGAGGGAAAAGCTTCACTCTGACCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGAGAATTC IVT-RNA sequence of TCF3-PBX1: A total of 1162 nt, and the splitting point is between 802 and 803 nt LP binding site: (After experimental optimization, a pair of LP Bs was finally used, namely SEQ ID 27 and 28 in Table 1), 940-977nt CP binding sites: (5 CPs), 323-424nt Example 1 The detection method includes the following steps: 1. Processing of clinical samples Lysis of whole blood or bone marrow samples Before performing the capture reaction, whole blood or bone marrow needs to be lysed. After thawing EDTA-anticoagulated whole blood or bone marrow from a -80°C freezer at room temperature, mix thoroughly by inverting 3-5 times. Then, prepare the lysis mixture in 2 mL centrifuge tubes according to the table below. To ensure complete lysis, the maximum volume in each centrifuge tube should not exceed 500 μL. After briefly centrifuging the tubes at low speed, place them in a metal bath shaker and incubate for 30 min (56°C, 1200 rpm). The remaining whole blood lysis buffer from the capture reaction can be stored at -20°C for a short period. The preparation method for the whole blood lysis reaction system is as follows: Lysis of dried blood smear samples (1) Take out the dried blood sample stored in the -80℃ refrigerator and prepare a 5mm diameter punching pliers. Burn both sides of the punching pliers in the outer flame of an alcohol lamp for a few seconds, and let it cool completely to room temperature. Keep the punching pliers clean and do not introduce other contaminants.

[0034] (2) After the punch forceps have cooled, take a clean blank filter paper and punch three holes in it. Observe whether both sides of the dried blood sample are soaked in blood. If there is no abnormality, punch the hole in the center of the dried blood sample to ensure that the dried blood sample falls completely into the 1.5 mL centrifuge tube. After punching the sample of each patient, the punch forceps must be burned, cooled and punched with blank filter paper again before the next sample can be processed. Cross-contamination must be strictly avoided.

[0035] (3) Add the lysis system to the 1.5 mL centrifuge tube containing the collected dried blood smears according to the table below. After a short period of low-speed centrifugation, place the tube in a metal bath shaker and incubate for 30 min (56℃, 1200 rpm).

[0036] 2. IVT-RNA: Design and synthesis of primers and probes Based on the COSMIC database, the breakpoint locations of all mRNA splice variant transcripts of the three fusion genes ETV6-RUNX1, BCR-ABL1, and TCF3-PBX1 were determined (see Table 2-4). A series of adjacent probes (referred to as capture probes and ligation probes based on their tails) were designed to bind to the vast majority of transcripts. Specifically, for the 5' chaperone gene of the fusion gene, the probe binding site was designed upstream of the most upstream breakpoint; for the 3' chaperone gene, the probe binding site was designed downstream of the most downstream breakpoint (see Table 2-4). Figure 2Therefore, the sequences at these probe binding sites are common to the vast majority of transcripts, meaning that one set of probes can bind to the vast majority of different transcripts. The 5' chaperone gene exon containing the 5' chaperone gene probe binding site and its adjacent exon sequences were combined with the 3' chaperone gene exon containing the 3' chaperone gene probe binding site and its adjacent exon sequences to design and synthesize RNA of approximately 912-2750 nt in length as a mimicry fusion gene IVT-RNA.

[0037] Figure 2 This is a schematic diagram of the break-fusion modes of the three fusion genes. For the fusion gene BCR-ABL1, according to the COSMIC fusion gene database (see Table 2), among the many BCR-ABL1 transcripts, the breakpoint of the 5' chaperone gene (BCR gene) is located at different positions in exons 1-19 of BCR, while the breakpoint of the 3' chaperone gene (ABL1 gene) is located at different positions in exons 1-3 of ABL1. Therefore, we designed a ligation probe upstream of the upstream breakpoint of BCR, i.e., the breakpoint of exon 1, and a capture probe downstream of the downstream breakpoint of ABL1, i.e., the breakpoint of exons 2-3. This can cover all BCR-ABL1 transcripts with known breakpoints, accounting for more than 90% of all BCR-ABL1 fusion transcripts.

[0038] Similarly, according to the COSMIC fusion gene database (see Table 3), the vast majority of known breakage patterns in the fusion gene ETV6-RUNX1 occur at exon 5 of the 5' chaperone gene (ETV6 gene) and exons 2-3 of the 3' chaperone gene (RUNX1 gene). Therefore, designing a capture probe upstream of the breakpoint at exon 5 of ETV6 and a ligation probe downstream of the breakpoint at exons 4-6 of RUNX1, i.e., the most downstream exon 3, can cover more than 73% of fusion transcripts. Similarly, in the fusion gene TCF3-PBX1, according to the COSMIC fusion gene database (see Table 4), approximately 99% of the breakage patterns are in exon 16 of the 5' chaperone gene (TCF3 gene) and exon 3 of the 3' chaperone gene (PBX1 gene). Therefore, designing a capture probe upstream of the breakage point in exons 11-13 of TCF3 and a ligation probe downstream of the breakage point in exon 3 of PBX1 can cover more than 99% of the fusion patterns.

