Application of target histone H4K77 acetylation modified substance in preparation of medicine for delaying immune aging, modified stem progenitor cell and application of modified stem progenitor cell

By targeting histone H4K77 acetylated substances and modifying stem and progenitor cells, the problem of immune system dysfunction was solved, achieving the effects of delaying immune aging and preventing related diseases, improving the body's immune function and reducing inflammation.

CN122005809APending Publication Date: 2026-05-12WEST CHINA HOSPITAL SICHUAN UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
WEST CHINA HOSPITAL SICHUAN UNIV
Filing Date
2026-04-13
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

As we age, the function of hematopoietic stem cells gradually deteriorates, leading to a decline in the function of the immune system, increased myeloid bias, and reduced lymphocyte production, resulting in decreased immune function and exacerbation of related diseases. Current technologies have not been able to effectively address the link between histone H4K77 acetylation modification and immune aging.

Method used

By targeting substances that acetylate or acetylate histone H4K77, including the small molecule compound RGFP966, gene editing reagents, and histone H4K77 analogs, the level of histone H4K77 acetylation modification in stem and progenitor cells is increased, thereby regulating stem and progenitor cell differentiation, promoting lymphoid differentiation, and inhibiting myeloid differentiation. The modified stem and progenitor cells are then used to prepare drugs that delay immune aging.

Benefits of technology

It effectively delays immune aging, improves the body's adaptive immune function, reduces inflammation, and prevents and treats systemic aging-related diseases caused by immune aging, such as infectious diseases, tumors, chronic inflammation, and cardiovascular diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122005809A_ABST
    Figure CN122005809A_ABST
Patent Text Reader

Abstract

The invention provides application of a targeted histone H4K77 acetylation modified substance in preparation of a medicine for delaying immune aging, a modified stem progenitor cell and application of the modified stem progenitor cell, and belongs to the technical field of medicine. The target histone H4K77 acetylation modification or acetylation-like modification substance is a substance for increasing the histone H4K77 acetylation modification level or acetylation-like modification level in hematopoietic stem cells and / or hematopoietic progenitor cells. It is found for the first time that by increasing histone H4K77 acetylation modification or acetylation-like modification, immune senescence and systemic senescence caused by immune senescence can be effectively delayed, and immune senescence and systemic senescence related diseases caused by immune senescence can be treated. The invention provides a new choice for clinically delaying immune senescence and systemic senescence caused by immune senescence and treating immune senescence and systemic senescence related diseases caused by immune senescence, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical technology, specifically relating to the use of substances targeting histone H4K77 acetylation modification in the preparation of drugs for delaying immune aging, and the modified stem progenitor cells and their uses. Background Technology

[0002] Hematopoietic stem cells (HSCs) are the source of blood cells, responsible for generating all types of blood cells, including red blood cells, white blood cells, and platelets. HSCs are crucial in the immune system, providing a continuous supply of immune cells and helping to maintain blood circulation and immune defense. However, with age, especially in environments of chronic inflammation, the function of HSCs gradually declines, their regenerative capacity decreases, and the immune system deteriorates more rapidly.

[0003] The body's health and aging are closely related to the function of the immune system; more than 80% of diseases are related to immune dysregulation. Systemic aging refers to the process by which the functions of multiple systems in an organism (such as the nervous system, immune system, and endocrine system) gradually decline with age.

[0004] Studies show that with increasing age, the myeloid bias in hemoglobinocytes (HSCs) significantly increases, leading to an increase in the number of neutrophils and platelets, while the production of lymphocytes (such as T cells and B cells) decreases. This imbalance in blood composition reflects a decline in immune system function, especially in the context of chronic inflammation. Long-term low-grade inflammation not only accelerates the aging of HSCs but also promotes their over-differentiation into myeloid cells.

[0005] Myeloid cells (such as neutrophils and monocytes) increase significantly during immunosenescence. Overactivation and differentiation of myeloid cells lead to excessive secretion of inflammatory factors, further exacerbating chronic inflammation. For example, mice lacking Sema4A exhibit excessive expansion of myeloid cells during aging, resulting in increased chronic inflammation. Furthermore, the proportion of myeloid-biased hematopoietic stem cells (my-HSCs) increases in old age, leading to decreased lymphohematopoiesis and increased myeloid hematopoiesis.

[0006] Conversely, decreased lymphoid differentiation capacity leads to a reduction in the number of T cells and B cells. A decrease in lymphocytes signifies a decline in the long-term defense capabilities of the immune system, making it more susceptible to repeated viral and bacterial infections and even reducing anti-cancer capabilities. For example, HSC clones in early-aging mice tend to differentiate into myeloid cells, while those in delayed-aging mice tend to differentiate into lymphoid cells. Therefore, regulating myeloid and lymphoid differentiation during immunosenescence is of great significance for treating chronic inflammation and decreased immune function.

[0007] H4K77 is the 77th lysine residue on histone H4. This site can undergo various post-translational modifications, including acetylation, succinylation, and ubiquitination. These modifications play important regulatory roles in chromatin structure and function, thereby affecting biological processes such as gene expression, DNA replication, and repair. H4K77ac refers to the acetylation modification of the 77th lysine residue on histone H4. Studies have shown that the upregulation of H4K77ac in hepatocellular carcinoma is significantly associated with poor patient prognosis. However, there are currently no reports in the literature regarding the association of H4K77ac with immunosenescence. Summary of the Invention

[0008] The purpose of this invention is to utilize substances that target histone H4K77 acetylation or acetylation-like modification in the preparation of medicaments for delaying immunosenescence or preventing and / or treating systemic aging-related diseases caused by immunosenescence.

[0009] This invention first provides the use of substances that target histone H4K77 acetylation or acetylation-like modification in the preparation of drugs for delaying immune aging or preventing and / or treating systemic aging-related diseases caused by immune aging, wherein the substances are those that increase the level of histone H4K77 acetylation or acetylation-like modification in stem and progenitor cells.

[0010] The substances that increase the level of histone H4K77 acetylation modification in stem and progenitor cells include exogenously acetylated histone H4K77, histone H4K77 acetylation modification promoters, gene editing reagents that control H4K77 acetylation, and stem and progenitor cells containing gene editing reagents that control H4K77 acetylation or treated with exogenously acetylated histone H4K77 or histone H4K77 acetylation modification promoters. The substances that increase the level of histone H4K77 acetylation modification in stem and progenitor cells include acetylated histone H4K77 analogs, gene editing reagents that control histone H4K77 mutations to acetylated histone H4K77 analogs, and stem and progenitor cells containing acetylated histone H4K77 analogs and gene editing reagents that control histone H4K77 mutations to acetylated histone H4K77 analogs.

[0011] Preferably, the histone H4K77 acetylation modification promoter comprises a small molecule compound with the structural formula shown in Formula II: Formula II Among them, R1 is selected from hydrogen, C 1~6 Alkyl groups, halogens; R2 is selected from hydrogen, C 1~6 Alkyl groups, halogens; Link B is selected from the group containing C. 1~10 Mixed chains of alkylene or heterocyclic groups.

[0012] More preferably, the small molecule compound is RGFP966.

[0013] Preferably, the acetylated histone H4K77 analog is a mutant of histone H4K77 with lysine mutated to glutamine or other negatively charged amino acids.

[0014] Furthermore, the aforementioned drugs that delay immune aging are those that improve the body's adaptive immune function or reduce inflammation by altering the composition and function of the aging immune system.

[0015] Furthermore, the aforementioned drugs are those that promote lymphoid differentiation of stem and progenitor cells or reduce myeloid differentiation of stem and progenitor cells.

[0016] The present invention also provides a modified stem progenitor cell, which is a stem progenitor cell with upregulated histone H4K77 acetylation or acetylation; it includes a histone H4K77 acetylation modification promoter or an acetylated histone H4K77 analog.

