IbTGA protein, coding gene and application of IbTGA protein in regulation and control of sweet potato vine growth

Abstract

The invention belongs to the field of plant genetic engineering technology and sweet potato breeding, and particularly relates to application of an IbTGA gene in regulation and control of sweet potato vine growth, and the nucleotide sequence of the gene is shown as SEQ ID NO.1. It is confirmed for the first time that overexpression of the IbTGA gene in sweet potatoes can significantly increase the length between stem nodes to promote vine growth, and expression of the IbTGA gene is inhibited through a gene knockout technology to significantly shorten the length between stem nodes to slow down vine growth. On the basis, the invention provides the following application: a new sweet potato variety which is moderate in vine length and convenient to mechanically receive is created by regulating and controlling the expression abundance of the IbTGA gene; in specific implementation, the IbTGA gene is constructed to an expression vector, and a transgenic plant is obtained through agrobacterium-mediated transformation of sweet potato calluses. The invention provides a new gene resource and breeding technology for improving the property of the overground part of the sweet potato.

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and sweet potato breeding, specifically involving an IbTGA protein, its encoding gene, and its application in regulating the growth of sweet potato vines. Background Technology

[0002] sweet potato( Ipomoea batatas Sweet potato is an important dual-purpose crop for both food and cash crops in my country. However, its long vines often significantly hinder mechanized harvesting. Furthermore, excessively long vines can intertwine and overlap, preventing some leaves from performing effective photosynthesis and thus affecting the biomass accumulation of the tubers. Therefore, effectively controlling sweet potato vine length and preventing excessive growth is crucial for improving the efficiency and yield of mechanized sweet potato harvesting.

[0003] Transcription factors play a crucial role in crop genetic engineering because their overexpression or interference can systematically upregulate or downregulate gene clusters related to growth and development, thereby regulating key agronomic traits such as plant height. Among these, the TGA family consists of plant-specific C2-C2 zinc finger proteins that exhibit significant responses to plant hormones, nutritional status, and various abiotic stresses. Although their roles in stress adaptation and growth regulation are well-established, no studies have yet reported on the regulation of sweet potato vine length by IbTGA. Summary of the Invention

[0004] The purpose of this invention is to provide an IbTGA protein, its encoding gene, and its application in regulating sweet potato vine growth, thereby addressing the problems existing in the prior art. In this invention, the IbTGA protein and its encoding gene play an important role in regulating sweet potato vine growth, providing new genetic resources and breeding techniques for improving the agronomic traits of sweet potato.

[0005] To achieve the above objectives, the present invention provides the following solution: This invention provides an IbTGA protein related to the regulation of sweet potato vine growth, which is derived from sweet potato and is a protein as follows (1) or (2): (1) A protein consisting of the amino acid sequence shown in SEQ ID NO: 2; (2) A protein derived from the protein described in (1) with the amino acid sequence shown in SEQ ID NO: 2 having one or more amino acid residues substituted and / or deleted and / or added, and which is associated with plant stem growth.

[0006] To achieve the above objectives, the present invention also provides a gene encoding the IbTGA protein.

[0007] Furthermore, the gene is any one of the following DNA molecules (1)-(3): (1) The DNA molecule shown in SEQ ID NO: 1; (2) A DNA molecule that hybridizes with the DNA molecule defined in (1) under strict conditions and encodes a protein related to plant stem growth; (3) A DNA molecule that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with the DNA sequence defined in (1) and encodes a plant stem growth-related protein.

[0008] To achieve the above objectives, the present invention also provides the application of the above-mentioned IbTGA protein or the encoding gene in regulating the growth of sweet potato vines, wherein the regulation is achieved by changing the expression level of the encoding gene to increase or decrease the growth of sweet potato vines.

[0009] Further, improve IbTGA The level of gene expression increases the growth of sweet potato vines.

[0010] Furthermore, suppression IbTGA The level of gene expression reduces the growth of sweet potato vines.

[0011] The present invention also provides a method for regulating the length of sweet potato vines, comprising any of the following steps: Overexpression in sweet potatoes IbTGA Genes that promote vine growth; or inhibition IbTGA Gene expression slows down vine growth.

[0012] Among them, the IbTGA The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0013] Furthermore, the overexpression in step (a) includes: converting the... IbTGA Genes are inserted into suitable expression vectors to construct recombinant plasmids, which are then transformed into sweet potato cells or tissues through genetic transformation.