[0039] Table 2. Break-through fusion sites of the fusion gene BCR-ABL1 Table 3. Break-through fusion sites of the fusion gene ETV6-RUNX1 Table 4. Break-fusion sites of the fusion gene TCF3-PBX1 3. The testing process is as follows: (1) Capture reaction Take the whole blood / bone marrow / dried blood smear lysis buffer, thaw it thoroughly at room temperature and shake it to mix. Take 50 μL of the whole blood / bone marrow / dried blood smear lysis buffer into the capture reaction plate, add 1 μL of the capture-linked probe system with a final concentration of 100 nM, seal it with a membrane, denature it at 75℃ for 5 min, and then place it in a metal shaker at 55℃, 1200 rpm for 60 min to capture.

[0040] (2) Connection reaction After capture, remove the capture membrane, discard the liquid in the reaction plate, and wash three times with 1× washing buffer. Then add the ligation system to the reaction wells: 1 μL DNA ligase, 10 μL DNA ligation buffer (5×), and finally add ddH2O to make up to 50 μL. Seal the plate tightly with a membrane and incubate in a PCR instrument at 37°C for 10 min.

[0041] (3) qPCR reaction After ligation, remove the sealing membrane, discard the liquid in the reaction plate, and then add the following qPCR reaction mixture to the reaction wells: 12.5 μL qPCR premix, 1.25 μL 10 μM reverse primer for the fusion gene (FG-R), 0.5 μL 10 μM internal control primer (UP-F), 0.75 μL 10 μM forward primer for the fusion gene (FG-F), 0.25 μL 10 μM FAM and HEX probes, 0.125 μL 10 μM Cy5 probe, 1 μL 10 μM Texas Red probe, and finally add ddH2O to a final volume of 25 μL. Seal the plate tightly with a fluorescent qPCR membrane and react on a Roche LC96 real-time PCR detection system under the following cycling conditions: 50℃, 2 min; 95℃, 2 min; 95℃, 15 s; 60℃, 40 s; 40 cycles. At the end of the annealing extension stage, fluorescence channels were acquired using the FAM, HEX, Texas Red, and Cy5 channels.

[0042] (4) Interpretation of PCR results If the HEX channel containing the internal reference gene ABL1 is positive and Cq > 36, the experiment fails and the sample must be lysed again. Other channels can only be interpreted if Cq ≤ 36 in the HEX channel containing the internal reference gene ABL1: A positive FAM channel with Cq ≤ 36 indicates a positive BCR-ABL1 fusion gene; a positive Texas Red channel with Cq ≤ 36 indicates a positive ETV6-RUNX1 fusion gene; and a positive Cy5 channel with Cq ≤ 36 indicates a positive TCF-PBX1 fusion gene.

[0043] 4. Specificity and sensitivity of the detection method of this invention (1) Specificity assessment Using the IVT-RNA of the target fusion gene as a positive control, the IVT-RNA of other fusion genes as negative controls, and whole blood lysate from healthy individuals as a negative control, the detection method of this invention was used to determine whether there was cross-reactivity between the primers and probes of the three fusion genes, and to evaluate the specificity of this detection method.

[0044] (2) Sensitivity assessment The IVT-RNA of the fusion gene was serially diluted 3-fold, and the detection limits of the three fusion genes and the internal reference gene were detected using the method established in this invention to evaluate the sensitivity of the platform.

[0045] 5. Proportion of dual gene positivity The fusion gene and the internal reference gene were mixed at ratios of 1:1, 1:10, 1:100, 1:1000, and 1:10000; and the two fusion genes were mixed at ratios of 1:1 to 1:10000. The method of this invention was used to determine at which ratios they could be detected simultaneously.

[0046] 6. Clinical sample testing Using 195 peripheral whole blood samples, 29 dried blood smears, and 74 bone marrow samples from newly diagnosed ALL children, the method of this invention was used to detect three fusion genes. The detection rate of different fusion genes was analyzed based on the sample test results.

[0047] The test results are as follows: 1. Design results of the capture probe The following capture probe designs all conform to Figure 2 The region shown is illustrated. Specifically, multiple capture probes were designed: for the fusion gene BCR-ABL1, the capture probe combination was CP-1~CP-7; for the fusion gene ETV6-RUNX1, the capture probe combination was CP-1~CP-5; and for the fusion gene TCF3-PBX1, the capture probe combination was CP-1~CP-5, which can effectively capture the synthetic IVT-RNA of the three fusion genes.

