A microfluidic chip for multiplex differential diagnosis of different subtypes of avian influenza virus and its application

Abstract

This invention provides a microfluidic chip for the multiplex differentiation and diagnosis of different avian influenza virus subtypes and its application. Specifically, it is a microfluidic chip based on TaqMan probes that can simultaneously and rapidly differentiate and diagnose 25 avian influenza subtypes, enabling high-throughput simultaneous detection of multiple gene targets. This invention utilizes high-throughput microfluidic chip technology to simplify the differential diagnosis procedure for avian influenza virus subtypes, resulting in more accurate and time-saving results. It is more suitable for rapid clinical diagnosis of avian influenza, providing technical support for rapid clinical detection, diagnosis, and prevention of avian influenza, and is of great significance for epidemic prevention and control and safeguarding public health security.

Description

Technical Field

[0001] This invention belongs to the field of gene detection technology, specifically relating to a microfluidic chip for multiplex differential diagnosis of different subtypes of avian influenza virus and its application. Background Technology

[0002] Avian influenza virus (AIV) is a highly infectious, negative-sense, single-stranded RNA influenza A virus containing eight gene segments, composed of hemagglutinin, neuraminidase, and six internal genes. Influenza A viruses are classified based on differences in their two most abundant surface proteins, hemagglutinin (HA) and neuraminidase (NA), with 16 distinct HA subtypes and 9 distinct NA subtypes infecting poultry. These viruses occur in different combinations, defining the virus. To date, 18 distinct HA proteins (H1-H18) and 11 NA proteins (N1-N11) have been identified, resulting in 198 potential AIV subtype combinations. AIV poses a significant threat to human and animal health, ranging from reduced egg or meat production, increased vaccination costs, and trade restrictions, to severe disease and mass mortality in poultry. Several AIV strains can also infect humans and other mammal species (such as pigs and seals). AIV subtypes that have caused human infection with avian influenza in the past and present include H1, H2, H3, H5, H6, H7, H9, and H10. Existing AIV detection technologies are mostly single-, double-, and triple-detection, which cannot quickly identify the viral subtype during an outbreak.

[0003] Microfluidic chip technology is a technique that integrates basic chemical and biological operating units onto tiny chips. It offers advantages such as small size, ease of operation, and high throughput, effectively improving experimental efficiency and accuracy. The main type of microfluidic device is the micro total analysis system (μTAS), also known as a "lab-on-chip" (LOC) device or a microfluidic paper-based analysis device (μPAD). In recent years, microfluidic chip technology has developed rapidly, giving rise to many new designs and applications. Common signal detection methods in LOC systems include optical detection, magnetoresistive sensors, electrochemical detection, acoustic detection, mass spectrometry, and nuclear magnetic resonance. Isothermal amplification technology integrated into LOC devices has been used to detect pathogens of veterinary significance, such as Cryptosporidium parvum, Escherichia coli, Salmonella typhimurium, and porcine herpesvirus. Currently, many microfluidic platforms are available for microbial extraction and are combined with various analytical methods to detect pathogenic microorganisms.

[0004] Because there are numerous subtypes of avian influenza, and the clinical symptoms and pathological changes of various subtypes are very similar, rapid and accurate identification of the virus type is a prerequisite for precision treatment. While routine clinical detection methods such as virus isolation and immunohistochemistry are accurate, they generally have significant drawbacks, including complex diagnostic procedures and long diagnostic times. Currently, quantitative real-time PCR (qPCR) is a relatively ideal method for diagnosing avian influenza virus subtypes. However, because avian influenza viruses are RNA viruses, their polymerases lack proofreading functions, resulting in a high mutation rate in the genome. Different subtypes also share similar gene sequences, and primers may cross-bind with non-target subtypes or related viruses. Therefore, when designing primers from highly conserved regions, homologous primers to other influenza viruses or host genes may easily lead to non-specific amplification and false positives. Therefore, providing a detection method that can simultaneously and rapidly differentiate and diagnose multiple subtypes of avian influenza is of great significance for the prevention and control of avian influenza. Summary of the Invention

[0005] The purpose of this invention is to provide a microfluidic chip for multiplex identification and diagnosis of different subtypes of avian influenza virus and its application, namely a microfluidic chip based on Taqman probes that can simultaneously and rapidly identify and diagnose 25 subtypes of avian influenza, and can detect multiple gene targets simultaneously with high throughput.

[0006] This invention first provides a Taqman primer-probe combination, which includes primer pairs and probes for detecting different subtypes of avian influenza viruses:

[0007] 1) Primer pairs and probes for detecting the H1 subtype,

[0008] The upstream primer is: 5′-GGCACATATGAYTATCCYA-3′ (SEQ ID NO:1).

