Detection method for detecting Sf9 host DNA residue by using fluorescent probe and application

Abstract

The invention provides a detection method for detecting Sf9 host DNA residues by using a fluorescent probe and application, and belongs to the technical field of biological detection.According to the method, a specific primer pair (such as SEQIDNO: 1 / 2) and the fluorescent probe (such as SEQIDNO: 11) are designed according to a high-copy conserved sequence of Sf9 host DNA, a kit containing a gene amplification solution, a standard substance and a quality control substance is matched, DNA is extracted through a liquid nitrogen grinding-column extraction method, and the detection result is accurate. And carrying out real-time fluorescent quantitative PCR amplification and then carrying out detection. According to the method, the detection sensitivity reaches 0.003 pg / mu L, the linear range is 300 pg / mu L-0. 003 pg / mu L, cross reaction to irrelevant DNA is avoided, the repeatability CV% is smaller than or equal to 10%, the reagent is still stable after being frozen and thawed for 10 times, and the whole process is completed within 1.5 hours; the method solves the problems of insufficient specificity and sensitivity, tedious operation and the like of the existing method, and can be used for quality control of biological products such as gene therapy drugs and cell vaccines.

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, and in particular to a detection method and application for detecting residual Sf9 host DNA using a fluorescent probe. Background Technology

[0002] In the research and development and production of biotherapeutic drugs such as gene therapy and cell vaccines, the Sf9 cell line is widely used due to its high efficiency in recombinant protein expression and its advantages in viral vector preparation. However, residual Sf9 host cell DNA in biopharmaceuticals may carry oncogenes or trigger immune responses, posing potential biosafety risks. Therefore, strict detection of its residual amount is a core aspect of biopharmaceutical quality control.

[0003] Currently, methods for detecting residual host cell DNA mainly include molecular hybridization, conventional PCR, and real-time quantitative PCR. Molecular hybridization is cumbersome, has a long detection cycle, and suffers from poor sensitivity and specificity, making it difficult to meet the detection requirements of modern biopharmaceuticals. While conventional PCR is relatively simple to operate, its quantitative accuracy is insufficient and it is easily affected by interference, leading to false positive results. Existing real-time quantitative PCR methods, when detecting Sf9 host DNA, suffer from problems such as weak primer and probe specificity, insufficient detection sensitivity, and poor robustness, failing to effectively distinguish interference from irrelevant DNA and thus failing to meet the stringent requirements of biotherapeutic drugs for detection methods. Therefore, a detection method and its application for detecting Sf9 host DNA residue using fluorescent probes are proposed. Summary of the Invention

[0004] In view of this, the present invention provides a detection method and application for detecting Sf9 host DNA residues using fluorescent probes, in order to solve or alleviate the technical problems existing in the prior art, and at least provide a beneficial alternative.

[0005] The technical solution of the present invention is implemented as follows: a specific primer pair for detecting Sf9 host DNA residues, comprising an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:1 and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:2; the upstream and downstream primers are designed for high-copy conserved sequences of Sf9 host DNA, and the absolute value of the Tm temperature difference between the upstream and downstream primers is ≤1℃.

[0006] Furthermore, for any of the following combinations: Combination 1: The upstream primer sequence is shown in SEQ ID NO:3, and the downstream primer sequence is shown in SEQ ID NO:4; Combination 2: The upstream primer sequence is shown in SEQ ID NO:5, and the downstream primer sequence is shown in SEQ ID NO:6; Combination 3: The upstream primer sequence is shown in SEQ ID NO:7, and the downstream primer sequence is shown in SEQ ID NO:8; Combination 4: The upstream primer sequence is shown in SEQ ID NO:9, and the downstream primer sequence is shown in SEQ ID NO:10.

[0007] A fluorescent probe for detecting Sf9 host DNA residues, used in conjunction with the above-mentioned specific primer pair, wherein the nucleotide sequence of the fluorescent probe is any of the following: SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15; the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

[0008] Further, the fluorescent reporter group is selected from FAM, NEX, ROX, TET, JOE, VIC, CY3, CY5 or Texas Red, and the fluorescent quencher group is selected from BHQ, TAMRA, Eclipse, Dabcyl, Lowa Black™ RQ or Lowa Black™ FQ; preferably, the fluorescent reporter group is FAM and the fluorescent quencher group is TAMRA.

[0009] A kit for detecting residual Sf9 host DNA, comprising any of the above-mentioned specific primer pairs, any of the above-mentioned fluorescent probes, and further comprising gene amplification solution, enzyme-free water (DEPC water), Sf9 DNA standard, positive control and negative control; The gene amplification solution is 2×TaqMan qPCR Mix, containing Taq DNA polymerase, dNTPs, and magnesium ions; The Sf9 DNA standard had a concentration of 30 ng / μL. Agarose gel electrophoresis confirmed that the band was single and free of impurities, with a purity ≥95% and an A260 / A280 ratio of 1.823-1.826. The positive control is a DNA solution containing a specific conserved region sequence of Sf9 host DNA, as shown in SEQ ID NO:16; The negative control was enzyme-free water (DEPC water).

[0010] Further, the amounts of each component added to the 30 μL reaction system in the kit are as follows: 15.0 μL of 2×TaqManqPCR Mix, 0.6 μL of upstream primer, 0.6 μL of downstream primer, 0.3 μL of fluorescent probe, 3.5 μL of DEPC water, and 10.0 μL of template; the final concentration of the upstream primer is 0.2 μM, the final concentration of the downstream primer is 0.2 μM, and the final concentration of the fluorescent probe is 0.1 μM; the optimal detection combination is when the primer pair shown in SEQ ID NO:1 / 2 is combined with the probe shown in SEQ ID NO:11.

[0011] A method for detecting Sf9 host DNA residues includes the following steps: S1. Sample Pretreatment: DNA was extracted from the biological product samples to be tested using liquid nitrogen grinding combined with column extraction. The specific steps were as follows: centrifugation at 4000g for 5 min to collect bacterial cells → grinding with liquid nitrogen to powder → adding Buffer GSL and RNase A, lysing in a 70℃ water bath for 10 min → adding Buffer PSS for purification → isopropanol precipitation → washing with Buffer GW1 / GW2 → elution with Buffer TB to obtain the DNA solution to be tested; Sf9 DNA standard was serially diluted with DEPC water to prepare a series of standard solutions of 300 pg / μL, 30 pg / μL, 3 pg / μL, 0.3 pg / μL, 0.03 pg / μL, and 0.003 pg / μL, and negative control samples were also prepared. S2. Preparation of reaction system: Using the above kit, prepare a 30 μL reaction system according to the above proportions; S3. PCR Amplification: Place the reaction system in a real-time quantitative PCR instrument and execute the following program: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s, 60℃ annealing extension for 1 min (read fluorescence signal), for a total of 40 cycles; S4. Results Analysis: A standard curve was plotted based on the amplification results of the standard series solutions. The logarithm of the standard concentration was plotted on the x-axis, and the corresponding Ct value was plotted on the y-axis. Linear regression analysis was performed using the least squares method. The correlation coefficient R of the standard curve was calculated. 2 ≥0.999, amplification efficiency of 90%-110%; based on the Ct value of the sample to be tested, the residual concentration of Sf9 host DNA in the sample to be tested is calculated in combination with the standard curve.