[0017] Furthermore, the histone H4K77 acetylation modification promoter comprises a small molecule compound with the structural formula shown in Formula II: Formula II Among them, R1 is selected from hydrogen, C 1~6 Alkyl groups, halogens; R2 is selected from hydrogen, C 1~6 Alkyl groups, halogens; Link B is selected from the group containing C. 1~10 Mixed chains of alkylene or heterocyclic groups; Alternatively, the acetylated histone H4K77 analogue is a mutant of histone H4K77 with a lysine mutation to glutamine.

[0018] The present invention also provides the use of the above-described modified stem and progenitor cells in the preparation of drugs for delaying immunosenescence or for preventing and / or treating systemic aging-related diseases caused by immunosenescence.

[0019] The "stem progenitor cells" mentioned above in this invention are preferably hematopoietic stem cells and / or hematopoietic progenitor cells.

[0020] The present invention also provides the use of substances targeting histone H4K77 acetylation or acetylation-like modification in the preparation of drugs for delaying immunosenescence and systemic aging caused by immunosenescence or for preventing and / or treating immunosenescence and systemic aging-related diseases caused by immunosenescence; the substances targeting histone H4K77 acetylation or acetylation-like modification are substances that increase the level of histone H4K77 acetylation or acetylation-like modification in hematopoietic stem cells and / or hematopoietic progenitor cells.

[0021] Further, the substance that increases the level of histone H4K77 acetylation modification in hematopoietic stem cells and / or hematopoietic progenitor cells includes reagents that increase the level of histone H4K77 acetylation modification in hematopoietic stem cells and / or hematopoietic progenitor cells, and histone H4K77 acetylated modified hematopoietic stem cells and / or hematopoietic progenitor cells; or, the substance that increases the level of histone H4K77-like acetylation modification in hematopoietic stem cells and / or hematopoietic progenitor cells includes acetylated histone H4K77 analogs, gene editing reagents that control histone H4K77 mutations to acetylated histone H4K77 analogs, and histone H4K77-like acetylated modified hematopoietic stem cells and / or hematopoietic progenitor cells; Preferably, the histone H4K77 acetylated hematopoietic stem cells and / or hematopoietic progenitor cells contain an agent that increases the level of histone H4K77 acetylation modification in the hematopoietic stem cells and / or hematopoietic progenitor cells; or, the histone H4K77-like acetylated hematopoietic stem cells and / or hematopoietic progenitor cells contain an acetylated histone H4K77 analog or a gene-editing agent that controls the mutation of histone H4K77 to an acetylated histone H4K77 analog.

[0022] Furthermore, the reagents for increasing the level of histone H4K77 acetylation modification in hematopoietic stem cells and / or hematopoietic progenitor cells include exogenously acetylated histone H4K77, histone H4K77 acetylation modification promoters, and gene editing reagents that control H4K77 acetylation.

[0023] Furthermore, the histone H4K77 acetylation modification promoter includes substances that inhibit histone deacetylases and substances that activate histone acetyltransferases.

[0024] Furthermore, the histone deacetylases include class I histone deacetylases, class II histone deacetylases, class III histone deacetylases, and class IV histone deacetylases.

[0025] Furthermore, the class I histone deacetylases include HDAC1, HDAC2, HDAC3, and HDAC8.

[0026] Furthermore, the substances that inhibit histone deacetylase include histone deacetylase inhibitors, drugs that inhibit histone deacetylase gene expression, drugs that knock out or knock down histone deacetylase genes, and drugs that degrade histone deacetylase.

[0027] Furthermore, the histone deacetylase inhibitor is selected from small molecule compounds, peptides, and antibodies.

[0028] Furthermore, the histone deacetylase inhibitor is an HDAC3 inhibitor, preferably a small molecule compound with the structural formula shown in Formula I: Formula I Among them, the surface recognition group A is selected from aromatic groups; Link B is selected from C 1~10 A mixed chain of alkylene, aromatic, or heterocyclic groups; The zinc-binding group C is selected from groups containing hydroxyoxime acid, o-aminobenzamide, isohydroxyoxime acid, carboxylic acid, or benzamide.

[0029] Furthermore, the HDAC3 inhibitor is selected from small molecule compounds with the structural formula shown in Formula II: Formula II Among them, R1 is selected from hydrogen, C 1~6 Alkyl groups, halogens; R2 is selected from hydrogen, C 1~6 Alkyl groups, halogens; Link B is selected from the group containing C. 1~10 Mixed chains of alkylene or heterocyclic groups.

[0030] Furthermore, the HDAC3 inhibitor is RGFP966.

[0031] Furthermore, the drug that inhibits histone deacetylase gene expression is selected from circular RNA, antisense nucleic acid, small interfering nucleic acid, nucleic acid aptamer, small activating nucleic acid, micronucleic acid, mRNA drug, and ribozyme.

[0032] Furthermore, the drug for knocking out or knocking down the histone deacetylase gene is selected from the CRISPR / Cas9 gene editing system, and the preferred delivery vector is a lentiviral vector or an AAV vector.

[0033] Furthermore, the drug for degrading histone deacetylase is selected from protein degrading agents, preferably selected from PROTAC and molecular gels.

[0034] Furthermore, the substance that activates histone acetyltransferase includes histone acetyltransferase agonists or drugs that overexpress histone acetyltransferase.

[0035] Furthermore, the histone acetyltransferase agonist is a small molecule compound, a polypeptide, or an antibody; or, the substance overexpressing histone acetyltransferase includes a CRISPR / Cas9 gene editing system, preferably delivered via a lentiviral vector or an AAV vector.

[0036] Furthermore, the gene editing reagent is selected from the CRISPR / Cas9 gene editing system, and the preferred delivery vector is a lentiviral vector or an AAV vector.

[0037] Furthermore, the acetylated histone H4K77 analog is a mutant of histone H4K77 with lysine mutated to glutamine.

[0038] Furthermore, the aging includes systemic immune imbalance caused by decreased lymphoid differentiation of hematopoietic stem cells or increased myeloid differentiation of hematopoietic stem cells, an increase in the number of innate immune system cells, an increase in age-related secretory phenotypes, abnormal differentiation and / or function of inflammatory aging lymphocytes, a decrease in new T and / or B cells due to thymic and / or bone marrow aging, and loss and / or functional changes in the immune repertoire.

[0039] Furthermore, the drug that delays immune aging and systemic aging caused by immune aging, or prevents and / or treats immune aging and systemic aging-related diseases caused by immune aging, is a drug that promotes lymphatic differentiation of hematopoietic stem cells and / or reduces myeloid differentiation of hematopoietic stem cells.

[0040] Furthermore, the systemic aging-related diseases are selected from those with decreased immune function, infectious diseases, tumors, chronic inflammation, cardiovascular diseases, metabolic diseases, myeloid leukemia, neurodegenerative diseases, and immunodeficiency diseases.

[0041] Furthermore, the infectious diseases are selected from pneumonia, otitis media, meningitis, sepsis, and recurrent respiratory infections; The tumors are selected from lymphoma, prostate cancer, breast cancer, lung cancer, colorectal cancer, multiple myeloma, skin cancer, gastric cancer, pancreatic cancer, squamous cell carcinoma of the head and neck, ovarian cancer, and glioblastoma multiforme. The chronic inflammation mentioned is selected from atherosclerosis and chronic obstructive pulmonary disease; The cardiovascular diseases mentioned are selected from coronary heart disease, myocardial infarction, stroke, and cardiac fibrosis; The metabolic diseases mentioned are selected from type 2 diabetes, obesity, fatty liver, insulin resistance, chronic kidney disease, and osteoporosis. The myeloid leukemia mentioned is selected from acute myeloid leukemia and chronic myeloid leukemia; The neurodegenerative diseases mentioned are selected from Alzheimer's disease and Parkinson's disease; The immunodeficiency disease mentioned is selected from acquired immunodeficiency syndromes.