[0009] Downstream primer: 5′-CCAGGGAGACTAACAAGAC-3′ (SEQ ID NO:2)

[0010] Probe: 5′-CCACAGTCGCCAGTTCCCT-3′ (SEQ ID NO:3);

[0011] 2) Primer pairs and probes for detecting the H2 subtype,

[0012] The upstream primer 3'-CTAATTGATGGTTGGTATGGTTTCA-5' (SEQ ID NO:4)

[0013] Downstream primer 3'-AATTGCCGATTGAGTGCTTTT-5' (SEQ ID NO:5)

[0014] Probe 3'-CAGAATGCACAGGGAGAGGGAACTGCT-5' (SEQ ID NO:6);

[0015] 3) Primer pairs and probes for detecting the H3 subtype,

[0016] The upstream primer is 3'-ATACCAAGGTGCTATTCGGT-5' (SEQ ID NO:7).

[0017] Downstream primer 3'- CTTACCAGATCTGCTGCTTG-5' (SEQ ID NO:8)

[0018] Probe 3'- TACCAACCATCTATCATTCRTCCC-5' (SEQ ID NO:9);

[0019] 4) Primer pairs and probes for detecting the H4 subtype.

[0020] The upstream primer 3'- GACCCARGGATACAAGGACA-5' (SEQ ID NO:10)

[0021] Downstream primer 3'-ATATGCACCGTCTGGCACC-5' (SEQ ID NO:11)

[0022] Probe 3'-ACCGTTGTGGGCTTGTCCG-5' (SEQ ID NO:12);

[0023] 5) Primer pairs and probes for detecting the H5 subtype,

[0024] The upstream primer is 3'-AGGGAGGATGGCAGGGAATG-5' (SEQ ID NO:13).

[0025] Downstream primer 3'-TCTCCGTCTGCAGCGTACTCACT-5' (SEQ ID NO:14)

[0026] Probe 3'-ATGGTTGGTATGGGTACCACCATAGCAATG-5' (SEQ ID NO:15);

[0027] 6) Primer pairs and probes for detecting the H6 subtype,

[0028] The upstream primer is 3'-TYTGGCATATACGCTGTGACAATG-5' (SEQ ID NO:16).

[0029] Downstream primer 3'-GACTGCTCGCATCACCGTACTATA-5' (SEQ ID NO:17)

[0030] Probe 3'- CCAGAATCGGTAAAGCTGT -5' (SEQ ID NO:18);

[0031] 7) Primer pairs and probes for detecting the H7 subtype.

[0032] The upstream primer is 3'-CTAATTGATGGTTGGTATGGTTTCA-5' (SEQ ID NO:19).

[0033] Downstream primer 3'-AATTGCCGATTGAGTGCTTTT-5' (SEQ ID NO:20)

[0034] Probe 3'-CAGAATGCACAGGGAGAGGGAACTGCT-5' (SEQ ID NO:21);

[0035] 8) Primer pairs and probes for detecting the H8 subtype,

[0036] The upstream primer 3'-CCTTGCGTTTGAATTTTTCTGT-5' (SEQ ID NO:22)

[0037] Downstream primer 3'-TTCGTGGGTTAGAGGTCTGT-5' (SEQ ID NO:23)

[0038] Probe 3'-CAGCTCGGTGACCCCATTCTA-5' (SEQ ID NO:24);

[0039] 9) Primer pairs and probes for detecting the H9 subtype.

[0040] The upstream primer is 3'-GCTGGAATCTGAMGGMACTTACA-5' (SEQ ID NO:25).

[0041] Downstream primer 3'-AATTGGACATGGCCCACCA-5' (SEQ ID NO:26)

[0042] Probe 3'-ATTTTATTCGACTGTCGCCTCATCTCTTG-5' (SEQ ID NO:27);

[0043] 10) Primer pairs and probes for detecting the H10 subtype,

[0044] The upstream primer is 3'-CTAATTGATGGTTGGTATGGTTTCA-5' (SEQ ID NO:28).

[0045] Downstream primer 3'-AATTGCCGATTGAGTGCTTTT-5' (SEQ ID NO:29)

[0046] Probe 3'-CAGAATGCACAGGGAGAGGGAACTGCT-5' (SEQ ID NO:30);

[0047] 11) Primer pairs and probes for detecting the H11 subtype,

[0048] The upstream primer is 3'-CTAATTGATGGTTGGTATGGTTTCA-5' (SEQ ID NO:31).