[0048] 2. Design results of connecting probes This invention designs three pairs of ligation probes for each of the three fusion genes (the ligation probes for the fusion gene and the internal reference gene are: Group A, LP1-1P & LP1-2; Group B, LP2-1P & LP2-2; Group C, LP3-1P & LP3-2), as shown in Table 5-7. In each experiment, one pair of ligation probes and all the capture probes are added separately. The design of the fusion gene ligation probes and capture probes conforms to... Figure 2 In the indicated regions, the Ct values ​​were compared, and the probe with the smallest Ct value was selected as the optimal probe. The results showed that for the fusion gene BCR-ABL1, group B was the optimal probe; for the fusion gene ETV6-RUNX1, group A was the optimal probe; and for the fusion gene TCF3-PBX1, group B was the optimal probe. By screening multiple groups of ligation probes that bind to different target regions, we identified the probe sequence with the highest binding efficiency and the best detection sensitivity.

[0049] Table 5 Results of BCR-ABL1 fusion gene ligation probe optimization Table 6 Results of ETV6-RUNX1 fusion gene ligation probe optimization Table 7 Optimization results of the TCF3-PBX1 fusion gene ligation probe 3. Specificity test results The method of this invention was used to specifically analyze the internal reference gene and three fusion genes. The reaction system contained all capture probes (i.e., CP-1~CP-7 shown in SEQ ID NO. 7-13, CP-1~CP-5 shown in SEQ ID NO. 20-24, CP-1~CP-5 shown in SEQ ID NO. 31-35), ligation probes (i.e., LP2-1P shown in SEQ ID NO. 3, LP2-2 shown in SEQ ID NO. 4, LP1-1P shown in SEQ ID NO. 14, LP1-2 shown in SEQ ID NO. 15, LP2-1P shown in SEQ ID NO. 27, LP2-2 shown in SEQ ID NO. 28, and LP shown in SEQ ID NO. 36-41), amplification primers (i.e., UP-F shown in SEQ ID NO. 42, FG-R shown in SEQ ID NO. 43, FG-F shown in SEQ ID NO. 44), and amplification probes (i.e., P1 shown in SEQ ID NO. 45, P2 shown in SEQ ID NO. 46, and LP shown in SEQ ID NO. 36-41), all capture probes (i.e., CP-1~CP-7 shown in SEQ ID NO. 7-13, CP-1~CP-5 shown in SEQ ID NO. 20-24, CP-1~CP-5 shown in SEQ ID NO. 31-35), all ligation probes (i.e., LP2-1P shown in SEQ ID NO. 3, LP2-2 shown in SEQ ID NO. 43, LP1-1P shown in SEQ ID NO. 44, LP2-2 shown in SEQ ID NO. 45, P2 shown in SEQ ID NO. 46, and LP shown in SEQ ID NO. (P3 shown in NO.47 and P4 shown in SEQ ID NO.48) Only one type of IVT-RNA was added to each well. The results showed that all primers and probes could only amplify the corresponding fusion gene, and there was no cross-reaction with other fusion genes. Moreover, the whole blood lysate from healthy individuals could only amplify the internal reference gene ABL1, indicating that this method has good specificity.

[0050] Table 8 Specificity Tests Note: N / A indicates no fluorescent amplification signal. 4. Sensitivity test results Sensitivity tests were performed using standards or IVT-RNA diluted 3-fold as templates, with three replicates for each concentration. The results showed that the limits of detection (LODs) for the BCR-ABL1, ETV6-RUNX1, and TCF3-PBX1 fusion genes in this invention were 75 cps / reaction, 6 cps / reaction, and 29 cps / reaction, respectively, while the LOD for the ABL1 internal reference gene was 81 cps / reaction. This demonstrates that the technique of this invention possesses high sensitivity. Figure 3 ).

[0051] 5. The method of this invention yields positive results in detecting dual fusion genes. The results showed that ( Figure 4The fusion gene IVT-RNA and the internal reference ABL1 gene were prepared into a 1:10000 mixture, which was then simultaneously detected using the method of this invention. ETV6-RUNX1 and BCR-ABL1, and TCF3-PBX1 can be detected simultaneously at a concentration ratio of 1:10000; TCF3-PBX1 and ETV6-RUNX1 can be detected simultaneously at a concentration ratio of 1:100, and simultaneously with BCR-ABL1 at a concentration ratio of 1:1000; BCR-ABL1 and ETV6-RUNX1 can be detected simultaneously at a concentration ratio of 1:100, and simultaneously with TCF3-PBX1 at a concentration ratio of 1:1000. The fact that the probes designed in this invention can be detected at concentrations of 1:100, 1:1000, and 1:10000 indicates that there is no mutual interference between the probes.