[0012] Furthermore, the detection sensitivity of the method is 0.003 pg / μL (fg level), and the linear range is 0.003 pg / μL - 300 pg / μL; the Ct values of the detection of irrelevant DNAs such as CHO cells, HEK293 cells, E. coli, and Pichia pastoris are all greater than 35 or not detected, without cross-reaction; the CV% of three parallel detections of the same sample is ≤ 10%, and the CV% of the detection result after the nucleic acid amplification solution is repeatedly frozen and thawed 10 times is ≤ 13.9%, and the repeatability and durability of the method are good.

[0013] The detection method further includes a quality control step: S11. The negative control product should meet the following requirements: the Ct value of the FAM channel shows 0 or is not detected, and there is no obvious S-shaped amplification curve; S12. The positive control product should meet the following requirements: there is a Ct value in the FAM channel and Ct ≤ 40, there is an obvious S-shaped amplification curve, the amplification efficiency is 90% - 110%, and the correlation coefficient R 2 ≥ 0.999; S13. If the negative control product and the positive control product do not meet the above requirements, or the amplification efficiency of the standard curve exceeds the range of 90% - 110%, or R 2 < 0.999, it is determined that this experiment is invalid and needs to be retested; S14. Interpretation of the results of the test sample: If the Ct value ≤ 40 and there is an obvious S-shaped amplification curve, it is determined that the Sf9 host DNA residue is positive; if the Ct value > 40 or is not detected, it is determined to be negative; if 40 < Ct value ≤ 44, it is recommended to repeat the detection. If the result after repetition is still 40 < Ct value ≤ 44, it is determined to be positive, and if there is no amplification, it is determined to be negative.

[0014] The application of the above specific primer pair, fluorescent probe, and kit in the quality control of biotherapeutic drugs, wherein the biotherapeutic drugs include gene therapy drugs, cell vaccines, and recombinant protein drugs, and the drugs use Sf9 cells as an expression system or production raw material.

[0015] Due to the adoption of the above technical solutions in the embodiments of the present invention, it has the following advantages: First, the primer pair and fluorescent probe of the present invention are both designed for the high-copy conserved sequence (SEQ ID NO: 16) of Sf9 host DNA. After verification by NCBI Blast comparison, there is no homologous interference, and it is confirmed through a specificity experiment that the Ct values of the detection of 8 common interfering DNAs such as CHO cells, HEK293 cells, Candida albicans, and Staphylococcus aureus are all > 35 or not detected, without cross-reaction. The amplification specificity of the optimal primer-probe combination (Sf-F1 / Sf-R1 / Sf-P1) reaches 100%, completely solving the core problem of insufficient specificity in the background technology and ensuring the accuracy of the detection result.

[0016] II. This invention improves the detection sensitivity to 0.003 pg / μL (fg level) by optimizing the Tm value matching degree of primers and probes (absolute value of the Tm difference between forward and reverse primers ≤1℃), the component ratio of the reaction system, and the amplification program. This is more than 3000 times more sensitive than traditional methods. This sensitivity fully covers the limits for residual host DNA in biological products (100 pg~10 ng / dose) in the 2020 edition of the Chinese Pharmacopoeia and EP, USP, and WHO. It can effectively detect extremely low concentrations of residual DNA, filling the gap in low concentration detection in the prior art.

[0017] Third, the detection method established in this invention uses liquid nitrogen grinding combined with column extraction for rapid DNA extraction, with the entire extraction process taking only 30 minutes; the PCR amplification program consists of only 40 cycles (total time approximately 1.5 hours), requiring no subsequent processing, and the results are directly read through fluorescence signals. Simultaneously, the kit includes a complete set of components such as premixed solutions, standards, and quality control materials, allowing for direct preparation of the reaction system. The operation is simple and easy to learn, requiring no highly skilled technical personnel, thus solving the problems of complex and time-consuming operations and meeting the needs for rapid detection of batch samples.

[0018] The above overview is for illustrative purposes only and is not intended to be limiting in any way. In addition to the illustrative aspects, embodiments, and features described above, further aspects, embodiments, and features of the invention will become readily apparent from the accompanying drawings and the following detailed description. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 This is a diagram illustrating the components of the reagent kit of the present invention; Figure 2 Figure 1 shows the repeatability of the Sf9 DNA-method validation of this invention. Figure 3 Figure 2 shows the repeatability of the Sf9 DNA-method validation of this invention. Figure 4 Figure 3 shows the repeatability of the Sf9 DNA method of this invention. Figure 5 This is the standard curve diagram of Sf9-F0 of the present invention; Figure 6 This is a graph from the Sf9-F0 experimental results report of the present invention; Figure 7 This is the standard curve diagram of Sf9-F1 of the present invention; Figure 8 This is a diagram from the Sf9-F1 experimental results report of the present invention; Figure 9 This is the standard curve diagram of Sf9-F2 of the present invention; Figure 10 This is a report figure of the experimental results of Sf9-F2 in this invention; Figure 11 This is the standard curve diagram of Sf9-F3 of the present invention; Figure 12 This is a diagram from the Sf9-F3 experimental results report of the present invention; Figure 13 This is the standard curve diagram of Sf9-F4 of the present invention; Figure 14 This is a diagram from the experimental results report of Sf9-F4 of the present invention; Figure 15 This is the standard curve diagram of Sf9-F5 of the present invention; Figure 16 This is a diagram from the experimental results report of the Sf9-F5 of this invention. Detailed Implementation

[0021] In the following description, only certain exemplary embodiments are briefly described. As those skilled in the art will recognize, the described embodiments can be modified in various ways without departing from the spirit or scope of the invention. Therefore, the drawings and description are considered to be exemplary in nature and not restrictive.

[0022] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings.

[0023] like Figure 1-16 As shown, this invention provides a method and application for detecting Sf9 host DNA residues using fluorescent probes. The technical solution of this invention will be described in detail below with reference to specific experimental materials, instruments, steps, results and analysis. All experimental operations strictly follow the conventional experimental specifications of molecular biology to ensure the accuracy and reproducibility of experimental results.