[0049] Downstream primer 3'-AATTGCCGATTGAGTGCTTTT-5' (SEQ ID NO:32)

[0050] Probe 3'-CAGAATGCACAGGGAGAGGGAACTGCT-5' (SEQ ID NO:33);

[0051] 12) Primer pairs and probes for detecting the H12 subtype,

[0052] The upstream primer 3'-AAGCTGGAATCTGAMGGMACTTAC-5' (SEQ ID NO:34)

[0053] Downstream primer 3'-ATTGGACTATGGCCCAKAAYA-5' (SEQ ID NO:35)

[0054] Probe 3'-ATTTTATTCGACTGTCGCCTCATCTCTTG-5' (SEQ ID NO:36);

[0055] The upstream primer is 3'-AGGAATGGCTAGATGGCTGGTATG-5' (SEQ ID NO:37).

[0056] Downstream primer 3'-TGTCGGTTATTGAGTCCTTAGTCC-5' (SEQ ID NO:38)

[0057] Probe 3'-ACACCAAAATGCTCAGGGCACAGG-5' (SEQ ID NO:39);

[0058] 14) Primer pairs and probes for detecting the H14 subtype,

[0059] The upstream primer is 3'-AAACCAGAGGTCTATTCGGT-5' (SEQ ID NO:40).

[0060] Downstream primer 3'-CTTTTCAGATCTGCTGCTTG-5' (SEQ ID NO:41)

[0061] Probe 3'- TACCAACCATCTATCATTCCTTCCC -5' (SEQ ID NO:42);

[0062] 15) Primer pairs and probes for detecting the H15 subtype,

[0063] The upstream primer 3'- GACCCARGGATACAAGGACA-5' (SEQ ID NO:43)

[0064] Downstream primer 3'-AAATGCAAATCTGGCACC-5' (SEQ ID NO:44)

[0065] Probe 3'- TTGTGGGCTTGTCATG-5' (SEQ ID NO:45);

[0066] 16) Primer pairs and probes for detecting the H16 subtype,

[0067] The upstream primer is 3'-AGGGAGGATGGCAGGGAATG-5' (SEQ ID NO:46).

[0068] Downstream primer 3'-TCTTTGTCTGCAGCGTACCCACT-5' (SEQ ID NO:47)

[0069] Probe 3'-ATGGTTGGTATGGGTACCACCATAGCAATG-5' (SEQ ID NO:48);

[0070] 17) Primer pairs and probes for detecting the N1 subtype,

[0071] The upstream primer 3'-CCAGGTGTTGTTCTCATAGG-5' (SEQ ID NO:49)

[0072] Downstream primer 3'- TCAATCCAAACAGGGAATCA-5' (SEQ ID NO:50)

[0073] Probe 3'- CCAGCCTGAACCATGCAATCAAAGCATC -5' (SEQ ID NO:51);

[0074] 18) Primer pairs and probes for detecting the N2 subtype,

[0075] The upstream primer is 3'-TGGGAACCTTAAGCAAGTGTGC-5' (SEQ ID NO:52).

[0076] Downstream primer 3'- CCTGTCATCCCCAGTGATACAA-5' (SEQ ID NO:53)

[0077] Probe 3'- TAGCATGGTCCCAGCTCAGCTGCCAT-5' (SEQ ID NO:54);

[0078] 19) Primer pairs and probes for detecting the N3 subtype,

[0079] The upstream primer 3'-AATGGTAGATGGCTGGTATGAGG-5' (SEQ ID NO:55)

[0080] Downstream primer 3'-TCGGTTATTGAGTCCTTAGTCCTG-5' (SEQ ID NO:56)

[0081] Probe 3'-ACCAAAATGCTCAGGGCACAGGAC-5' (SEQ ID NO:57);

[0082] 20) Primer pairs and probes for detecting the N4 subtype,

[0083] The upstream primer is 3'-AGGAATGGTAGATGGCTGGTATG-5' (SEQ ID NO:58).

[0084] Downstream primer 3'-TGTCGGTTATTGAGTCCTTAGTCC-5' (SEQ ID NO:59)

[0085] Probe 3'- ACACCAAAATGCTCAGGGCACAGG-5' (SEQ ID NO:60);

[0086] 21) Primer pairs and probes for detecting the N5 subtype,

[0087] The upstream primer 3'-GYACACCATGTGARTCCTTTATCTG-5' (SEQ ID NO:61)

[0088] Downstream primer 3'- GGAATCCAGRAGYGGKTTYG-5' (SEQ ID NO:62)

[0089] Probe 3'- ACAYCCACCCATTWGCGTCCCASA-5' (SEQ ID NO: 63);

[0090] 22) Primer pairs and probes for detecting the N6 subtype,

[0091] The upstream primer 3'-TGCAGGATGTTCGCTCTGAGTC-5' (SEQ ID NO:64)