[0042] The present invention also provides a modified hematopoietic stem cell and / or hematopoietic progenitor cell, which is a hematopoietic stem cell and / or hematopoietic progenitor cell with upregulated histone H4K77 acetylation or acetylation.

[0043] Furthermore, the hematopoietic stem cells and / or hematopoietic progenitor cells are the patient's own hematopoietic stem cells and / or hematopoietic progenitor cells, or allogeneic hematopoietic stem cells and / or hematopoietic progenitor cells.

[0044] Furthermore, the hematopoietic stem cells and / or hematopoietic progenitor cells contain substances that increase the level of histone H4K77 acetylation modification or acetylation-like modification in the hematopoietic stem cells and / or hematopoietic progenitor cells; The substance that increases the level of histone H4K77 acetylation modification in hematopoietic stem cells and / or hematopoietic progenitor cells includes reagents that increase the level of histone H4K77 acetylation modification in hematopoietic stem cells and / or hematopoietic progenitor cells; or, the substance that increases the level of histone H4K77-like acetylation modification in hematopoietic stem cells and / or hematopoietic progenitor cells includes acetylated histone H4K77 analogs and gene editing reagents that control histone H4K77 mutations to acetylated histone H4K77 analogs.

[0045] Furthermore, the reagents for increasing the level of histone H4K77 acetylation modification in hematopoietic stem cells and / or hematopoietic progenitor cells include exogenously acetylated histone H4K77, histone H4K77 acetylation modification promoters, and gene editing reagents that control H4K77 acetylation.

[0046] Furthermore, the histone H4K77 acetylation modification promoter includes substances that inhibit histone deacetylases and substances that activate histone acetyltransferases.

[0047] Furthermore, the histone deacetylases include class I histone deacetylases, class II histone deacetylases, class III histone deacetylases, and class IV histone deacetylases.

[0048] Furthermore, the class I histone deacetylases include HDAC1, HDAC2, HDAC3, and HDAC8.

[0049] Furthermore, the substances that inhibit histone deacetylase include histone deacetylase inhibitors, drugs that inhibit histone deacetylase gene expression, drugs that knock out or knock down histone deacetylase genes, and drugs that degrade histone deacetylase.

[0050] Furthermore, the histone deacetylase inhibitor is selected from small molecule compounds, peptides, and antibodies.

[0051] Furthermore, the histone deacetylase inhibitor is an HDAC3 inhibitor, preferably a small molecule compound with the structural formula shown in Formula III: Formula III Among them, the surface recognition group A is selected from aromatic groups; Link B is selected from C 1~10 A mixed chain of alkylene, aromatic, or heterocyclic groups; The zinc-binding group C is selected from groups containing hydroxyoxime acid, o-aminobenzamide, isohydroxyoxime acid, carboxylic acid, or benzamide.

[0052] Furthermore, the HDAC3 inhibitor is selected from small molecule compounds with the structural formula shown in Formula IV: Formula IV Among them, R1 is selected from hydrogen, C 1~6 Alkyl groups, halogens; R2 is selected from hydrogen, C 1~6 Alkyl groups, halogens; Link B is selected from the group containing C. 1~10 Mixed chains of alkylene or heterocyclic groups.

[0053] Furthermore, the HDAC3 inhibitor is RGFP966.

[0054] Furthermore, the drug that inhibits histone deacetylase gene expression is selected from circular RNA, antisense nucleic acid, small interfering nucleic acid, nucleic acid aptamer, small activating nucleic acid, micronucleic acid, mRNA drug, and ribozyme.

[0055] Furthermore, the drug for knocking out or knocking down the histone deacetylase gene is selected from the CRISPR / Cas9 gene editing system, and the preferred delivery vector is a lentiviral vector or an AAV vector.

[0056] Furthermore, the drug for degrading histone deacetylase is selected from protein degrading agents, preferably selected from PROTAC and molecular gels.

[0057] Furthermore, the substance that activates histone acetyltransferase includes histone acetyltransferase agonists or drugs that overexpress histone acetyltransferase.

[0058] Furthermore, the histone acetyltransferase agonist is a small molecule compound, a polypeptide, or an antibody; or, the substance overexpressing histone acetyltransferase includes a CRISPR / Cas9 gene editing system, preferably delivered via a lentiviral vector or an AAV vector.

[0059] Furthermore, the gene editing reagent is selected from the CRISPR / Cas9 gene editing system, and the preferred delivery vector is a lentiviral vector or an AAV vector.

[0060] Furthermore, the acetylated histone H4K77 analog is a mutant of histone H4K77 with lysine mutated to glutamine.

[0061] The present invention also provides a method for delaying immune aging and systemic aging caused by immune aging and / or treating immune aging and systemic aging-related diseases caused by immune aging, wherein the method is a method for increasing the level of histone H4K77 acetylation modification or acetylation-like modification in hematopoietic stem cells and / or hematopoietic progenitor cells.

[0062] The present invention also provides the use of acetylated histone H4K77 or acetylated histone H4K77 analogs as substances for delaying immunosenescence and systemic aging caused by immunosenescence or for preventing and / or treating immunosenescence and systemic aging-related diseases caused by immunosenescence; preferably, the acetylated histone H4K77 analog is a mutant of histone H4K77 with a lysine mutation to glutamine.

[0063] This invention is the first to discover the correlation between histone H4K77 acetylation modification and immune aging, and provides a scheme to delay immune aging and prevent and treat immune aging-related diseases by targeting histone H4K77 acetylation modification or acetylation-like modification.

[0064] The key to this invention lies in the discovery that acetylated histone H4K77 or acetylated histone H4K77 analogs are associated with immunosenescence. Therefore, any method of increasing acetylated histone H4K77 or acetylated histone H4K77 analogs to delay immunosenescence and systemic aging caused by immunosenescence, or to prevent and / or treat immunosenescence and systemic aging-related diseases caused by immunosenescence, is within the scope of protection of this invention.

[0065] Regarding the definition of terminology used in this invention: Unless otherwise stated, the initial definitions provided for groups or terms herein apply to that group or term throughout the specification; for terms not specifically defined in this invention, their meanings should be given based on the disclosure and context, meanings that those skilled in the art would assign to them. Wherein: The minimum and maximum carbon atom content in hydrocarbon groups are indicated by a prefix, for example, the prefix C. a~b Alkyl groups refer to any alkyl group containing one to two carbon atoms ("a" to "b"). For example, C 1~10 Alkyl refers to a straight-chain or branched alkyl group containing 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 carbon atoms, and so on.

[0066] "Alkyl" refers to a hydrocarbon group formed by the loss of a hydrogen atom from an alkane molecule, consisting of carbon and hydrogen atoms. Alkyl groups can be straight-chain or branched, and can optionally be substituted by one or more substituents as defined in this invention. Alkyl groups include methyl, ethyl, and propyl (n-propyl and isopropyl).

[0067] "Heterocyclic group" refers to a saturated ring or a non-aromatic unsaturated ring containing at least one heteroatom and having a single ring; where heteroatoms refer to nitrogen, oxygen, sulfur, and boron atoms.

[0068] "Halogen" refers to fluorine, chlorine, bromine, or iodine.

[0069] Prevention and treatment of immune aging-related diseases refers to the prevention or treatment of diseases related to immune aging.

[0070] "Prevention" refers to taking various measures before a disease occurs in order to avoid its occurrence or delay its onset.

[0071] "Treatment" refers to taking measures to reduce or completely alleviate the symptoms of an existing disease.

[0072] "Immunosenescence" refers to the functional decline and remodeling of the immune system due to factors such as aging. It manifests as a decline in the body's immune function, accompanied by a state of chronic low-grade inflammation. The underlying cause of immunosenescence involves a shift in the differentiation lineage of hematopoietic stem and progenitor cells, showing an increase in myeloid differentiation and a decrease in lymphoid differentiation. The former exacerbates the body's inflammatory state, while the latter leads to a decline in the body's adaptive immune function.