[0052] 6. Test results of clinical samples This invention tested whole blood samples from 195 newly diagnosed pediatric ALL patients, and detected 10 cases positive for BCR-ABL1, 35 cases positive for ETV6-RUNX1, and 8 cases positive for TCF3-PBX1.

[0053] The results obtained by the method of this invention were compared with the results obtained by the RT-PCR kit from the bone marrow samples of these children at the time of initial diagnosis. The positive concordance rate of the three fusion genes BCR-ABL1, ETV6-RUNX1 and TCF3-PBX1 was 100%, and the negative concordance rate was 100%, indicating good diagnostic efficacy.

[0054] Using the method of this invention, 29 dried blood smear samples prepared from peripheral whole blood were tested. One case was positive for BCR-ABL1, 24 cases were positive for ETV6-RUNX1, 0 cases were positive for TCF3-PBX1, and 4 samples were negative. The results of this invention showed 100% concordance with those obtained using a clinical bone marrow RT-PCR kit, indicating that the method of this invention is suitable for detecting the three fusion genes and internal reference genes in dried blood smear samples.

[0055] Using the method of this invention, 74 bone marrow samples were tested, and 5 cases were positive for BCR-ABL1, 21 cases were positive for ETV6-RUNX1, 4 cases were positive for TCF3-PBX1, and 44 samples were negative. The detection results of this invention showed 100% concordance with those of clinical bone marrow samples using RT-PCR kits, indicating that the method of this invention is suitable for the detection of the three fusion genes and internal reference genes in bone marrow samples.

[0056] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A primer-probe composition, characterized in that, The primer-probe composition comprises: The first bridging probe group shown in SEQ ID NO.3-4, the second bridging probe group shown in SEQ ID NO.14-15, and the third bridging probe group shown in SEQ ID NO.27-28; The first capture probe group shown in SEQ ID NO.7-13, the second capture probe group shown in SEQ ID NO.20-24, and the third capture probe group shown in SEQ ID NO.31-35; The Taq-Man probe sets shown in SEQ ID NO.45, SEQ ID NO.47 and SEQ ID NO.48; Primer sets for amplifying the fusion genes BCR-ABL1, ETV6-RUNX1, and TCF3-PBX1.

2. The primer-probe composition according to claim 1, characterized in that, The primer sets used to amplify the fusion genes BCR-ABL1, ETV6-RUNX1 and TCF3-PBX1 are shown in SEQ ID NO.43-44.

3. The primer-probe composition according to claim 1 or 2, characterized in that, The primer-probe composition further includes probes and primers for detecting an internal reference gene; wherein the internal reference gene includes the ABL1 gene, and / or the probes for detecting the internal reference gene include a ligation probe and a Taq-Man probe.

4. The primer-probe composition according to claim 3, characterized in that, It must contain at least one of the following characteristics: (1) The ligation probe used to detect the internal reference gene is shown in SEQ ID NO.36-41; (2) The Taq-Man probe used to detect the internal reference gene is shown in SEQ ID NO.46; (3) Primers used to detect the internal reference gene ABL1 are shown in SEQ ID NO.42-43; (4) The Taq-Man probe is modified with a detectable marker; (5) Taq-Man probes have locked nucleic acid modification or MGB modification.

5. A test kit, characterized in that, The detection kit contains the primer and probe composition according to any one of claims 1-4.

6. The use of the primer-probe composition according to any one of claims 1-4 or the detection kit according to claim 5 in the preparation of a detection product for at least one of the fusion genes BCR-ABL1, ETV6-RUNX1 and TCF3-PBX1.

7. The use of the primer-probe composition according to any one of claims 1-4 or the detection kit according to claim 5 in the preparation of leukemia detection products.

8. The application according to claim 7, characterized in that, The detection includes the following steps: (1) Obtain the sample to be tested; (2) Mix the ligation probe and the capture probe with the sample to be tested and incubate for capture reaction. After the reaction is complete, wash away the unhybridized probe and then add it to the ligation system for ligation reaction. After the reaction is complete, mix the product with primers and Taq-Man probe and perform PCR. Determine the detection result based on the PCR result.

9. The application according to claim 7 or 8, characterized in that, The test is a single-tube test.

10. The application according to claim 8, characterized in that, The sample to be tested is a whole blood sample, a dried blood smear sample, or a bone marrow sample.

Citation Information

Patent Citations

  • TaqMan MGB probe real-time fluorescence PCR detection method for leukemia fusion genes, and special primers, probes and kit used by same

    CN102251031A

  • Primer group and method for detecting blood tumor fusion gene

    CN115948553A

  • Kit and method for detecting common fusion genes of lymphoid leukemia based on multiple digital PCR (Polymerase Chain Reaction) method

    CN120485370A