[0092] Downstream primer 3'-CGAAATGGGATCCTATCATGTAT-5' (SEQ ID NO:65)

[0093] Probe 3'- ACAACACTCAGAGGGCAACATGCGAAT--5' (SEQ ID NO:66);

[0094] 23) Primer pairs and probes for detecting the N7 subtype,

[0095] The upstream primer 3'-CTAACTTGATGGTTGTTATGGTTTCA-5' (SEQ ID NO:67)

[0096] Downstream primer 3'-AATTGCCAAGATTGAGTGCTTT-5' (SEQ ID NO:68)

[0097] Probe 3'-CAGAATGCACAGGGAGAGGGAACTGCT-5' (SEQ ID NO:69);

[0098] 24) Primer pairs and probes for detecting the N8 subtype,

[0099] The upstream primer 3'-TCCATGYTTCCTGGGTTGARATGAT-5' (SEQ ID NO:70)

[0100] Downstream primer 3'-GCTCCATCRTGCCAYGACCA-5' (SEQ ID NO:71)

[0101] Probe 3'-TCHAGYACTCCATTGTRATGTGTGGAGT-5' (SEQ ID NO:72);

[0102] 25) Primer pairs and probes for detecting the N9 subtype,

[0103] The upstream primer 3'-CAGAGGCCTGTTGCAGAAATTCC-5' (SEQ ID NO:73)

[0104] Downstream primer 3'-CCGTTGTGGCATACACATTCAG-5' (SEQ ID NO:74)

[0105] Probe 3'-CACATGGGCCCGAAACATACTAAGAACACA-5' (SEQ ID NO:75);

[0106] Furthermore, the Taqman primer-probe combination also includes universal primer pairs and probes capable of detecting different subtypes of avian influenza viruses.

[0107] M-F3'-GACCRATCCTGCACCTCAGAC-5' (SEQ ID NO:76),

[0108] M-R3'-AGGCCATTYTGGTCAAAKCGTCTA-5' (SEQ ID NO:77),

[0109] M-P3'-TGCAGTCCTCGCTCACTGGGTACG-5' (SEQ ID NO:78).

[0110] Furthermore, the probe is labeled with a fluorescent reporter group at its 5' end and a quencher group at its 3' end;

[0111] Furthermore, the fluorescent reporter group and quencher group are FAM and BHQ1, respectively.

[0112] The present invention also provides the application of the aforementioned primer-probe combination in the preparation of products for detecting different subtypes of avian influenza viruses;

[0113] The product described herein, as a specific example, is a microfluidic chip.

[0114] The present invention also provides a microfluidic chip comprising the above-described primer-probe combination.

[0115] The present invention also provides a method for detecting different subtypes of avian influenza virus for non-disease diagnosis and treatment purposes, which uses the microfluidic chip described above for detection.

[0116] This invention utilizes microfluidic chip technology capable of high-throughput detection to simplify the identification and diagnosis of avian influenza virus subtypes, resulting in more accurate and time-saving diagnostic procedures. It is more suitable for rapid clinical diagnosis of avian influenza, providing technical support for rapid clinical detection, diagnosis, and prevention of avian influenza. This is of great significance for epidemic prevention and control and for ensuring public health security. Attached Figure Description

[0117] Figure 1 Microfluidic chip structure diagram;

[0118] Figure 2 Schematic diagram of sample loading onto a microfluidic chip;

[0119] Figure 3 Microfluidic chip sample loading flowchart;

[0120] Figure 4 Diagram showing the sample addition of the reaction solution to the microfluidic chip.

[0121] Figure 5 : Schematic diagram of the sealing machine handle;

[0122] Figure 6 : Diagram showing the chip being placed into the die-sealing machine;

[0123] Figure 7 : Diagram showing the chip placement position in the die-sealing machine;

[0124] Figure 8 A diagram illustrating whether edge modifications are correct;

[0125] Figure 9 : A diagram showing the prepared chip placed in the sample plate holder of the qPCR instrument;

[0126] Figure 10 Schematic diagram of recombinant plasmid standard preparation;

[0127] Figure 11 : Specific detection results of the TaqMan probe real-time fluorescence quantitative PCR detection method for AIV subtypes H1, H2, N1, N3, N4, and N5;

[0128] Figure 12 Figure 1: Sensitivity detection results of the TaqMan probe real-time fluorescence quantitative PCR detection method for AIV subtypes H1, H2, N1, N3, N4, and N5;

[0129] Figure 13 : Detection result image of chip 1;

[0130] Figure 14 : Detection result image of chip 2;

[0131] Figure 15 : Detection results of chip 3. Detailed Implementation

[0132] This invention, based on the screening and establishment of multiplex TaqMan detection primer pairs and probes, develops a multiplex microfluidic chip capable of high-throughput screening of different subtypes of avian influenza virus samples. A single chip can simultaneously detect 1-8 samples; unlike existing single-tube multiplex technologies, there is no cross-reaction because this chip has 8 sample loading slots, each with 48 reaction wells below it, with each well detecting only one target. By using an ABI reaction plate, the detection of multiple targets / pathogens is achieved by increasing the number of reaction wells, without being limited by the number of fluorescence channels. Figure 1 ).