[0024] I. Experimental Materials and Instruments (a) Experimental materials 1. Primers and probes: All specific primer pairs and fluorescent probes used in this invention were synthesized by Sangon Biotech (Shanghai) Co., Ltd. After synthesis, they were purified by high performance liquid chromatography (HPLC) with a purity of ≥98%, which meets the requirements of real-time quantitative PCR experiments.

[0025] The core primer pair includes upstream primer Sf-F1 (sequence: CCTAACGCCTCCCATCAACT, SEQ ID NO:1) and downstream primer Sf-R1 (sequence: TGTGGCACAGGTAATCGTCT, SEQ ID NO:2). Alternative primer pairs include combination 1 (upstream primer Sf-F0: ACGTACCAATGCTAGTGGCT, SEQ ID NO:3; downstream primer Sf-R0: AGAAATGGCTCGTGTTGTCG, SEQ ID NO:4). Combination 2 (upstream primer Sf-F2: ATATCGAGCACAGCTTGGGT, SEQ ID NO:5; downstream primer Sf-R2: CCAGGCAGCATCATGACTTT, SEQ ID NO:6); Combination 3 (upstream primer Sf-F3: GGTTTGATCGCTTGCCAGTT, SEQ ID NO:7; downstream primer Sf-R3: ACCCAAGCTGTGCTCGATA, SEQ ID NO:8); Combination 4 (upstream primer Sf-F4: CACAGCTTGCTTGACACCAT, SEQ ID NO:9; downstream primer Sf-R4: AGGAAGTCTCGGATCAGTTTGT, SEQ ID NO:10).

[0026] The fluorescent probes include the preferred probe Sf-P1 (sequence: FAM-TGCTAGTGGCTCTCGCAGCCA-TAMRA, SEQ ID NO: 11) and alternative probes Sf-P0 (sequence: FAM-TGCCACAGCTTGCTTGACACCA-TAMRA, SEQ ID NO: 12), Sf-P2 (sequence: FAM-TCAGGGTTGTTCCAAATCTCGCGC-TAMRA, SEQ ID NO: 13), Sf-P3 (sequence: FAM-CCGCAACCAGCATCCAGAGATGTTG-TAMRA, SEQ ID NO: 14), and Sf-P4 (sequence: FAM-ACCACTATTGTCGACAACACGAGCCA-TAMRA, SEQ ID NO: 15). All primer pairs and probes are designed for high-copy conserved sequences of Sf9 host DNA (SEQ ID NO:16) to ensure specific binding to the target sequence.

[0027] 2. Core components of the kit: 2×TaqMan qPCR Mix was purchased from BBI Life Sciences. It contains thermostable Taq DNA polymerase, a mixture of dNTPs, magnesium ions, and the buffer system required for PCR reactions, meeting the high-efficiency amplification requirements of real-time quantitative PCR; enzyme-free water (DEPC water) was purchased from Sigma-Aldrich, DEPC treated and autoclaved, free from RNase and DNase contamination, and used for reaction system preparation and sample dilution; Sf9 DNA standards were prepared in-house. The specific process was as follows: frozen Sf9 cells (purchased from the China Center for Type Culture Collection) were taken, thawed, and cultured to scale up. The cells were collected by centrifugation at 4000g for 5 min. Genomic DNA was extracted using liquid nitrogen grinding combined with column extraction, and the concentration was calibrated to 30 μL using a UV spectrophotometer. The purity was verified by 1% agarose gel electrophoresis at ng / μL, showing a single band without any impurities, an A260 / A280 ratio of 1.823-1.826, and a purity ≥95%. The sample was aliquoted and stored at -20℃ for later use. The positive control was a solution of recombinant plasmid DNA containing the specific conserved region sequence of Sf9 host DNA as shown in SEQ ID NO:16, prepared in our laboratory at a concentration of 10 pg / μL, used to monitor the validity of the experiment. The negative control was enzyme-free water (DEPC water) used to eliminate contamination interference during the experiment.

[0028] 3. Nucleic acid extraction reagents: All nucleic acid extraction reagents were purchased from Tiangen Biotech (Beijing) Co., Ltd., including Buffer GSL (cell lysis buffer), Buffer PSS (protein precipitation buffer), Filter FQ column (for removing impurities), adsorption column (for DNA adsorption), Buffer GW1 and Buffer GW2 (washing buffer), and Buffer TB (elution buffer); RNase A was purchased from Thermo Fisher Scientific at a concentration of 10 mg / mL to remove RNA contamination during the extraction process.

[0029] 4. Interfering DNA Samples: To verify the specificity of the method of this invention, a variety of common irrelevant DNA samples were selected, including CHO cell and HEK293 cell genomic DNA (purchased from the Cell Bank of the Chinese Academy of Sciences Type Culture Collection Committee), E. coli, Pichia pastoris, Candida albicans, and Staphylococcus aureus genomic DNA (purchased from the China Industrial Microbial Culture Collection Center). The concentration of all interfering DNA samples was adjusted to 3 pg / μL and stored at -20℃ for later use.

[0030] 5. Actual test samples: Three batches of gene therapy drug samples with Sf9 cells as the expression system (provided by a biopharmaceutical company) were selected. All samples were in lyophilized powder form and were reconstituted with enzyme-free water to a specified volume before use to verify the applicability of the method of the present invention in actual sample testing.

[0031] (II) Experimental Instruments The main instruments used in the experiment include: Real-time quantitative PCR instrument (model: Bio-Rad CFX96, Bio-Rad Laboratories, USA) is used for PCR amplification and fluorescence signal acquisition; High-speed refrigerated centrifuge (model: Eppendorf 5810R, Eppendorf GmbH, Germany) is used for centrifugation operations during bacterial cell collection and nucleic acid extraction. A constant temperature water bath (model: HH-S6, Shanghai Jinghong Experimental Equipment Co., Ltd.) is used for cell lysis during nucleic acid extraction. Agarose gel electrophoresis apparatus (model: Bio-Rad PowerPac Basic, Bio-Rad Corporation, USA) is used for DNA purity and integrity verification; Ultraviolet spectrophotometer (model: Nanodrop 2000, Thermo Fisher Scientific, USA) is used for DNA concentration and purity determination; Clean bench (model: SW-CJ-1FD, Suzhou Purification Equipment Co., Ltd.), used for aseptic operation; High-pressure steam sterilizer (model: MLS-3750, Sanyo Corporation, Japan) is used for sterilizing laboratory equipment; Refrigerator (model: DW-86L388, Haier Group) is used for the low-temperature preservation of samples and reagents.