[0073] Immunosenescence includes systemic immune imbalance caused by loss of stem cell lineage of hematopoietic stem cells, decreased lymphoid differentiation or increased myeloid differentiation of hematopoietic stem cells, increased number of cells of the innate immune system, increased age-related secretory phenotypes, abnormal differentiation and / or function of inflammatory senescent lymphocytes, decreased number of new T and / or B cells due to thymic and / or bone marrow aging, and loss and / or alteration of immune repertoire.

[0074] Adaptive immune function refers to the specific, memory immune response mediated by T cells and / or B cells.

[0075] "Immunosenescence-related diseases," also known as "systemic aging-related diseases caused by immunosenescence," refer to diseases of the body caused by immunosenescence. These include, for example, decreased immune function, infectious diseases, tumors, autoimmune diseases, cardiovascular diseases, metabolic diseases, myeloid leukemia, neurodegenerative diseases, and chronic inflammation. Infectious diseases include systemic or local tissue infections caused by pathogens such as bacteria, viruses, and fungi, such as pneumonia, otitis media, meningitis, sepsis, and recurrent respiratory infections. Tumors include lymphoma, prostate cancer, lung cancer, breast cancer, colorectal cancer, multiple myeloma, skin cancer, stomach cancer, pancreatic cancer, head and neck squamous cell carcinoma, and ovarian cancer. Glioblastoma multiforme; autoimmune diseases including rheumatoid arthritis (RA), systemic lupus erythematosus (SLE), psoriasis, and Hashimoto's thyroiditis (HT); cardiovascular diseases including coronary heart disease, myocardial infarction, stroke, and cardiac fibrosis; metabolic diseases including type 2 diabetes, obesity, fatty liver, insulin resistance, chronic kidney disease, and osteoporosis; myeloid leukemia including acute myeloid leukemia and chronic myeloid leukemia; neurodegenerative diseases including Alzheimer's disease and Parkinson's disease; chronic inflammation including atherosclerosis and chronic obstructive pulmonary disease; cardiovascular diseases including coronary heart disease, myocardial infarction, stroke, and cardiac fibrosis.

[0076] Hematopoietic stem cells (HSCs) are pluripotent stem cells found in the bone marrow. They possess two core capabilities: self-renewal and multi-lineage differentiation, enabling them to produce all types of blood cells (including myeloid and lymphoid cell lineages).

[0077] Hematopoietic progenitor cells (HPCs) are the progeny cells of hematopoietic stem cells. They have lost or significantly weakened their self-renewal capacity, but still retain the potential for proliferation and directed differentiation. They are responsible for rapidly expanding and differentiating into specific blood cell lineages.

[0078] The "acetylation modification of histone H4K77" in this invention refers to the acetylation modification of the 77th amino acid (i.e., lysine, K) of histone H4.

[0079] "Histone H4 K77-like acetylation modification" refers to the charge change of the 77th amino acid of histone H4, which is similar to that of lysine after acetylation.

[0080] "Acetylated histone H4K77 analogue" refers to a histone H4 mutant that can mimic the charge change caused by acetylation of lysine (K) at position 77 of histone H4. For example, it can be a histone H4 mutant in which lysine (K) at position 77 is mutated to glutamine (Q).

[0081] "Acetylated histone H4K77" refers to histone H4 whose lysine (K) at position 77 is acetylated.

[0082] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0083] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following embodiments. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0084] Figure 1 Immunofluorescence and flow cytometry analysis of H4K77ac in aging HSCs: (AD) The levels of H4K77ac and H4 in young and aged HSCs were detected by immunofluorescence using AF647-labeled anti-rabbit IgG antibody staining; representative confocal microscopy images of H4K77ac (A) or H4 (B) in young and aged HSCs, scale bar 2 μm; quantitative analysis of the fluorescence intensity of H4K77ac (C) and H4 (D) was performed using ImageJ. n = 167-365), fluorescence intensity was calculated per square pixel and normalized to DAPI; (EF) flow cytometry representative data (E) shows the abundance of H4K77ac in young and old HSCs, and the cumulative mean (F) shows the relative mean fluorescence intensities (MFI) of H4K77ac in young and old HSCs as measured by flow cytometry. n = 7-10), error bars represent standard error (SEM); statistical significance is determined by unpaired Student's... t Test evaluation (B, D, F). , p <0.001; , p <0.0001 is used for inter-group comparisons.

[0085] Figure 2To investigate the role of H4K77ac in regulating lymphoid differentiation in young HSCs: (AB) Overlap analysis of H4K77ac promoter-enriched genes in the transcriptomes of young and old HSCs. Venn diagrams show the overlap between H4K77ac promoter-enriched genes (TSS ± ​​3 kb) and transcriptome genes in young (blue) and old (orange) HSCs: (A) Bubble diagrams and (B) GSEA diagrams show the pathway enrichment analysis results of overlapping genes using the GSEA database (including GO, KEGG, and Reactome); NES (normalized enrichment score) was calculated using the permutation test (p < 0.05), with blue indicating genes upregulated in young HSCs and orange indicating genes upregulated in old HSCs; (C) Transcription initiation sites (TSS ± ​​3 kb) of H4K77ac CUT & Tag fragments in lymphoid and myeloid differentiation-related genes in young and old HSCs. The distribution of kb (lymphoid differentiation-related gene sets: GO:0030217 and GO:0030183, corresponding to T cell and B cell differentiation, respectively; myeloid differentiation-related gene set: GO:0030099) was analyzed using the Kruskal-Wallis rank-sum test to assess statistical significance. , indicating that p < 0.001 in the corresponding comparison.

[0086] Figure 3 Signal distribution and transcriptional changes of H4K77ac aging-related genes in young and old HSCs: (A) H4K77ac peak distribution in the promoter region of aging-related genes. The signal distribution of H4K77ac peaks at the promoter regions of characteristic genes in young (blue) or old (orange) HSCs is shown in the Genome Explorer (IGV). (B) Changes in the transcriptional level of H4K77ac aging-related genes. Transcriptome data were used to detect changes in H4K77ac aging-related genes in young (blue) and old (orange) HSCs. Foxp1, Nfia, Ncor2, Pik3cd, Lyn , Itga4 The relative mRNA expression levels of characteristic genes ( n =3-10), the cumulative mean represents the fold change normalized to the mRNA expression level of young HSCs, the error bars represent SEM, and two-way ANOVA was used to assess statistical significance. Indicates the corresponding comparison p Value < 0.001.

[0087] Figure 4 HDAC3 is a deacetylase that regulates H4K77ac: (A) Comparative analysis of the H4K77 acetylated peptide and its unmodified form, pull-down protein. (B) ShRNA- Hdac3 Knock out inefficient verification methods.

[0088] Figure 5 Knockdown in older HSCs Hdac3 Promoted lymphoid differentiation: In vitro differentiation experiments of senescent HSCs infected with (AF) shRNA-Hdac3 (shRNA#1) or vector control. Representative data (A, D) and cumulative means (B, C, E, F) illustrate the effects of shRNA- Hdac3 CD45 derived from infected HSCs or vector control HSCs + mCherry + T lymphocytes (CD4) in cells - CD8 - CD4 + CD8 + ), B lymphocytes (CD19) + ) or bone marrow cells (CD11b + The differentiation frequency of ). The cumulative mean is presented as a fold change relative to the control group, ( n = 14-20, three independent experiments). Error bars represent SEM. Unpaired Student's... t Test and evaluate statistical differences (B, D). , p <0.01; , p <0.001, used for inter-group comparisons.

[0089] Figure 6 Representative abundance of H4K77ac in HSCs after treatment with different concentrations of RGFP966.