[0133] The designed primers and probes for various subtypes of avian influenza virus are embedded in the reaction wells in the form of dry powder. 1-8 samples can be detected at a time. Manual operation takes only 5-10 minutes. Each sample well can detect 26 targets (AIV H1-H16 subtype, N1-N9 subtype, universal for AIV). It is universal for avian influenza virus. Only 1μL of reaction system is needed for each reaction well. The test results can be obtained within 90 minutes.

[0134] Features of the innovative TAC microfluidic chip:

[0135] 1. Simple reaction solution preparation: Primers and probes are pre-encapsulated in the reaction wells in dry powder form, which is stable and can be transported at room temperature;

[0136] 2. Flexible target detection: 8 sample wells (1μL reaction system), 25 targets;

[0137] 3. Nucleic acid testing: One-step simultaneous detection, requiring less template;

[0138] 4. Semi-automatic sample loading: Sample loading takes 5-10 minutes, without the need for complex micro-liquid pipetting devices;

[0139] 5. Rapid results: Experimental results are obtained within 90 minutes;

[0140] 6. Reliable results: Spatial multiplexing technology ensures that each experiment is a single experiment, avoiding the steps of optimizing reagents in multiple reactions and cross-contamination;

[0141] 7. High sensitivity: comparable to qPCR single-tube assay results;

[0142] 8. High degree of standardization, eliminating systematic errors and facilitating comparison of results between laboratories.

[0143] The present invention will now be described in detail with reference to the embodiments and accompanying drawings.

[0144] Example 1: Primer and probe design and screening

[0145] Based on the HA and NA gene sequences of avian influenza viruses publicly available in the NCBI database, this study first used MEGA 12.0 software to perform systematic multiple sequence alignment and evolutionary analysis on the obtained sequences to identify and preserve highly conserved regions among different isolates. Subsequently, based on these conserved regions, primers and probes were designed using Oligo 7 software, rigorously screening primer-probe components with high specificity and good amplification efficiency. To ensure the accuracy and specificity of the design, BLAST was used to verify the designed primers and TaqMan probes against the corresponding target genes, confirming their matching degree in the target sequences and ruling out the possibility of non-specific binding.

[0146] We randomly selected 6 subtypes as examples to demonstrate the effectiveness of primers and probes.

[0147] I. Preparation of Recombinant Plasmid Standards

[0148] Standards for subtypes H1, H2, N1, N3, N4, and N5 were prepared separately, such as... Figure 10 As shown.

[0149] II. Specificity Test

[0150] Using nucleic acids of subtypes H1, H2, H3, H4, H5, H6, H7, H9, H10 AIV, NDV, and IBV as templates, amplification was performed using the established real-time quantitative PCR system and conditions. ddH2O was used as a negative control to test the specificity of the established TaqMan probe real-time quantitative PCR detection method for subtypes H1, H2, N1, N3, N4, and N5 AIV. The results are as follows: Figure 11 As shown, only the detected AIV subtype was positive, exhibiting a typical S-shaped amplification curve, while the detection results for other AIV, IBV, and NDV subtypes were all negative, indicating that the established detection method has good specificity. The results for the remaining subtypes also showed good specificity and no mutual interference.

[0151] III. Sensitivity Test

[0152] With 1.0×10 5 copies / μL~1.0×10 0 Using recombinant plasmid standards (copies / μL) as templates, the sensitivity of the AIV TaqMan probe real-time quantitative PCR method established in this study for H1, H2, N1, N3, N4, and N5 subtypes was detected. Results are as follows: Figure 12 As shown in Table 1, the detection limits for H1, H2, N1, N3, and N5 are 1 × 10⁻⁶. 1 The detection limit for N4 is 1 × 10 copies / μL. 2 The results showed that the established detection method had good sensitivity, which was higher than that of conventional PCR. The detection limits for the remaining subtypes (H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, N2, N6, N7, N8, and N9) were 1 × 10⁻⁶. 1 The detection limits for H14, H15, and H16 are 1×10⁻⁶ copies / μL. 2 Both copies / μL showed good sensitivity.