[0014] Furthermore, in step (b), inhibition is achieved through gene knockout (Crisper Cas9). IbTGA Gene expression.

[0015] Furthermore, the genetic transformation is performed using Agrobacterium-mediated transformation, wherein the infection receptor is preferably sweet potato callus tissue.

[0016] The technical solution provided by this invention brings beneficial effects as follows: This invention discloses IbTGA The gene is a key gene regulating sweet potato vine growth. A method is provided to regulate... IbTGAGene expression levels (overexpression or knockout) are an effective technical means to directionally alter sweet potato vine length, providing important genetic resources and core technologies for effectively regulating sweet potato vine length, preventing excessive growth, and thus improving the efficiency and yield of mechanized sweet potato harvesting. Attached Figure Description

[0017] Figure 1 In sweet potatoes IbTGA Gene clone agarose gel electrophoresis image.

[0018] Figure 2 for IbTGA A schematic diagram of the structure of the gene overexpression vector pCAMBIA1301-IbTGA.

[0019] Figure 3 for IbTGA A schematic diagram of the structure of the gene knockout vector pHSE401-IbTGA.

[0020] Figure 4 for IbTGA PCR detection diagram of overexpressing transgenic sweet potato.

[0021] Figure 5 for IbTGA Figure showing the results of expression level analysis in overexpression and gene knockout transgenic sweet potatoes.

[0022] Figure 6 Phenotypic appearance of wild-type, overexpressed, and gene knockout transgenic sweet potato vines.

[0023] Figure 7 Phenotypic diagram of internodes of wild-type, overexpressed, and gene knockout transgenic sweet potatoes (A) and statistical graph of measurement length results (B). Detailed Implementation

[0024] To enable those skilled in the art to better understand and implement the technical solutions of this invention, the invention will be described in detail and completely below with reference to specific embodiments. It should be noted that the embodiments described below are merely some specific implementations of this invention, used for illustrative purposes, and do not constitute a limitation on the scope of this invention.

[0025] Based on the content disclosed in this invention, all other implementation methods obtained by those skilled in the art from the teachings of these embodiments without creative effort are within the spirit and protection scope of this invention.

[0026] Unless otherwise expressly stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains. Conventional experimental reagents and materials used in the embodiments of this invention, unless otherwise specified, are commercially available. The source or construction method of specific biological materials involved in the core of this invention (such as nucleotide fragments containing the sequence shown in SEQ ID NO.1, constructed recombinant expression vectors, specific sweet potato genetic transformation receptor materials, etc.) will be described in detail in specific embodiments. Experimental methods not specifying detailed operating steps are performed in accordance with recognized standard experimental methods in the art, or strictly following the standard operating procedures provided by relevant reagent and instrument suppliers.

[0027] Example 1 Sweet potato IbTGA Cloning of genes 1. Extraction of total RNA from sweet potato leaves Total RNA was extracted using the Trizol RNA extraction kit (Shanghai Jierui, GK3016). The specific steps are as follows: (1) Take about 300 mg of young leaves of sweet potato variety Xu Zishu No. 8 and grind them into powder in liquid nitrogen. Before the liquid nitrogen evaporates, transfer the powder to a 1.5 mL sterile RNAase-free centrifuge tube. Add 1 mL of RnaEx™ (Trizol) to every 100 mg of sample, vortex for 30 s, and let stand at room temperature for 5 min to fully lyse the sample.

[0028] (2) Add 200 μL of chloroform to each 1 mL of RnaEx™, shake vigorously for 30 s, and let stand at room temperature for 5 min.

[0029] (3) Pre-cool the centrifuge at 4°C in advance, centrifuge at 12000 rpm for 10 min to allow the solution to fully separate into layers.

[0030] (4) Use a pipette tip to draw 500 μL of supernatant containing RNA and carefully transfer it to a new 1.5 mL RNase-free centrifuge tube. Add 200 μL of anhydrous ethanol and mix well.

[0031] (5) Transfer all of the solution (including the precipitate) from (4) into the GenClean column placed in a 2 mL collection tube, place at room temperature for 2 min, and centrifuge at 8000 rpm for 1 min.