[0090] Figure 7 RGFP966 promotes HSC differentiation into lymphoid lineage: (AB) In vitro differentiation experiments of HSCs treated with the HDAC3 inhibitor RGFP966: Representative data (A) and cumulative mean (B) show the effect of different concentrations of RGFP966 on CD45 differentiation. + B lymphocytes (CD19) in cells + ), bone marrow cells (CD11b + ) and T lymphocytes (CD4) - CD8 - CD4 + CD8 + The differentiation frequency of ) n = 3-4 (three independent repeated experiments), error bars represent SEM, and statistical differences were assessed using one-way ANOVA with Tukey multiple comparison correction (B). p<0.05; p<0.01; , p<0.001, used for labeled inter-group comparisons.

[0091] Figure 8 Cut & Tag Analysis of H4K77ac in RGFP966-treated aged HSCs: (A) A heatmap showing the Z-scores of the differential peaks enriched by H4K77ac in RGFP966- and DMSO-treated aged hematopoietic stem cells, analyzed using the DiffBind tool. (B) Gene set enrichment analysis (GSEA) of pre-sorted genes enriched by H4K77ac in RGFP966- and DMSO-treated hematopoietic stem cells from young and aged mice (permutation test, p < 0.05). Differential peaks were identified using the DiffBind tool (p < 0.1).

[0092] Figure 9 To illustrate the changes in H4K77ac in characteristic genes in aged HSCs treated with RGFP966, IGV shows the distribution of H4K77ac peaks in the promoter regions of characteristic genes in aged HSCs treated with RGFP966 (pink) or DMSO (blue).

[0093] Figure 10 RGFP966 restored the expression of H4K77ac-related genes. The relative mRNA levels of H4K77ac-related genes in young HSCs (cyan), aged HSCs (dark blue), and RGFP966-treated aged HSCs (pink) were detected by qPCR (n = 3-6, at least three independent experiments). Cumulative means are presented as fold changes relative to young HSC levels. Error bars represent SEM. One-way ANOVA was used to assess statistical differences. p<0.05; p<0.01; p<0.001; , p<0.0001, used for labeled inter-group comparisons.

[0094] Figure 11 To represent the overexpression efficiency of histone mutants, Western blot representations show the expression of H4 Total protein in Lin-bone marrow cells infected with H4K77 mutant virus or vector control.

[0095] Figure 12 In vitro differentiation experiments of H4K77 mutant overexpressing HSCs: (A) Cumulative mean showing GFP from H4 WT / K77R / K77Q HSCs. + CD45 + (A) Median fluorescence index (MFI) of GFP in cells; (B) Representative data from in vitro differentiation experiments of HSCs overexpressing the H4K77 mutant; (C) GFP derived from HSCs overexpressing H4K77R / Q.+ CD45 + T lymphocytes (CD4) in cells + CD8 + CD4 - CD8 - (C), B lymphocytes (B220) + (D) and myeloid cells (CD11b) + (E) Cumulative average frequency ( n = 5-8 (three independent replicates), error bars represent SEM, using unpaired Student's... t The CE test is used to assess statistical significance. , p <0.05; , p <0.01; , p <0.001; used for inter-group comparisons.

[0096] Figure 13 A schematic diagram of the in vivo transplantation experiment design.

[0097] Figure 14 Lineage reconstruction for in vivo transplantation of H4K77 mutant HSCs: (A) Flow cytometry representation of lineage differentiation (myeloids, B lymphocytes, T lymphocytes, and DCs) in peripheral blood; (B) Stacked bar plots depicting the frequency (per group) of these lineages (myeloids, B lymphocytes, T lymphocytes, and DCs) in peripheral blood at 8, 12, and 16 weeks post-transplantation. n = 9 receptors). Error bars represent SEM, and Tukey multiple comparison correction was performed using two-way ANOVA. , p <0.05; , p <0.01; used for inter-group comparisons. Detailed Implementation

[0098] The raw materials, reagents and equipment used in this invention are all known products, obtained by purchasing commercially available products.

[0099] I. Experimental materials used in the following examples: 1. Laboratory animals C57BL / 6J mice were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd., B6.SJL-Ptprc a Pepc b / BoyJ (SJL) mice were purchased from The Jackson Laboratory (Bar Harbor, ME). All mice were housed in an SPF-grade animal facility. Mice aged 6-8 weeks were considered young, and mice aged 18-28 months were considered old.

[0100] 2. Cells and bacterial strains (1) Cells: Human embryonic kidney 293T cells (HEK293T) and human chronic myeloid leukemia cells (K562) were obtained from the China Center for Type Culture Collection (CCTCC); OP9-GFP and OP9-DL4 stromal cell lines were provided by the Fifth Medical Center of the PLA General Hospital.

[0101] (2) Strains: E. coli DH5α competent strain was purchased from Takara Bio and used for plasmid amplification.

[0102] 3. Preparation of main solutions The solutions involved in the embodiments of this invention are all prepared using conventional methods in the art or according to the instructions of the corresponding reagents.

[0103] II. Experimental methods used in the following examples 1. Obtaining mouse bone marrow samples Mice were euthanized by CO2 asphyxiation. The humerus, ilium, femur, and tibia were harvested, and muscle tissue was removed. The medullary cavity was rinsed with pre-cooled PBS buffer containing 2% FBS or the bones were ground to collect bone marrow suspension. Red blood cell lysis buffer (3 mL / mouse) was added, and the mixture was incubated at room temperature for 5 min. After neutralization, the mixture was centrifuged (450 × g, 5 min, 4 °C) to collect the cell pellet for cell counting.

[0104] 2. Enrichment of mouse hematopoietic stem cells (1) Used for flow cytometry analysis: per 1×10 8 Bone marrow cells were resuspended in 250 μL of PBS buffer and incubated on ice for 30 min with 5 μL each of biotin-conjugated lineage antibodies (CD11b, Gr-1, TER119, B220, and CD3e). After washing, 50 μL of anti-Rat IgG magnetic beads were added and the cells were incubated on ice for 30 min. The cells were then passed through an LS sorting column, and the cell suspension was collected by centrifugation.

[0105] (2) For flow cytometry sorting: Use the Mouse hematopoietic progenitor cell isolation kit according to the manufacturer's instructions. Bone marrow cells were sorted at a ratio of 1 × 10⁻⁶. 8Resuspend cells at 1 / mL, add Fc block (20 μL / mL) and Cocktail mix (50 μL / mL), incubate on ice for 15 min, then add Streptavidin magnetic beads (75 μL / mL) and incubate for another 10 min. Place in EasySep. TM Incubate the cells in a magnetic rack at room temperature for 3 minutes, then pour out the cell suspension. Repeat this process 3 times, and collect the cells by centrifugation.

[0106] 3. Staining and sorting of mouse hematopoietic stem cells Each 1×10 8 Cells were resuspended in 300 μL PBS buffer, and 6 μL of Fc block was added. Cells were incubated on ice for 30 min. 300 μL of premixed antibody (antibody composition and dilution ratios are shown in the table below) was added, and cells were stained on ice in the dark for 30 min. After washing, cells were centrifuged. Cells were analyzed using BDFACS Aria. TM The sorting is performed using a flow cytometer. The sorting strategy is as follows: HSC (Lin) - (TER119) - CD11b - Gr-1 - B220 - CD3e - CD127 - Sca1 + c-Kit + CD150 + CD48 - ); MPP1 (Lin) - CD127 - Sca1 + c-Kit + CD150 + CD48 + ); MPP2 (Lin) - CD127 - Sca1 + c-Kit + CD150 - CD48 + CD135 - ); MPP3 (Lin) - CD127 - Sca1 + c-Kit + CD150 - CD48 + CD135 + ).

[0107] 4. Flow cytometry analysis (1) Cell surface protein staining: Add premixed antibody to 100 μL system and stain on ice in the dark for 30 min. Add 1 mL pre-cooled PFE buffer, centrifuge at 4°C and 450×g for 5 min, and discard the supernatant. Resuspend in 400 μL of 4% paraformaldehyde, filter, and then perform detection.