[0153] Table 1: Detection Sensitivity Data for Primer Pairs and Probe Combinations

[0154]

[0155] Note: "--" indicates that the test result did not show a specific CT value, which means it is negative.

[0156] The results of specificity and sensitivity studies indicate that the designed primer pairs and probe combinations exhibit good specificity and sensitivity for detecting different subtypes of avian influenza virus, reducing the risk of false positives. This is of great significance in practical diagnosis because the pathogen load of AIV infection is often low in the early stages of infection, allowing for earlier positive detection, thus shortening the diagnosis time, accelerating the initiation of control measures, and providing a data foundation for clinical assessment of disease progression, evaluation of treatment effectiveness, and monitoring of asymptomatic infections. The high sensitivity reduces false negatives, making it more suitable for clinical testing. In avian influenza surveillance and early intervention, this provides technical support for rapid clinical detection, diagnosis, and control of AIV, which is of great significance for epidemic prevention and control and ensuring public health security.

[0157] Example 2: Construction of a multi-microfluidic chip

[0158] The chip fabrication method is as follows:

[0159] 1. A positive mold with micro-reaction cavities and channel structures is fabricated on a silicon wafer using the standard SU-8 photolithography process, with each unit corresponding to an independent reaction. PDMS is poured onto the mold, cured, and then peeled off to obtain a PDMS layer with microstructures. Holes are then drilled in the layer to form interfaces.

[0160] 2. The PDMS layer is permanently bonded to a flat glass sheet after oxygen plasma treatment. The bottom of the glass sheet will be in direct contact with the external temperature control system to achieve efficient thermal cycling. Before chip bonding, the inner surfaces of the PDMS and glass are chemically modified.

[0161] 3. Pre-quantitatively spot the contents of Taq DNA polymerase, dNTPs, primers, and TaqMan probes into each reaction chamber.

[0162] The liquid in the chamber is freeze-dried under low temperature and vacuum conditions to form a solid freeze-dried powder.

[0163] 4. After freeze-drying, the reaction chamber needs to be completely sealed with a PDMS to isolate moisture and air, ensuring the stability of the freeze-dried powder and allowing it to be transported at room temperature.

[0164] The chip is used as follows:

[0165] I. Preparation of reaction solution for microfluidic chip:

[0166] 1-Step RT-qPCR Master Mix, 25 μL

[0167] Total nucleic acid (gDNA / gRNA) 50 μL

[0168] 25 μL of nuclease-free deionized water

[0169] 100 μL total volume per sample

[0170] II. Chip Sampling and Sealing

[0171] 1. Extract viral nucleic acid from various AIV subtypes, including H1N2, according to the instructions of the RNA virus extraction kit, and prepare a 100 μL reaction system. Figure 2 , Figure 3 As shown, tilt the pipette tip (approximately 45°) and insert it into the sample well (i.e., the Fillport in the image below). Inject 100 μL of the prepared reaction solution into the sample well of the microfluidic chip. Be careful to move gently and evenly, avoiding overflow or air bubbles. During injection, the sample will flow from the Fillport to the Ventport and accumulate in the funnel-shaped space of the sample well.

[0172] 2. Insert the chip with the sample onto the card holder, ensuring the sample loading port is facing upwards and the reaction port is facing the marked side of the adapter. If there are empty spaces in the adapter, fill them with a balancing chip.

[0173] 3. Insert the adapter with the chip installed into the centrifuge basket, with the marked side of the adapter facing outwards.

[0174] 4. Place the basket into the centrifuge and balance it. Then centrifuge twice at 1200 rpm, 1 minute each time.

[0175] 5. Remove the centrifuged chip and confirm that the reaction solution has flowed into the reaction wells and that the remaining liquid volume in each well is consistent (e.g., ...). Figure 4 (Leftmost image); If a large amount of reaction solution remains in a certain sample loading tank (e.g.) Figure 4 (See image in the middle). You can centrifuge the chip for another minute. However, if the reaction solution remains in the sample well after another centrifugation, it indicates a problem with sample loading into the reaction wells, and it is recommended to replace the chip with a new one. If the reaction solution in a sample well completely drains out (e.g., ...), Figure 4 (See the rightmost image) It is also recommended to replace it with a new chip.

[0176] 6. Ensure the sealing machine's carrier is in the starting position (see...). Figure 5 )

[0177] 7. Place the centrifuged chip into the die sealer with the foil side facing up and the sample feeding port facing the end of the handle.

[0178] The direction of position Figure 6 , Figure 7 The chip should be placed at the same height as the die sealer. Hold the handle and push it slowly and smoothly in the direction of the arrow, moving it across the entire chip to the end of the die sealer.