[0032] (6) Carefully remove the column, discard the waste liquid in the collection tube, put the column back into the collection tube, add 600 uL buffer RWA, centrifuge at 8000 rpm at room temperature for 30 s, and discard the waste liquid in the collection tube.

[0033] (7) Repeat step (6) once, carefully remove the column, discard the waste liquid in the collection tube, put the column back into the collection tube, and centrifuge at 12000 rpm for 1 min at room temperature.

[0034] (8) Carefully remove the column and place it in a 1.5 mL sterile RNase-free centrifuge tube. Add 50 μL DEPC-H2O dropwise to the center of the inner membrane of the column and place at 65℃ for 2 min.

[0035] (9) Centrifuge at 12000 rpm at room temperature for 2 min, and collect the solution in the tube as sweet potato RNA.

[0036] 2. Reverse transcription of sweet potato RNA to form cDNA The extracted total RNA was reverse transcribed into cDNA using the First-Strand cDNA Synthesis Kit (Toyobo, FSQ301). The specific steps are as follows: (1) Take 1 μg of total RNA into a sterile RNAase-free PCR tube, heat denature it at 65℃ for 5 min, and then immediately place it on ice to cool.

[0037] (2) Add 2 μL of 4x DN Master Mix (with gDNA Remover) to ice, and bring the volume to 8 μL with RNase-Free H2O. Gently mix the reaction solution and incubate at 37°C for 5 min.

[0038] (3) Next, add 2 μL of 5x RT Master Mix II to ice. After gently mixing the reaction solution, perform the reverse transcription reaction at the following temperatures: 37℃ for 15 min, 50℃ for 5 min, 98℃ for 5 min, and store at 4℃.

[0039] (4) The obtained product is diluted 10 times with RNase-free water before being used in subsequent experiments or stored at -20℃.

[0040] 3. IbTGA CDS sequence amplification of the gene Sweet potatoes were obtained based on the sweet potato genome (Beauregard V1.0). IbTGA The full-length CDS sequence of the gene was obtained, and upstream and downstream primers for CDS amplification were designed using Primer 5 online software. IbTGA-F: 5'-ATGGGTGGTAGTTCCACACTGA-3' (SEQ ID NO. 3); IbTGA-R: 5'-TCACTCGCGTGGCCTTGCA-3' (SEQ ID NO. 4).

[0041] Using the 10-fold diluted cDNA obtained above as a template, a 50 μL reaction mixture (Takara, R045A) was prepared on ice: 2 μL template cDNA, 25 μL PrimeSTAR Max Premix (2×), 1 μL each of forward and reverse primers, and 21 μL ddH2O. After loading, the mixture was thoroughly mixed and slightly centrifuged, then placed on a PCR instrument for amplification: 98˚C for 10 s, 58˚C for 15 s, 72˚C for 30 s, 32 cycles; 72˚C for 5 min; stored at 4˚C. The PCR products were analyzed by agarose gel electrophoresis (…). Figure 1 The target fragment was obtained by gelling back (Novizan, DC221-01).

[0042] After sequencing, the PCR product contained the nucleotides shown in SEQ ID NO.1. The gene represented by this sequence was named IbTGA, and the coding region of the gene was nucleotides 1-1407 from the 5' end of SEQ ID NO.1. The protein encoded by this gene was named IbTGA, and the amino acid sequence of the protein was the amino acid sequence shown in SEQ ID NO.2, consisting of 468 amino acid residues.

[0043] Example 2 Construction of recombinant expression vector 1. IbTGA Construction of gene overexpression vectors Based on the available restriction enzyme sites (Kpn I and BamHI) of the expression vector pCAMBIA1301, design IbTGA Homologous arm primers constructed from overexpression vectors: IbTGA-OE-F: 5'-TTACAATTAGGATCCATGGGTGGTAGTTCCACACT-3' (SEQ ID NO. 5); IbTGA-OE-R: 5'-GACGGCGCTGGTACCCTCGCGTGGCCTTGCAAG-3' (SEQ ID NO. 6).

[0044] PCR amplification was performed using primers with the aforementioned restriction enzyme sites to obtain a DNA fragment containing the complete coding sequence of IbTGA. The amplified product was purified and recovered. Simultaneously, the pCAMBIA1301 empty vector plasmid was double-digested with Kpn I and BamHI (Thermo Scientific). The purified DNA fragment and the digested empty vector plasmid were ligated using ABclonal's 2×MultiF Seamless Assembly Mix ligase. The recombinant plasmid was then transformed into *E. coli* DH5α competent cells and sent to Shanghai Qingke Sequencing Co., Ltd. for sequencing to obtain accurate results. IbTGA Gene overexpression vector pCAMBIA1301-IbTGA ( Figure 2 ).