[0108] (2) Intracellular protein staining: After surface staining, resuspend in 500 μL Foxp3 working solution (Fixation / Permeabilization Concentrate: Diluent = 1:3), and punch in wells on ice in the dark for 30 min. Add 1 mL wash buffer (1×Permeabilization Buffer), centrifuge at 600×g for 5 min at 4°C. Resuspend in 50 μL blocking buffer (wash buffer containing 2% FBS), and incubate at room temperature for 15 min. Add H4K77ac (1:2500) or H4 Total (1:100) primary antibody, stain at room temperature in the dark for 30 min, wash, add AF647 anti-Rabbit IgG (1:600) secondary antibody, stain at room temperature in the dark for 30 min, wash, and then use for flow cytometry analysis.

[0109] 5. Microscope confocal After intracellular staining, add DAPI at a 1:1000 ratio and stain in the dark for 5 minutes, then wash. Use a Cytospin 4 shaker (300 rpm, 7 minutes) to transfer the cells onto an immunohistochemistry slide designed to prevent cell detachment. Add 20 μL of 75% glycerol, cover with a coverslip, and observe under a confocal microscope.

[0110] 6. Retrovirus and Lentiviral Packaging The calcium chloride transfection method was used in six-well plates. 293T cells were seeded 24 hours prior to transfection (0.5-0.6 × 10⁻⁶ cells per well). 6 / hole). The transfection system is as follows: (1) Retrovirus: 2 μg of target plasmid, 2 μg of pCL-Eco, 40 μL of 1.25M CaCl2, and sterile water to make up to 200 μL. Slowly add 200 μL of 2×HBSS.

[0111] (2) Lentiviral: 3 μg of target plasmid, 2 μg of psPAX2, 1 μg of pMD2.G, 40 μL of 1.25M CaCl2, and sterile water to make up to 200 μL. Slowly add 200 μL of 2×HBSS.

[0112] Replace with fresh culture medium 8 hours after transfection. Collect viral supernatant 48-72 hours later, centrifuge at 1500 rpm for 5 minutes, filter the supernatant through a 0.45 μm filter, and store at -80°C.

[0113] 7. Primary cell viral infection Mice were intraperitoneally injected with 5-FU (3 mg / 20 g body weight) before infection. The virus solution was supplemented with 10% FBS, 10 ng / mL LSCCF, 100 ng / mL TPO, and 8 μg / mL Polybrene. Primary cells were resuspended in this virus solution, transferred to 48-well plates, centrifuged at 1800 rpm and 31°C for 60 min, and incubated at 37°C for 4 h. The cells were then washed and used for subsequent experiments.

[0114] 8. In vitro differentiation experiment of HSCs One day in advance, seed OP9-GFP or OP9-DL4 stromal cells into 24-well plates (3-4 × 10⁶ cells / well). 4 / well). The next day, the stromal cells were irradiated with 15 Gy. Prepare the differentiation medium according to the table below: HSCs were resuspended in the above-described medium and seeded at a rate of 1000 cells / well into 24-well plates containing irradiated matrix cells. On day 7, the plates were transferred to 6-well plates pre-coated with irradiated matrix cells. Cells were collected on day 14, filtered through a 40 μm screen, stained, and CD11b was detected by flow cytometry. + (Myeloid), B220 + / CD19 + (B cells), CD4 + CD8 + (T cells).

[0115] 9. CUT & Tag Experiment The NovonGS CUT&Tag High-sensitivity Kit was used according to the manufacturer's instructions. 20,000 sorted HSCs were resuspended in Primary Antibody Buffer containing 0.25 μg H4K77ac antibody and incubated overnight at 4°C with rotation. The next day, secondary antibody (Goat Anti-Rabbit IgG H&L, 1:100) was added and incubated at room temperature with shaking for 1 hour. After washing, ChiTag transposome dilution containing pAG-transposome was added and incubated at room temperature with shaking for 1 hour. Tagmentation buffer containing MgCl2 was added and incubated at 37°C for 1 hour. The reaction was terminated by adding 5×Stop Buffer and incubated at 55°C for 10 minutes. DNA was extracted and PCR library amplification was performed. The amplification products were purified using DNA Clean Beads. After quality control using Qubit and Agilent 2100, the library was sequenced at 150 bp using an Illumina X10 Sequencer.

[0116] 10. ATAC-seq experiment The High-Sensitivity Open Chromatin Profile Kit 2.0 was used according to the manufacturer's instructions. 50,000 sorted HSCs were resuspended in pre-chilled Lysis buffer and lysed on ice for 5 min. Lysis was terminated with Wash buffer, and the nuclei were collected by centrifugation. The cells were resuspended in 40 μL of the fragmented mix and incubated at 37°C for 30 min. The reaction was terminated with Stop buffer and incubated at 55°C for 10 min. DNA was extracted and PCR library amplification was performed (12 cycles). The amplification products were purified using DNA Clean Beads. After quality control, the library was sequenced at 150 bp using an Illumina NovaX Plus Sequencer.

[0117] 11. HSC in vivo transplantation experiment Recipient mice (CD45.2) + Two weeks prior to transplantation, the mice were fed with hydrochloric acid solution (pH=3.0). On the day of transplantation, the recipient mice underwent two irradiation treatments (4.5 Gy each time, 3-4 hours apart). 2 × 10⁻⁶ cells were collected. 5 Transplantation of competing bone marrow cells (CD45.2) + Resuspend in pre-cooled PBS. The donor source (CD45.1) + Or CD45.1 + CD45.2 +After being infected with a virus, sorted HSCs were mixed with competing bone marrow cells and transplanted via tail vein injection. Patients were fed hydrochloric acid solution containing gentamicin sulfate (1 mg / mL) for one week post-transplantation. Peripheral blood was collected at weeks 8, 12, and 16 post-transplantation to analyze reconstitution capacity and differentiation potential.

[0118] 12. Western blot assay Cells were sorted and lysed on ice for 30 min using RIPA lysis buffer containing protease inhibitors, followed by sonication (30% energy, 3 sec sonication, 6 sec pause, 2 min). The cells were then centrifuged at 13300 rpm at 4°C for 15 min. The supernatant was collected, and after BCA quantification, 6×SDS loading buffer was added, and the cells were boiled at 100°C for 5 min. Samples were separated by 12.5% ​​SDS-PAGE and transferred to a PVDF membrane, blocked with 5% milk for 1 h. The target antibody was added and incubated overnight at 4°C. After washing with TBST, HRP-conjugated secondary antibody was added and incubated at room temperature for 2 h. After washing, chemiluminescence detection was performed.

[0119] 13. MicroRNA extraction and qPCR experiment RNA was extracted using the Arcturus PicoPure RNA Isolation Kit according to the manufacturer's instructions. Sorted HSCs were centrifuged, resuspended in 100 μL of Extraction Buffer, and incubated at 42°C for 30 min. The supernatant was collected after centrifugation, added with 70% ethanol, and passed through an RNA purification column. The RNA was washed sequentially with Wash buffer 1 and Wash buffer 2, and finally eluted with Elution buffer. After reverse transcription to cDNA, qPCR was performed according to the following protocol: (1) Reaction system: 4 μL cDNA template, 0.5 μL each of qPCR primers (10 μM), 5 μL iTaq Universal SYBRGreen Supermix, total volume 10 μL.

[0120] (2) Reaction procedure: 95°C pre-denaturation for 3 min; 95°C for 15 sec, 60°C for 30 sec (fluorescence collection), for a total of 45 cycles; melting curve analysis was performed.

[0121] (3) qPCR primer sequences: Example 1: Experiment on the correlation between histone H4K77 acetylation and immune aging 1. Downregulation of H4K77ac during aging This invention utilizes immunofluorescence confocal microscopy (IFN-γ) Figure 1 A to Figure 1 D) and flow cytometry ( Figure 1 E to Figure 1 F) The changes in H4K77ac levels in HSCs of mice of different ages were analyzed. The results showed that the acetylation level of H4K77ac decreased significantly in aging HSCs, and the downregulation of H4K77ac was due to the reduced degree of acetylation modification at this site, rather than changes in the expression level of H4 itself.