[0179] 8. Remove the chip by the side and confirm that the chip is properly sealed (the scratches should be consistent with the position of the chip's main channel; if they are inconsistent or the aluminum foil is damaged, the chip cannot be used).

[0180] 9. Move the sealing machine handle back to the starting position for the next use.

[0181] 10. Use scissors to cut off the sample loading area along the edge of the chip. Be careful to cut along the outline of the amplification plate, avoiding any edge residue. Figure 8 .

[0182] Place the prepared chip into the qPCR instrument sample plate holder. The reaction wells should face upwards, the metal foil downwards, and the A1 well should be aligned with the top left corner. Figure 9 And run the pre-configured test program.

[0183] IV. Results Analysis

[0184] 1. Export the results of the three experiments to an Excel spreadsheet. Process the data using the Excel spreadsheet based on the Ct values ​​and corresponding standard concentrations, and plot a standard curve: Based on the standard amplification results, plot the standard curve with the Ct value on the X-axis and the standard copy number concentration on the Y-axis, establish a linear equation, and obtain the linearity R. 2value.

[0185] 2. Calculate amplification efficiency: The amplification efficiency of each target is calculated from the slope of the standard curve. The amplification efficiency of each target should be within the range of 90%-105%, R0. 2 The value should be close to 1.

[0186] Example 3: Testing actual samples using three chips.

[0187] Chip 1 and Chip 2 each have 8 sample wells (ports). Seven ports on each chip are used to add a different positive sample, and one port is used as a negative control. The detection results show good specificity; the positive sample and the internal reference gene exhibit typical S-shaped amplification curves with no cross-reactivity. The negative control showed no positive signal, indicating good sensitivity (e.g., ...). Figure 13 , Figure 14 ).

[0188] Chip 3, with all subtype-positive samples added to the same port and the other ports set as negative controls, still showed good detection results. Figure 15 All positive results within the same port exhibited typical S-shaped amplification curves, showing good correspondence. No positive signal was observed in the negative control.