[0032] II. Experimental Methods (I) Preparation and Certification of Sf9 DNA Standards 1. Sf9 cell culture and cell collection: Frozen Sf9 cells were cultured in Grace's insect cell culture medium containing 10% fetal bovine serum at 27°C under CO2-free conditions with shaking for 48-72 hours, until the cell density reached 1×10⁻⁶ cells / cells. 6 -2×10 6 cells / mL. Take the cultured cell suspension, centrifuge at 4000g for 5 min, discard the supernatant, collect the precipitated bacterial cells, wash twice with PBS buffer to remove residual culture medium.

[0033] 2. Genomic DNA Extraction: Genomic DNA was extracted from Sf9 cells using liquid nitrogen grinding combined with column extraction. The specific steps are as follows: (1) Transfer the collected mycelium to a sterile mortar, pour in an appropriate amount of liquid nitrogen, grind quickly into powder, weigh 1g of the ground mycelium powder, and transfer it to a 50mL centrifuge tube; (2) Add 6 mL of Buffer GSL and 20 μL of RNase A (10 mg / mL) to the centrifuge tube, vortex for 1 min to fully suspend the powder, and place in a 70℃ constant temperature water bath for 10 min, vortexing once every 2 min to ensure full cell lysis; (3) Add 2 mL of Buffer PSS, gently invert and mix 5 times, centrifuge at 4000g for 5 min to precipitate the protein; (4) Pipette the supernatant into the Filter FQ filter column, let it stand at room temperature for 2 min, centrifuge at 4000g for 5 min, and collect the filtrate into a new 50mL centrifuge tube; (5) Add 6 mL of isopropanol to the filtrate, gently invert and mix 10 times to allow the DNA to precipitate fully; (6) Transfer the above mixture to the adsorption column, centrifuge at 4000g for 5min, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube; (7) Add 10 mL of Buffer GW1 to the adsorption column, centrifuge at 4000 g for 1 min, discard the waste liquid, and put the adsorption column back into the collection tube; (8) Add 10 mL of Buffer GW2 to the adsorption column, centrifuge at 4000 g for 1 min, discard the waste liquid, and repeat this step once to ensure that impurities are completely removed; (9) Place the adsorption column in a new 50mL centrifuge tube, centrifuge at 4000g for 2min to completely remove the residual washing liquid, and let it air dry at room temperature for 5min to evaporate the residual anhydrous ethanol. (10) Add 1 mL of Buffer TB to the middle of the adsorption column, let it stand at room temperature for 5 min to allow the DNA to be fully eluted, centrifuge at 4000g for 2 min, and collect the elution solution, which is the Sf9 genomic DNA solution.

[0034] 3. Standard Calibration: The concentration and purity of the extracted Sf9 genomic DNA were determined using a UV spectrophotometer, with Buffer TB as a blank control. Absorbance values ​​at 260 nm and 280 nm were measured. The DNA concentration was calculated using the formula: DNA concentration (ng / μL) = A260 × 50 × dilution factor. The DNA purity was determined by the A260 / A280 ratio; a ratio between 1.8 and 2.0 indicated good DNA purity, free from protein and RNA contamination. Simultaneously, DNA integrity was verified using 1% agarose gel electrophoresis at 120V for 47 min. After electrophoresis, the gel was observed in a gel imaging system; the appearance of a single, clear band without tailing indicated good DNA integrity. The calibrated Sf9 DNA standard was diluted to 30 ng / μL with enzyme-free water and aliquoted at -20℃ for storage, avoiding repeated freeze-thaw cycles.

[0035] (II) Primer and probe screening experiment 1. Serial dilution of standards: Take 30 ng / μL of Sf9 DNA standard and serially dilute it with enzyme-free water to prepare a series of standard solutions with concentrations of 300 pg / μL, 30 pg / μL, 3 pg / μL, 0.3 pg / μL, 0.03 pg / μL, and 0.003 pg / μL. Set up 3 replicates for each concentration. At the same time, set up negative control (enzyme-free water) with 3 replicates to exclude experimental contamination.

[0036] 2. Reaction system preparation: A 30 μL reaction system was used, with the following components added: 15.0 μL of 2×TaqMan qPCRMix, 0.6 μL of upstream primer (final concentration 0.2 μM), 0.6 μL of downstream primer (final concentration 0.2 μM), 0.3 μL of fluorescent probe (final concentration 0.1 μM), 3.5 μL of enzyme-free water, and 10.0 μL of template (standard series solutions or negative control). Five separate reaction systems with different primer-probe combinations were prepared to avoid cross-contamination.

[0037] 3. PCR Amplification Program: Transfer the prepared reaction system to a 96-well plate of a real-time quantitative PCR instrument. Seal the plate with a sealing film and place it in the instrument. Set the following amplification program: 95℃ pre-denaturation for 10 min to completely denature the template DNA; then perform 40 cycles, each cycle including 95℃ denaturation for 15 s (to unwind the DNA double strands) and 60℃ annealing extension for 1 min (to allow primers to bind to the template and extend the DNA, while simultaneously acquiring fluorescence signals). The fluorescence signal acquisition channel is set to the FAM channel to detect changes in the probe's fluorescence signal.

[0038] 4. Screening Indicators and Judgment Criteria: After the experiment, the amplification curves, Ct values, and correlation coefficients (R²) of the standard curves for each primer-probe combination were obtained using the analysis software built into the real-time quantitative PCR instrument. 2 ) and amplification efficiency. Screening indicators include: (1) Amplification efficiency: the ideal range is 90%-110%. Amplification efficiency that is too high or too low indicates that the amplification performance of the primer-probe combination is poor; (2) Correlation coefficient R 2 ≥0.999 indicates that the linear relationship of the standard curve is good and the quantitative accuracy is high; (3) Negative control test results: The negative control should not have an obvious S-shaped amplification curve, and the Ct value should show as undetectable (UND) or Ct value>40, indicating that the experiment is not contaminated; (4) Amplification curve morphology: The amplification curve should have obvious exponential growth period and plateau period, without abnormal fluctuations. Based on the above indicators, the primer-probe combination with the best comprehensive performance was selected.

[0039] (III) Linear Range Verification Experiment 1. Experimental Design: The optimal primer-probe combination (Sf-F1 / Sf-R1 / Sf-P1) determined in the primer-probe screening experiment was used to detect a series of standard solutions at concentrations of 300 pg / μL, 30 pg / μL, 3 pg / μL, 0.3 pg / μL, 0.03 pg / μL, and 0.003 pg / μL. Each concentration was tested in triplicate. Negative control (enzyme-free water) and positive control (10 pg / μL Sf9 DNA solution) were also tested in triplicate.