[0122] 2. H4K77ac participates in the differentiation of HSC lineages. This invention integrates transcriptomic data and H4K77ac CUT & Tag data from young (2-month-old) and aged (28-month-old) HSCs. The results show that most genes exhibiting significant differences in H4K77ac levels in their promoter regions (TSS±3kb) highly overlap with differentially expressed genes during aging. GSEA analysis of these key genes indicates they are primarily associated with pathways such as lineage differentiation, signal transduction, and metabolic regulation. Figure 2 A). Furthermore, there were significant differences in the enrichment signals of the two gene sets in young and aged HSCs. Pathways related to lymphocyte development, such as T cell differentiation and activation, B cell receptor (BCR) signaling, and Notch signaling, were enriched only in young hematopoietic stem cells; while genes involved in regulating protein synthesis, transcription, and translation were specifically enriched by H4K77ac in aged HSCs. Figure 2 B). This invention also analyzed the distribution of H4K77ac in lymphoid and myeloid gene concentrations in young and old HSCs. The results showed that the distribution of H4K77ac in lymphoid differentiation-related gene concentrations decreased significantly with age, while the distribution in myeloid gene concentrations did not show a significant age correlation. Figure 2 C).

[0123] This invention analyzed genes specifically enriched with H4K77ac in the promoter region of young HSCs. The results showed that several genes closely related to lymphoid differentiation, including Foxp1, Ncor2, Nfia, Pik3cd, Lyn and Itga4 The enrichment of H4K77ac on its TSS region is significantly reduced in aging HSCs. Figure 3 A). Accordingly, by analyzing the transcriptome data of HSCs in young and old mice, this invention discovered the aforementioned key genes regulating lymphoid differentiation ( Foxp1, Ncor2, Nfia, Pik3cd, Lyn and Itga4 The transcriptional levels of ) were significantly decreased in aging HSCs. Figure 3 B). This result suggests that the loss of H4K77a modification during aging may be an important reason for the decline in transcriptional activity of these key lymphoid differentiation genes.

[0124] In summary, the reduction of H4K77ac in senescent HSCs leads to an imbalance in the regulatory network of these key transcription factors, ultimately manifesting as a decrease in lymphoid differentiation potential.

[0125] Example 2: Experiments on HDAC3 regulation of histone H4K77 acetylation and immune aging 1. HDAC3 is a potential deacetylase of H4K77ac. This invention employed pull-down experiments to screen for potential acetylation regulators of H4K77ac. First, acetylated peptides of H4K77 and unmodified control peptides were designed and synthesized, and enriched by incubation in K562 protein lysis buffer. Subsequent mass spectrometry analysis was used to identify differences in interacting proteins. The results showed that histone deacetylase 3 (HDAC3) was specifically enriched by the H4K77 acetylated peptide and was the only histone deacetylase enriched by H4K77ac, suggesting that HDAC3 may be a potential target for regulating H4K77ac. Figure 4 A).

[0126] 2. Knocking down HDAC3 increases H4K77ac and promotes HSC differentiation into lymphoid lineages. To investigate whether targeting HDAC3 can regulate H4K77ac and alter the lineage differentiation of HSCs, this invention designed two shRNA sequences (#1 and #2) targeting HDAC3, cloned them, inserted them into the pSicoR-mCherry-empty vector, packaged them using a lentiviral system, and then infected cells.

[0127] shRNA- Hdac3 #1 sequence: TGAGGCCATTAGTGAGGAACTTTTCAAGAGAAAGTTCCTCACTAATGGCCTCTTTTTTC (SEQ IDNo. ​​1); shRNA- Hdac3 #2 sequence: TCGTGGCTCTCTGAAACCTTAATTCAAGAGATTAAGGTTTCAGAGAGCCACGTTTTTT (SEQ ID No. 2).

[0128] This invention validated shRNA- in the K562 cell line. Hdac3 It can knock down HDAC3 protein expression and promote the increase of H4K77ac. Figure 4 B).

[0129] To further investigate the effect of increasing H4K77ac levels by knocking down HDAC3 on HSC lineage differentiation, this invention selected shRNA with higher knockdown efficiency. Hdac3 #1. Further functional validation will be performed. HSCs from aged mice will be infected, and [the following will be constructed / constructed / implemented]. Hdac3 -knockdown( Hdac3Following the KD) HSC, this invention co-cultured it with OP9-GFP or OP9-DL4 stromal cells for 14 days and then detected... Hdac3 -KD HSCs showed changes in lymphoid and myeloid differentiation potential. Successfully infected cells were distinguished by mCherry fluorescent labeling, and CD45 was also analyzed. + mcherry + Cells were analyzed. Results showed that, compared to the control group, Hdac3 -KD HSCs exhibit higher T cell (CD4+) levels. + CD8 + ) and B cells (CD19) + The differentiation ratio of myeloid cells (CD11b) + The differentiation rate of ) has decreased significantly. Figure 5 A to Figure 5 F). These results indicate that knocking down HDAC3 can promote lymphoid differentiation in aged HSCs by increasing the level of H4K77ac, suggesting that HDAC3 may be a potential anti-aging target for restoring the insufficient lymphoid differentiation capacity of aged HSCs.

[0130] 3. RGFP966 promotes H4K77ac by inhibiting HDAC3. Knockdown of HDAC3 is beneficial to lymphoid differentiation of HSCs, but HDAC3 functions through both enzyme-dependent and non-enzyme-dependent pathways, and the shRNA knockdown model cannot distinguish between these two functional pathways.

[0131] This invention compared the effects of HDAC3 inhibitor RGFP966 and SIRT2 inhibitor Thiomyristoyl treatment on H4K77ac levels, finding that only RGFP966 significantly increased H4K77ac levels, indicating that H4K77ac is specifically regulated by HDAC3. To specifically inhibit HDAC3 enzyme activity, this invention used the inhibitor RGFP966 to explore the effect of reduced HDAC3 activity on HSC lineage determination. Flow cytometry results showed that under 0.5-2 μM RGFP966 treatment, H4K77ac levels in HSCs exhibited a clear dose-dependent increasing trend (…). Figure 6 Treatment with 0.5–2 μM RGFP966 increased HSC differentiation into B cells and T cells in a dose-dependent manner, while decreasing differentiation into myeloid cells. Figure 7 A to Figure 7 B) indicates that RGFP966 can increase H4K77ac levels and promote lymphoid differentiation potential of HSCs by inhibiting HDAC3 enzyme activity.

[0132] 4. RGFP966 remodels chromatin accessibility in aged HSCs by regulating HDAC3. This invention utilizes RGFP966 (1 μM) to treat aged HSCs and detects changes in the genomic distribution of H4K77ac using cut & tag analysis. The results show that RGFP966 treatment significantly increases the cut & tag signal of H4K77ac in aged HSCs. Figure 8 A). Gene pathway analysis further revealed that genes with increased H4K77ac modification were mainly enriched in pathways related to hematopoietic lineage regulation, lymphocyte differentiation and activation, especially T / B cell proliferation and activation signaling pathways. Figure 8 B).

[0133] Key lymphoid genes whose H4K77 acetylation distribution in the TSS region significantly decreases during aging include: Foxp1, Ncor2, Nfia, Pik3cd, Lyn and Itga4 After RGFP966 treatment, the enrichment peak of H4K77ac in its promoter region increased significantly. Figure 9 ).

[0134] This invention also detected the expression levels of related genes in young HSCs, aged HSCs, and aged HSCs treated with RGFP966. qPCR results showed that the transcriptional levels of these key lymphoid genes, whose expression levels significantly decreased during aging, were significantly restored after RGFP966 treatment. Figure 10 This indicates that RGFP966, by inhibiting HDAC3 activity and increasing H4K77ac levels, can effectively enhance the transcription and expression levels of key lymphoid genes in senescent HSCs, thereby reversing the insufficient lymphoid differentiation in senescent HSCs.