[0045] 2. IbTGA Construction of gene knockout vector according to IbTGA The full-length genome sequence was obtained, and gRNA sequences were designed using the targetDesign tool (http: / / skl.scau.edu.cn / targetdesign / ). Off-target analysis was performed using Cas Offinder (http: / / www.rgenome.net / cas-offinder / ). Based on the pHSE401 and pCBC-DT1T2 vectors, four primers with dual targets (IbTGA-DT1-BsF, IbTGA-DT1-F0, IbTGA-DT2-R0, and IbTGA-DT2-BsR) were designed, and PCR amplification was performed using the pCBC-DT1T2 vector as a template. Specifically, homologous arm cloning primers containing the gRNA target sequence were designed based on the BsaI restriction site of the pHSE401 vector. IbTGA-DT1-Bs: 5'-ATATATGGTCTCGATTGAATTGGGCAGAGTCGCAGAGTT-3' (SEQ ID NO. 7); IbTGA-DT1-F0: 5'-TGAATTGGGCAGAGTCGCAGAGTTTTAGAGCTAGAAATAGCAA-3' (SEQ ID NO. 8); IbTGA-DT2-R0: 5'-AACTCAGTGTGGAACTACCACCCAATTTTATCGGATGTCCC-3' (SEQ ID NO. 9); IbTGA-DT2-BsR: 5'-ATTATTGGTCTCGAAACTCAGTGTGGAACTACCACCCAA-3' (SEQ ID NO. 10).

[0046] Using the primers with homologous arms described above, PCR amplification yielded a 626 bp fragment containing the target. After gel purification, this fragment was ligated to the BsaI-digested empty vector pHSE401 plasmid using an enzyme digestion and ligation method. The recombinant plasmid was then transformed into E. coli DH5α competent cells and sent to Qingke for sequencing, ultimately yielding a precisely constructed fragment. IbTGA Gene knockout vector pHSE401-IbTGA ( Figure 3 ).

[0047] Example 3 Agrobacterium-mediated genetic transformation of sweet potato 1. Transformation of Agrobacterium with recombinant expression vector The pCAMBIA1301-TGA and pHSE401-IbTGA plasmids, which were validated by sequencing, were transformed into Agrobacterium EHA105 cells. 1.5 μL of plasmid was mixed with 50 μL of competent cells and incubated on ice for 30 min, then flash-frozen in liquid nitrogen for 5 min, followed by heat shock at 37°C for 5 min, and then incubated on ice for 2 min. 600 μL of LB medium was added and mixed well. The cells were then incubated at 28°C and 200 rpm for 2 h, plated on LB plates, and cultured at 28°C for 2 days. The resulting single colonies were then validated by PCR.

[0048] 2. Sweet potato embryogenic callus induction and subculture (1) Take 15-25 cm sweet potato seedlings obtained by sprouting tubers, cut off 0.5 cm segments of their stem tips, rinse repeatedly with pure water, then surface sterilize with 70% ethanol for 30 s, then soak in 0.1% mercuric chloride solution for 3 min, and finally rinse with sterile water 3-5 times to thoroughly remove residual sterilizing agent. Under a biological microscope, peel off the stem tip meristem, inoculate it into MS solid medium containing 2.0 mg / L 2,4-D, and culture it in the dark at 28℃ for 3-5 weeks to induce embryogenic callus formation.

[0049] (2) During subculture, callus tissue is transferred to fresh MS medium with the same hormone concentration. Every 15-20 days, callus in good condition is screened, non-embryonic tissue is removed, and the tissue is divided into uniformly sized tissue blocks and cultured to achieve continuous propagation.

[0050] 3. Infection and Co-cultivation (1) One day in advance, sweet potato embryogenic callus was ground and sieved to a particle size of 0.8 ~ 1.2 mm and precultured in MS liquid medium containing 2.0 mg / L 2,4-D as a transformation recipient.