[0040] 2. Reaction system and amplification procedure: The reaction system was prepared in the same manner as the primer and probe screening experiment, and the amplification procedure was the same as before.

[0041] 3. Data Processing and Analysis: After the experiment, the logarithm of the standard concentration was used as the x-axis, and the corresponding mean Ct was used as the y-axis. Linear regression analysis was performed using the least squares method to plot the standard curve, obtaining the linear regression equation y = ax + b (where a is the slope and b is the intercept). The correlation coefficient R was then calculated. 2 And amplification efficiency. The formula for calculating amplification efficiency is: E = (10^(-1 / a) - 1) × 100%. The criterion for determining the linear range is: correlation coefficient R. 2 A concentration ≥0.999 indicates an amplification efficiency between 90% and 110%, suggesting good linearity of the method within this concentration range, making it suitable for quantitative detection.

[0042] (iv) Repeatability verification experiment 1. Experimental Design: Standard solutions of 300 pg / μL, 30 pg / μL, 3 pg / μL, 0.3 pg / μL, 0.03 pg / μL, and 0.003 pg / μL, and three test samples (S2: 30 pg / μL, S3: 3 pg / μL, S4: 0.3 pg / μL) were selected. The optimal primer-probe combination was used, and three parallel replicates were performed according to the above reaction system and amplification procedure. The reaction system was prepared independently for each test, and negative and positive quality controls were set up to ensure the independence and reliability of the experiment.

[0043] 2. Data Processing and Analysis: Record the Ct values ​​of each concentration of standard and test sample in each test, and calculate the mean Ct, mean test value (converted from the standard curve), and coefficient of variation (CV%) for each concentration. The formula for calculating the coefficient of variation is: CV% = (standard deviation / mean) × 100%. The repeatability criterion is: CV% ≤ 10% for three repeated tests of each concentration sample, indicating that the method has good repeatability and the test results are stable and reliable.

[0044] (v) Accuracy Verification Experiment 1. Experimental design: Take test samples S2 (30 pg / μL), S3 (3 pg / μL), and S4 (0.3 pg / μL) with known concentrations. Set up 3 replicates for each sample and perform 3 parallel tests using the method of this invention. At the same time, set up a series of standard solutions, negative control and positive control to ensure the consistency of experimental conditions.

[0045] 2. Data Processing and Analysis: Based on the standard curve for each test, the mean detection value for each sample is calculated. Combined with the theoretical concentration of the sample, the recovery rate is calculated. The recovery rate calculation formula is: Recovery rate = (Mean detection value / Theoretical concentration) × 100%. The accuracy criterion is: a recovery rate between 90% and 110% indicates high accuracy of the method and its ability to accurately quantify the residual concentration of Sf9 host DNA in the sample.

[0046] (vi) Specificity verification experiment 1. Experimental Design: Sf9 DNA (3 pg / μL) was selected as the positive control, and genomic DNA from CHO cells, HEK293 cells, E. coli, Pichia pastoris, Candida albicans, and Staphylococcus aureus (all at a concentration of 3 pg / μL) were selected as interference samples. Each sample was configured in duplicate, and a negative control (enzyme-free water) was also configured in duplicate. The optimal primer and probe combination was used, and the detection was performed according to the above reaction system and amplification procedure.

[0047] 2. Data Processing and Analysis: Record the Ct values ​​for each sample and observe the amplification curve morphology. Specificity criteria are as follows: positive controls (Sf9 DNA) should show a distinct S-shaped amplification curve with a Ct value ≤ 40; interfering samples and negative controls should not show a distinct S-shaped amplification curve with a Ct value > 35 or undetectable (UND), indicating that the method is specific to Sf9 host DNA, has no cross-reactivity, and can effectively exclude interference from irrelevant DNA.

[0048] (vii) Durability verification experiment 1. Experimental Design: 2×TaqMan qPCR Mix and Primer-Probe Mix (upstream primer, downstream primer, and fluorescent probe mixed in specific proportions) were subjected to repeated freeze-thaw cycles. The freeze-thaw conditions were: -20℃ for 12 h, followed by natural thawing at room temperature for 30 min, constituting one freeze-thaw cycle. Three, six, and ten freeze-thaw cycles were performed. Reagents without freeze-thaw treatment served as controls. Standard solutions of 300 pg / μL, 30 pg / μL, and 3 pg / μL were selected as detection targets, with three replicates for each concentration. Negative and positive controls were also included. The optimal primer-probe combination was used, and detection was performed according to the above reaction system and amplification procedure.

[0049] 2. Data Processing and Analysis: Record the Ct values ​​of standards at different concentrations after different freeze-thaw cycles, and calculate the mean values ​​and the coefficient of variation (CV%) compared to the unfrozen control group. The robustness criteria are: after 3, 6, and 10 freeze-thaw cycles, if the CV% of the test results of each concentration standard compared to the unfrozen control group is ≤15%, and the test results of the negative and positive quality controls meet the requirements, it indicates that the method has good robustness, the repeated freeze-thaw cycles of the reagents have little impact on the test results, and it is suitable for use under routine laboratory conditions.

[0050] (viii) Validation experiment of the lowest detection limit 1. Experimental Design: Sf9 DNA standard was serially diluted with enzyme-free water to prepare solutions with concentrations of 0.003 pg / μL and 0.001 pg / μL, with three replicates for each concentration; a negative control (enzyme-free water) was also prepared with three replicates. The optimal primer-probe combination was used, and detection was performed according to the above reaction system and amplification procedure.

[0051] 2. Data Processing and Analysis: Observe the amplification curve morphology of standards at various concentrations and record the Ct values. The criterion for determining the limit of detection (LOD) is: the lowest concentration showing a clear S-shaped amplification curve and Ct ≤ 40 is the LOD of this method. If all three replicates at a certain concentration meet the above conditions and the negative control shows no amplification, then that concentration is the LOD; if some replicates show amplification, further verification is required; if there is no amplification, then the concentration should be reduced and detection continued.

[0052] (IX) Detection Experiment of Actual Samples 1. Sample Pretreatment: Take 3 batches of gene therapy drug samples, and for each batch, take 3 parallel samples. Add 1 mL of enzyme-free water to each sample for reconstitution, and vortex for 5 min to fully dissolve the samples. Extract the DNA in the samples according to the genomic DNA extraction method in “(I) Preparation and Calibration of Sf9 DNA Standard品”, and the specific steps are as follows: (1) Transfer the reconstituted samples to 50 mL centrifuge tubes, centrifuge at 4000 g for 5 min, and collect the precipitate; (2) Add 6 mL of Buffer GSL and 20 μL of RNase A, vortex for 1 min, and lyse in a water bath at 70 °C for 10 min; (3) The subsequent steps (purification with Buffer PSS, precipitation with isopropanol, washing with Buffer GW1 / GW2, and elution with Buffer TB) are the same as before. Finally, collect 1 mL of DNA eluate as the test sample solution.