Claims

1. A Taqman primer-probe combo, characterized in that, The primer-probe combination contains primer pairs and probes for detecting different subtypes of avian influenza viruses: 1) Primer pair and probe for detecting H1 subtype, the sequence of the upstream primer is SEQ ID NO:1, the sequence of the downstream primer is SEQ ID NO:2, and the sequence of the probe is SEQ ID NO:3; 2) Primer pair and probe for detecting H2 subtype, wherein the sequence of the upstream primer is SEQ ID NO:4, the sequence of the downstream primer is SEQ ID NO:5, and the probe sequence is SEQ ID NO:6; 3) Primer pair and probe for detecting H3 subtype, wherein the sequence of the upstream primer is SEQ ID NO:7, the sequence of the downstream primer is SEQ ID NO:8, and the sequence of the probe is SEQ ID NO:9; 4) Primer pair and probe for detecting H4 subtype, wherein the sequence of the upstream primer is SEQ ID NO:10, the sequence of the downstream primer is SEQ ID NO:11, and the sequence of the probe is SEQ ID NO:12; 5) Primer pair and probe for detecting H5 subtype, wherein the sequence of the upstream primer is SEQ ID NO:13, the sequence of the downstream primer is SEQ ID NO:14, and the sequence of the probe is SEQ ID NO:15; 6) Primer pair and probe for detecting H6 subtype, wherein the sequence of the upstream primer is SEQ ID NO:16, the sequence of the downstream primer is SEQ ID NO:17, and the sequence of the probe is SEQ ID NO:18; 7) Primer pair and probe for detecting H7 subtype, wherein the sequence of the upstream primer is SEQ ID NO:19, the sequence of the downstream primer is SEQ ID NO:20, and the sequence of the probe is SEQ ID NO:21; 8) Primer pair and probe for detecting H8 subtype, wherein the sequence of the upstream primer is SEQ ID NO:22, the sequence of the downstream primer is SEQ ID NO:23, and the sequence of the probe is SEQ ID NO:24; 9) Primer pair and probe for detecting H9 subtype, wherein the sequence of the upstream primer is SEQ ID NO:25, the sequence of the downstream primer is SEQ ID NO:26, and the sequence of the probe is SEQ ID NO:27; 10) Primer pairs and probes for detecting H10 subtype, wherein the sequence of the upstream primer is SEQ ID NO:28, the sequence of the downstream primer is SEQ ID NO:29, and the sequence of the probe primer is SEQ ID NO:30; 11) Primer pairs and probes for detecting H11 subtype, wherein the sequence of the upstream primer is SEQ ID NO:31, the sequence of the downstream primer is SEQ ID NO:32, and the sequence of the probe primer is SEQ ID NO:33; 12) Primer pairs and probes for detecting H12 subtype, wherein the sequence of the upstream primer is SEQ ID NO:34, the sequence of the downstream primer is SEQ ID NO:35, and the sequence of the probe primer is SEQ ID NO:36; 13) Primer pairs and probes for detecting H13 subtype, wherein the sequence of the upstream primer is SEQ ID NO:37, the sequence of the downstream primer is SEQ ID NO:38, and the sequence of the probe primer is SEQ ID NO:39; 14) Primer pair and probe for detecting H14 subtype, wherein the sequence of the upstream primer is SEQ ID NO:40, the sequence of the downstream primer is SEQ ID NO:41, and the sequence of the probe primer is SEQ ID NO:42; 15) Primer pairs and probes for detecting H15 subtype, wherein the sequence of the upstream primer is SEQ ID NO:43, the sequence of the downstream primer is SEQ ID NO:44, and the sequence of the probe primer is SEQ ID NO:45; 16) Primer pairs and probes for detecting H16 subtype, wherein the sequence of the upstream primer is SEQ ID NO:46, the sequence of the downstream primer is SEQ ID NO:47, and the sequence of the probe primer is SEQ ID NO:48; 17) Primer pairs and probes for detecting N1 subtype, wherein the sequence of the upstream primer is SEQ ID NO:49, the sequence of the downstream primer is SEQ ID NO:50, and the sequence of the probe primer is SEQ ID NO:51; 18) Primer pair and probe for detecting N2 subtype, wherein the sequence of the upstream primer is SEQ ID NO:52, the sequence of the downstream primer is SEQ ID NO:53, and the sequence of the probe primer is SEQ ID NO:54; 19) Primer pair and probe for detecting N3 subtype, wherein the sequence of the upstream primer is SEQ ID NO:55, the sequence of the downstream primer is SEQ ID NO:56, and the sequence of the probe primer is SEQ ID NO:57; 20) Primer pair and probe for detecting N4 subtype, wherein the sequence of the upstream primer is SEQ ID NO:58, the sequence of the downstream primer is SEQ ID NO:59, and the sequence of the probe primer is SEQ ID NO:60; 21) Primer pairs and probes for detecting the N5 subtype, wherein the sequence of the upstream primer is SEQ ID NO:61, the sequence of the downstream primer is SEQ ID NO:62, and the sequence of the probe primer is SEQ ID NO:63; 22) Primer pair and probe for detecting N6 subtype, wherein the sequence of the upstream primer is SEQ ID NO:64, the sequence of the downstream primer is SEQ ID NO:65, and the sequence of the probe primer is SEQ ID NO:66; 23) Primer pair and probe for detecting N7 subtype, wherein the sequence of the upstream primer is SEQ ID NO:67, the sequence of the downstream primer is SEQ ID NO:68, and the sequence of the probe primer is SEQ ID NO:69). 24) Primer pair and probe for detecting N8 subtype, wherein the sequence of the upstream primer is SEQ ID NO:70, the sequence of the downstream primer is SEQ ID NO:71, and the sequence of the probe primer is SEQ ID NO:72; 25) Primer pair and probe for detecting N9 subtype, wherein the sequence of the upstream primer is SEQ ID NO:73, the sequence of the downstream primer is SEQ ID NO:74, and the sequence of the probe primer is SEQ ID NO:

75.

2. The Taqman primer-probe combination as described in claim 1, characterized in that, The primer-probe combination also includes universal primer pairs and probes capable of detecting different subtypes of avian influenza viruses.

3. The Taqman primer-probe combination as described in claim 2, characterized in that, The universal primer pair and probe capable of detecting different subtypes of avian influenza virus have the following sequence: upstream primer sequence is SEQ ID NO:76, downstream primer sequence is SEQ ID NO:77, and probe sequence is SEQ ID NO:

78.

4. The Taqman primer-probe combination as described in any one of claims 1-3, characterized in that, The probe is labeled with a fluorescent reporter group at its 5' end and a quencher group at its 3' end.

5. The Taqman primer-probe combination as described in claim 4, characterized in that, The fluorescent reporter group and quencher group are FAM and BHQ1, respectively.

6. The use of the Taqman primer-probe combination according to claim 1 in the preparation of products for detecting different subtypes of avian influenza virus.

7. The application as described in claim 6, characterized in that, The product in question is a microfluidic chip.

8. A microfluidic chip, characterized in that, The chip contains the Taqman primer-probe combination as described in claim 1.

9. A method for detecting different subtypes of avian influenza virus for non-disease diagnosis and treatment purposes, characterized in that, The method described herein uses the microfluidic chip as described in claim 8 for detection.

Images