[0135] In summary, RGFP966 can effectively reverse the decline in H4K77ac levels in aged HSCs, acting as a promoter of histone H4K77 acetylation modification and enhancing lymphoid differentiation in HSCs. This finding provides important experimental evidence for correcting HSC lineage differentiation imbalance and reversing immunosenescence by targeting H4K77ac.

[0136] Example 3: Site-directed mutagenesis experiment of histone H4K77 1. Constructing point mutations for H4K77 This invention first constructed the wild-type H4 WT plasmid and the H4K77R and H4K77Q mutant plasmids. All plasmids were cloned into the MigR1 plasmid and co-expressed with the reporter gene GFP downstream of the same CMV promoter.

[0137] The point mutation sequences are as follows: The lysine (K, AAG) at position 77 of the H4 protein is mutated to arginine (R, AGG) or glutamine (Q, CAG) to obtain the H4K77R and H4K77Q sequences. The specific sequences are as follows: To evaluate overexpression efficiency, Lin⁻ bone marrow cells obtained by magnetic bead sorting were infected with a virus. After flow cytometry sorting of GFP⁺ cells, total protein was extracted, and the overall overexpression of histone H4 was detected by Western blotting. The results showed that compared with the control group infected with empty vector virus (representing the background level of endogenous histones), the expression levels of H4 protein in the H4 WT, H4K77Q, and H4K77R mutant infection groups were significantly increased, and the expression levels among the mutants were comparable. Figure 11 This result confirms the adequate overexpression of exogenous histones, providing an experimental basis for subsequent functional studies.

[0138] 2. In vitro experiments verified that overexpression of the H4K77 mutant affects the differentiation potential of HSCs. To investigate whether the H4K77 mutant has a regulatory effect on the lineage determination of HSCs, this invention first infected senescent HSCs with H4 WT, H4K77Q, or H4K77R viruses, and then assessed their lineage differentiation potential through in vitro differentiation experiments. Since the target genes all share the same promoter as GFP, this invention used the mean fluorescence intensity (MFI) of GFP to reflect the expression levels of each protein mutant. The results showed that the expression levels of the three mutants in the in vitro differentiation system were comparable (…). Figure 12 A) ruled out the possibility of phenotypic changes due to differences in expression levels. Flow cytometry analysis further showed that, compared to the non-acetylated H4K77R, the acetylated H4K77Q significantly promoted the differentiation of HSCs into T cells and B cells, while inhibiting myeloid cell differentiation (A). Figure 12 BE).

[0139] In summary, in vitro experiments have demonstrated that simulated H4K77ac can significantly promote lymphoid differentiation of senescent HSCs and inhibit myeloid differentiation.

[0140] 3. In in vivo experiments, H4K77ac promotes the lymphoid differentiation potential of HSCs. To further evaluate whether simulated H4K77 acetylation also affects the differentiation potential of HSCs in vivo, a competitive in vivo transplantation experiment was conducted. CD45 homologous markers (CD45.1⁺, CD45.1⁺, CD45.2⁺, and CD45.2⁺) were used to distinguish donor and recipient cells from different treatments. HSCs from aged CD45.1⁺, CD45.2⁺, or CD45.1⁺ mice were infected with H4K77Q and H4K77R, respectively, and then co-transplanted into the same CD45.2⁺ recipient mouse at a 1:1 ratio. At weeks 8, 12, and 16 post-transplantation, the phenotypic distribution of various immune cells in peripheral blood was analyzed by flow cytometry to assess the impact of H4K77Q and H4K77R on HSC lineage export. Figure 13 ).

[0141] Peripheral blood lineage reconstruction analysis showed that, between 8 and 16 weeks post-transplantation, HSCs overexpressing H4K77Q exhibited a significantly increased lymphoid differentiation rate and a decreased myeloid differentiation rate compared to HSCs overexpressing H4K77R. Figure 14 A- Figure 14 B). This result confirms that in vivo acetylation via H4K77Q mimics the acetylation state, effectively promoting HSC differentiation into lymphoid cells and inhibiting myeloid bias.

[0142] In summary, this invention elucidates the core regulatory role of H4K77ac in HSC lineage determination. By constructing an H4K77Q mutant to simulate acetylation, the lineage differentiation imbalance in aging HSCs was successfully reversed in in vitro and in vivo experimental systems, promoting lymphoid differentiation. These findings not only reveal a novel mechanism of lineage dysregulation in HSC aging from the perspective of epigenetic modification, but also provide direct experimental evidence for aging intervention strategies targeting H4K77ac.

[0143] This invention provides the use of substances targeting histone H4K77 acetylation or acetylation-like modifications in the preparation of drugs for delaying immunosenescence and systemic aging caused by immunosenescence. This invention is the first to discover that increasing histone H4K77 acetylation or acetylation-like modifications can effectively delay immunosenescence and systemic aging caused by immunosenescence, and treat immunosenescence and related systemic aging diseases. This invention provides a new option for clinically delaying immunosenescence and systemic aging caused by immunosenescence, and for treating related systemic aging diseases, and has broad application prospects.

Claims

1. The use of substances targeting histone H4K77 acetylation or acetylation-like modifications in the preparation of drugs for delaying immunosenescence or preventing and / or treating systemic aging-related diseases caused by immunosenescence, characterized in that: The substance is one that increases the acetylation or acetylation-like modification level of histone H4K77 in stem and progenitor cells.

2. The use according to claim 1, characterized in that: The substances that increase the level of histone H4K77 acetylation modification in stem and progenitor cells include exogenously acetylated histone H4K77, histone H4K77 acetylation modification promoters, gene editing reagents that control H4K77 acetylation, and stem and progenitor cells containing gene editing reagents that control H4K77 acetylation, or stem and progenitor cells treated with exogenously acetylated histone H4K77 or histone H4K77 acetylation modification promoters.

3. The use according to claim 1, characterized in that: The substances that increase the level of histone H4K77 acetylation modification in stem and progenitor cells include acetylated histone H4K77 analogs, gene editing reagents that control histone H4K77 mutations to acetylated histone H4K77 analogs, and stem and progenitor cells containing acetylated histone H4K77 analogs and gene editing reagents that control histone H4K77 mutations to acetylated histone H4K77 analogs.

4. The use according to claim 2, characterized in that: The histone H4K77 acetylation modification promoter includes a small molecule compound with the structural formula shown in Formula II: Formula II Among them, R1 is selected from hydrogen, C 1~6 Alkyl groups, halogens; R2 is selected from hydrogen, C 1~6 Alkyl groups, halogens; Link B is selected from the group containing C. 1~10 A mixed chain of alkylene or heterocyclic groups.

5. The use according to claim 4, characterized in that: The small molecule compound is RGFP966.

6. The use according to claim 3, characterized in that: The acetylated histone H4K77 analogue is a mutant of histone H4K77 with lysine mutated to glutamine or other negatively charged amino acids.

7. The use according to any one of claims 1 to 6, characterized in that: The drug is one that promotes lymphoid differentiation of stem and progenitor cells or reduces myeloid differentiation of stem and progenitor cells.

8. A modified stem progenitor cell, characterized in that: It is a stem progenitor cell with upregulated levels of histone H4K77 acetylation or acetylation-like substances; it includes histone H4K77 acetylation modification promoters or acetylated histone H4K77 analogs.

9. The stem progenitor cells according to claim 8, characterized in that: The histone H4K77 acetylation modification promoter includes a small molecule compound with the structural formula shown in Formula II: Formula II Among them, R1 is selected from hydrogen, C 1~6 Alkyl groups, halogens; R2 is selected from hydrogen, C 1~6 Alkyl groups, halogens; Link B is selected from the group containing C. 1~10 Mixed chains of alkylene or heterocyclic groups; Alternatively, the acetylated histone H4K77 analogue is a mutant of histone H4K77 with a lysine mutation to glutamine.