[0053] 2. Detection Procedure: According to the above reaction system and amplification program, use the optimal primer-probe combination to detect the test solutions of 3 batches of actual samples. Set 3 replicates for each batch of samples, and at the same time set a series of standard solutions (300 pg / μL, 30 pg / μL, 3 pg / μL, 0.3 pg / μL, 0.03 pg / μL, 0.003 pg / μL), negative control products, and positive control products, each with 3 replicates.

[0054] 3. Result Interpretation: Calculate the residual concentration of Sf9 host DNA in each actual sample according to the standard curve, and combine the quality control standards for result interpretation: (1) The negative control product should meet the requirements: The Ct value in the FAM channel shows 0 or is not detected, and there is no obvious S-shaped amplification curve; (2) The positive control product should meet the requirements: There is a Ct value in the FAM channel and Ct ≤ 40, there is an obvious S-shaped amplification curve, the amplification efficiency is 90% - 110%, and the correlation coefficient R 2 ≥0.999; (3) If the negative control product and the positive control product do not meet the above requirements, or the amplification efficiency of the standard curve exceeds the range of 90% - 110% or R 2 <0.999, it is determined that this experiment is invalid and needs to be retested; (4) Result interpretation of the test sample: If the Ct value ≤ 40 and there is an obvious S-shaped amplification curve, it is determined to be positive for the residual Sf9 host DNA; if the Ct value > 40 or is not detected, it is determined to be negative; if 40 < Ct value ≤ 44, it is recommended to repeat the test. If the result is still 40 < Ct value ≤ 44 after repetition, it is determined to be positive, and if there is no amplification, it is determined to be negative.

[0055] III. Experimental Results and Analysis (I) Results of Primer-Probe Screening The screening results of the five primer-probe combinations are shown in the table below. As can be seen from the table, the amplification efficiency of the combination Sf-F1 / Sf-R1 / Sf-P1 (SEQ ID NO:1 / 2 / 11) was 98.878%, falling within the ideal range of 90%-110%, indicating excellent amplification performance; the correlation coefficient R... 2 =1.0 indicates excellent linearity of the standard curve and high quantitative accuracy; no amplification signal (UND) was detected in the negative control, indicating no contamination in the experiment; the amplification curve showed good morphology, with obvious exponential growth and plateau phases, and no abnormal fluctuations. However, among other combinations, the amplification efficiency of Sf-F0 / Sf-R0 / Sf-P0 was 141.707%, exceeding the ideal range, possibly indicating non-specific amplification; the correlation coefficients R of Sf-F2 / Sf-R2 / Sf-P2, Sf-F3 / Sf-R3 / Sf-P3, and Sf-F4 / Sf-R4 / Sf-P4 were... 2 The values ​​were 0.997, 0.999, and 0.997, respectively. Although close to 0.999, they were all lower than the linear performance of the Sf-F1 / Sf-R1 / Sf-P1 combination. Based on the above indicators, the Sf-F1 / Sf-R1 / Sf-P1 combination was determined to be the optimal primer-probe combination for all subsequent validation experiments and actual sample detection.

[0056] Table 1. Screening results of 5 primer-probe combinations

[0057] (II) Validation results of linear range like Figure 2 As shown, the optimal primer-probe combination was used to detect a series of standard solutions ranging from 300 pg / μL to 0.003 pg / μL. The mean Ct values ​​for each concentration of the standard are shown in the table below. A standard curve was plotted with the logarithm of the standard concentration on the x-axis and the mean Ct value on the y-axis. The linear regression equation obtained was y = -3.314x + 25.646, and the correlation coefficient R0 was [value missing]. 2 =1.0, the amplification efficiency was 101.793%, which is within the ideal range of 90%-110%. The results show that the method of the present invention has good linearity in the concentration range of 300 pg / μL - 0.003 pg / μL, and can achieve accurate quantitative detection of Sf9 host DNA residues.

[0058] Table 2. Mean Ct values ​​for linear range verification

[0059] (III) Results of repeatability verification The accuracy verification results for samples S2, S3, and S4 are shown in the table below. As can be seen from the table, the mean Ct values ​​of the three repeated tests for each concentration standard and sample were stable, with coefficients of variation (CV%) all ≤9.8%, less than the 10% threshold. Specifically, the CV% for STD1 (300 pg / μL) was 5.4%, for STD2 (30 pg / μL) it was 3.8%, for STD3 (3 pg / μL) it was 9.4%, for STD4 (0.3 pg / μL) it was 5.1%, for STD5 (0.03 pg / μL) it was 9.8%, and for STD6 (0.003 pg / μL) it was 9.3%; the CV% for samples S2, S3, and S4 were 3.7%, 2.9%, and 6.1%, respectively. No amplification signal was detected in the negative control in three repeated tests, and the Ct value of the positive control was stable with CV% ≤ 2.0%. The results indicate that the method of this invention has good repeatability, and the detection results are stable and reliable, meeting the needs of routine testing.

[0060] Table 3. Results of repeatability verification

[0061] (iv) Accuracy verification results The accuracy verification results for samples S2, S3, and S4 are shown in the table below. As can be seen from the table, the mean detection value for sample S2 was 32.2668 pg / μL, the theoretical concentration was 30 pg / μL, and the recovery rate was 107.56%; the mean detection value for sample S3 was 3.0484 pg / μL, the theoretical concentration was 3 pg / μL, and the recovery rate was 101.61%; the mean detection value for sample S4 was 0.3106 pg / μL, the theoretical concentration was 0.3 pg / μL, and the recovery rate was 103.53%. The recovery rates for all three samples were within the accuracy judgment range of 90%-110%, and the CV% was ≤6.1%, indicating that the method of this invention has high accuracy and can accurately reflect the actual residual concentration of Sf9 host DNA in the samples, and can be used for quantitative analysis.

[0062] Table 4. Accuracy verification test results

[0063] (v) Specificity verification results The detection results of each DNA sample in the specificity verification experiment are shown in the table below. As can be seen from the table, the mean Ct value of the positive control (Sf9 DNA, 3 pg / μL) was 24.0191, showing a clear S-shaped amplification curve, indicating that the primer-probe combination had a good amplification effect on the target sequence. However, the Ct values ​​of the interfering samples (CHO cells, HEK293 cells, E. coli, Pichia pastoris, Candida albicans, Staphylococcus aureus DNA) were all >35 or undetectable (UND), with no clear S-shaped amplification curve. Specifically, no amplification signal was detected for CHO cells, HEK293 cells, E. coli, and Staphylococcus aureus DNA. The mean Ct value for Pichia pastoris DNA was 39.728, and the mean Ct value for Candida albicans DNA was 36.01, indicating extremely low actual detection concentrations that can be ignored. No amplification signal was detected for the negative control, indicating that the experiment was uncontaminated. The results show that the method of the present invention has extremely high specificity, can effectively distinguish Sf9 host DNA from other irrelevant DNA, has no cross-reaction, and can specifically detect the residue of Sf9 host DNA in the sample.

[0064] Table 5. Detection results of specificity verification

[0065] (vi) Durability verification results The robustness verification results under different freeze-thaw cycles are shown in the table below. As can be seen from the table, after 3, 6, and 10 freeze-thaw cycles, the detection results of the 2×TaqMan qPCR Mix and primer / probe Mix at different concentrations (300 pg / μL, 30 pg / μL, 3 pg / μL) compared to the unfrozen control group showed that the CV% of the FAM channel was 2.67%, 2.40%, and 2.84%, respectively, and the CV% of the CY5 channel was 2.82%, 2.18%, and 1.69%, respectively, all ≤3.0%, far below the 15% threshold. No amplification signal was detected in the negative control at any freeze-thaw cycle, and the Ct value of the positive control was stable, with amplification efficiency and correlation coefficient meeting the requirements. The results indicate that the method of this invention has good robustness, and repeated freeze-thaw cycles have minimal impact on the detection results. It is suitable for routine laboratory storage and use conditions, and there is no need to worry about performance degradation caused by reagent freeze-thaw cycles.

[0066] Table 6. Results of coefficient of variation in durability verification

[0067] (vii) Validation results of the lowest detection limit In the limit of detection (LOD) validation experiment, all three replicates of the 0.003 pg / μL Sf9 DNA standard showed obvious S-shaped amplification curves, with Ct values ​​of 33.8177, 34.0397, and 34.2229, respectively, all ≤40, meeting the criteria for the LOD. However, no amplification signal was detected in any of the three replicates of the 0.001 pg / μL standard, and no obvious S-shaped amplification curve was observed. No amplification signal was detected in the negative control, indicating no contamination in the experiment. The results show that the method of this invention has a LOD of 0.003 pg / μL (fg level) for Sf9 host DNA, exhibiting extremely high sensitivity, meeting the detection requirements for low concentrations of Sf9 host DNA residues in biological products, and is suitable for stringent quality control standards.

[0068] (viii) Actual sample test results The test results of three batches of gene therapy drug samples are shown in the table below. As can be seen from the table, no amplification signal was detected in the negative controls of all three batches of samples. The mean Ct value of the positive controls was 28.37, the amplification efficiency was 99.2%, and the correlation coefficient R0 was [missing value]. 2 =1.0, meeting quality control requirements, and the experiment is valid. Specifically, the FAM channel Ct values ​​of samples 1 and 2 were undetectable (UND), and the CY5 channel Ct values ​​were 18.62 and 17.95 respectively, both undetectable at the detection concentration, indicating negative results for Sf9 host DNA residue. Sample 3 had a FAM channel Ct value of 38.25 and a CY5 channel Ct value of 18.31, with a detection concentration of 0.0052 pg / μL, ≤40, indicating a positive result for Sf9 host DNA residue. The results show that the method of this invention can be successfully applied to the detection of actual biological product samples, accurately determining the residual state of Sf9 host DNA in the samples, providing reliable technical support for the quality control of biological products.

[0069] Table 7. Actual Sample Test Results

[0070] IV. Experimental Conclusions This invention establishes a detection method for residual Sf9 host DNA using fluorescent probes by designing specific primer pairs and fluorescent probes targeting high-copy-count conserved sequences in Sf9 host DNA, optimizing the reaction system and amplification procedure, and developing a matching kit. Through a series of systematic validation experiments, this method has been confirmed to possess the following superior performance: 1. High specificity: The optimal primer-probe combination (Sf-F1 / Sf-R1 / Sf-P1) can specifically bind to the target sequence of Sf9 host DNA and has no cross-reactivity with various unrelated DNAs such as CHO cells, HEK293 cells, E. coli, and Pichia pastoris. It has high specificity and can effectively avoid false positive results.

[0071] 2. High sensitivity: The lowest detection limit can reach 0.003 pg / μL (fg level), which is far lower than the sensitivity of existing conventional detection methods. It can accurately detect extremely low concentrations of Sf9 host DNA residues in biological products and meet strict quality control standards.

[0072] 3. Wide linear range: Good linearity is observed within the concentration range of 300 pg / μL to 0.003 pg / μL, with a correlation coefficient R0. 2 =1.0, amplification efficiency of 90%-110%, high quantitative accuracy, and can cover the detection needs of samples with different concentration ranges.

[0073] 4. Good repeatability and durability: The CV% of three repeated tests for each concentration sample is ≤10%, and the test results remain stable and reliable after 10 repeated freeze-thaw cycles. It is suitable for batch testing and long-term use in a normal laboratory environment.

[0074] 5. Simple and quick operation: The entire detection process can be completed in about 1.5 hours. The sample pretreatment adopts liquid nitrogen grinding combined with column extraction. The steps are clear and easy to operate. No complicated instruments and equipment or professional technicians are required, which facilitates its promotion and application.

[0075] 6. High practicality: Successfully applied to the detection of actual samples of gene therapy drugs using Sf9 cells as the expression system, it can accurately determine the residual state of Sf9 host DNA in the sample, providing a reliable technical means for the quality control of biological products such as gene therapy drugs, cell vaccines, and recombinant protein drugs, which is of great significance for ensuring the safety and efficacy of biological products.

[0076] In summary, the detection method and kit provided by this invention have the advantages of high specificity, high sensitivity, wide linear range, good repeatability, and simple operation. They can be widely used in the field of quality control of biological therapeutic drugs and have important practical application value and market prospects.

[0077] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any person skilled in the art can easily conceive of various variations or substitutions within the technical scope disclosed in the present invention, and these should all be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. A specific primer pair for detecting residual Sf9 host DNA, characterized in that, The primer pair includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:2; The upstream and downstream primers are designed for high-copy conserved sequences of Sf9 host DNA, and the absolute value of the Tm temperature difference between the upstream and downstream primers is ≤1℃.

2. A specific primer pair for detecting residual Sf9 host DNA, characterized in that, The primer pair is any combination of the following: Combination 1: The upstream primer sequence is shown in SEQ ID NO:3, and the downstream primer sequence is shown in SEQ ID NO:4; Combination 2: The upstream primer sequence is shown in SEQ ID NO:5, and the downstream primer sequence is shown in SEQ ID NO:6; Combination 3: The upstream primer sequence is shown in SEQ ID NO:7, and the downstream primer sequence is shown in SEQ ID NO:8; Combination 4: The upstream primer sequence is shown in SEQ ID NO:9, and the downstream primer sequence is shown in SEQ ID NO:

10.

3. A fluorescent probe for detecting residual Sf9 host DNA, characterized in that, The fluorescent probe is used in conjunction with the specific primer pair described in claim 1 or 2, and the nucleotide sequence of the fluorescent probe is any one of the following: SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15; the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

4. The fluorescent probe according to claim 3, characterized in that, The fluorescent reporter group is selected from FAM, NEX, ROX, TET, JOE, VIC, CY3, CY5 or Texas Red, and the fluorescent quencher group is selected from BHQ, TAMRA, Eclipse, Dabcyl, Lowa Black™ RQ or Lowa Black™ FQ; preferably, the fluorescent reporter group is FAM and the fluorescent quencher group is TAMRA.

5. A kit for detecting residual Sf9 host DNA, characterized in that, The kit contains the specific primer pair as described in claim 1 or 2, the fluorescent probe as described in claim 3 or 4, and also includes gene amplification solution, enzyme-free water (DEPC water), Sf9 DNA standard, positive control and negative control. The gene amplification solution is 2×TaqMan qPCR Mix, containing Taq DNA polymerase, dNTPs, and magnesium ions; The Sf9 DNA standard had a concentration of 30 ng / μL. Agarose gel electrophoresis confirmed that the band was single and free of impurities, with a purity ≥95% and an A260 / A280 ratio of 1.823-1.

826. The positive control is a DNA solution containing a specific conserved region sequence of Sf9 host DNA, as shown in SEQ ID NO:

16. The negative control was enzyme-free water (DEPC water).

6. The reagent kit according to claim 5, characterized in that, The amounts of each component added to the 30 μL reaction system in the kit are as follows: 15.0 μL of 2×TaqMan qPCR Mix, 0.6 μL of upstream primer, 0.6 μL of downstream primer, 0.3 μL of fluorescent probe, 3.5 μL of DEPC water, and 10.0 μL of template; The final concentration of the upstream primer is 0.2 μM, the final concentration of the downstream primer is 0.2 μM, and the final concentration of the fluorescent probe is 0.1 μM; When the primer pair described in Claim 1 is combined with the probe shown in SEQ ID NO:11, it is the optimal detection combination.

7. A method for detecting residual Sf9 host DNA, characterized in that, The method includes the following steps: S1. Sample pretreatment: Extract DNA from the biological product sample to be tested by liquid nitrogen grinding combined with column extraction. The specific steps are as follows: Centrifuge at 4000 g for 5 min to collect the thallus → Grind to powder in liquid nitrogen → Add Buffer GSL and RNase A, lysate in a water bath at 70 °C for 10 min → Purify with Buffer PSS → Precipitate with isopropanol → Wash with Buffer GW1 / GW2 → Elute with Buffer TB to obtain the DNA solution to be tested; Gradient dilute the Sf9 DNA standard product with DEPC water into standard product series solutions of 300 pg / μL, 30 pg / μL, 3 pg / μL, 0.3 pg / μL, 0.03 pg / μL, and 0.003 pg / μL, and set a negative control product at the same time; S2. Preparation of the reaction system: Use the kit described in Claim 5 or 6 to prepare a 30 μL reaction system according to the ratio described in Claim 6; S3. PCR amplification: Place the reaction system in a real-time fluorescence quantitative PCR instrument and execute the following program: Pre-denature at 95 °C for 10 min; Denature at 95 °C for 15 s, anneal and extend at 60 °C for 1 min (read fluorescence signal), for a total of 40 cycles; S4. Results Analysis: A standard curve was plotted based on the amplification results of the standard series solutions. The logarithm of the standard concentration was plotted on the x-axis, and the corresponding Ct value was plotted on the y-axis. Linear regression analysis was performed using the least squares method. The correlation coefficient R of the standard curve was calculated. 2 ≥0.999, amplification efficiency of 90%-110%; based on the Ct value of the sample to be tested, the residual concentration of Sf9 host DNA in the sample to be tested is calculated in combination with the standard curve.

8. The method for detecting Sf9 host DNA residue according to claim 7, characterized in that, The detection sensitivity of the method is 0.003 pg / μL (fg level), and the linear range is 0.003 pg / μL - 300 pg / μL; The Ct values of the detection of irrelevant DNAs such as CHO cells, HEK293 cells, E. coli, and Pichia pastoris are all greater than 35 or not detected, and there is no cross-reaction; The CV% of three parallel detections of the same sample ≤ 10%, and the CV% of the detection results after the nucleic acid amplification solution is repeatedly frozen and thawed 10 times ≤ 13.9%. The method has good repeatability and durability.

9. The method for detecting Sf9 host DNA residue according to claim 7, characterized in that, Includes a quality control step: S11. The negative control product should meet: The Ct value in the FAM channel shows 0 or is not detected, and there is no obvious S-shaped amplification curve; S12. Positive control samples must meet the following requirements: The FAM channel must have a Ct value with Ct≤40, a distinct S-shaped amplification curve, an amplification efficiency of 90%-110%, and a correlation coefficient R0. 2 ≥0.999; S13. If the negative control or positive control does not meet the above requirements, or the amplification efficiency of the standard curve exceeds the range of 90%-110%, R... 2 If the value is less than 0.999, the experiment is deemed invalid and needs to be repeated. S14. Judgment of the results of the sample to be tested: If the Ct value ≤ 40 and there is an obvious S-shaped amplification curve, it is judged as positive for Sf9 host DNA residue; if the Ct value > 40 or is not detected, it is judged as negative; if 40 < Ct value ≤ 44, it is recommended to repeat the detection. If the result is still 40 < Ct value ≤ 44 after repetition, it is judged as positive, and if there is no amplification, it is judged as negative.

10. The application of the specific primer pair described in Claim 1 or 2, the fluorescent probe described in Claim 3 or 4, and the kit described in any one of Claims 5 - 6 in the quality control of biotherapeutic drugs. The biotherapeutic drugs include gene therapy drugs, cell vaccines, and recombinant protein drugs, and the drugs use Sf9 cells as an expression system or production raw material.

Images