[0051] (2) The PCR-identified positive Agrobacterium was inoculated into 15 mL of LB liquid medium containing 100 mg / L kanamycin (Kan) and 100 mg / L rifampin (Rif), and cultured at 28°C with shaking at 200 rpm until OD. 600 When the bacterial cell density reaches 0.6-0.8, centrifuge at 4000 rpm for 10 min to collect the cells, resuspend in MS liquid medium, and then centrifuge and wash again. Finally, adjust the OD of the bacterial culture with MS medium. 600 Add acetylsuccine (AS, final concentration 30 mg / L) to 0.5 to prepare Agrobacterium infection solution.

[0052] (3) Add the pre-cultured sweet potato embryogenic callus to the Agrobacterium infection solution, wrap it in tin foil and shake it slowly for 30 min in the dark, then sonicate it for 15 s; remove the bacterial solution, wait for the surface of the cell cluster to dry slightly, and gently transfer it to the surface of MS solid medium (containing 30 mg / L AS + 2.0 mg / L 2,4-D) covered with sterile filter paper with a spatula and forceps. Incubate in the dark at 28℃ for 3 days to complete the co-culture.

[0053] 4. Sterilization, selection culture and regeneration of transgenic plants (1) After co-culture, scrape the embryonic cell mass into a sterile Erlenmeyer flask, rinse repeatedly with sterile water 5-8 times (with pipette blowing assistance) until the liquid is clear, and blot dry with sterile filter paper; transfer to MSD medium containing 200 mg / L cephalosporin (cef), and strictly delay culture for 1 week to eliminate Agrobacterium and promote tissue recovery.

[0054] (2) The callus tissue after delayed culture was transferred to MSD + 10 mg / L hygromycin (Hyg) + 200 mg / L CEF selection medium, and subcultured every 2 to 3 weeks to remove non-embryonic tissues. Two rounds of screening were performed.

[0055] (3) The resistant callus was transferred to MS medium containing 1 mg / L abscisic acid (ABA) and 200 mg / L CEF and cultured under light for 1-2 weeks to induce embryoid formation.

[0056] (4) Mature somatic embryos were transferred into MS medium containing 10 mg / L Hyg and 200 mg / L CEF and cultured for 1 to 2 months to obtain complete regenerated plants.

[0057] Example 4 Molecular identification of positive plants 1. DNA extraction from genetically modified sweet potatoes Leaves from regenerated sweet potato tissue culture seedlings were taken, and sweet potato genomic DNA was extracted using a modified CTAB method. The specific steps are as follows: (1) Add about 10 mg of sample and a small amount of PVPP to a pre-cooled 2 mL sterile centrifuge tube, freeze quickly with liquid nitrogen, and immediately grind into powder using a grinder.

[0058] (2) Add 600 μL of CTAB buffer preheated at 65℃ to the centrifuge tube, vortex to mix, and incubate in a water bath at 65℃ for 1 h. During this period, invert the tube several times every 20 min to promote full tissue lysis.

[0059] (3) Add 600 μL of chloroform-isoamyl alcohol (24:1) mixture, vortex until a milky white emulsion is formed, balance the mixture and centrifuge at 12000 rpm for 10 min at room temperature to separate the organic phase and the aqueous phase.

[0060] (4) Take 400 μL of supernatant (avoiding intermediate layer impurities), add it to a 1.5 mL centrifuge tube containing 300 μL of -20℃ pre-cooled isoamyl alcohol and 10 μL of 3 mol / L sodium acetate, gently invert and mix until flocculent precipitate appears, centrifuge at 12000 rpm for 5 min at room temperature.

[0061] (5) Discard the supernatant, add 800 μL of 70% ethanol pre-cooled at -20℃, centrifuge at 12000 rpm for 1 min at room temperature, and discard the supernatant.

[0062] (6) Repeat step (5) 2-3 times (until the precipitate turns white), discard the supernatant, open the lid and place it in a clean bench to dry for 5-10 minutes.

[0063] (7) Add 100 μL of TE buffer and gently tap the tube wall to dissolve the DNA; add 1 μL of 10 mg / mL RNase A and incubate at 37°C for 1 h to degrade the RNA.

[0064] 2. Identification of overexpression lines by PCR amplification by IbTGA Using overexpressed transgenic sweet potato DNA as a template, PCR amplification was performed on IbTGA-OE-tF / tR (overexpression) using vector-specific detection primers, and the result was confirmed by gel electrophoresis. IbTGA The gene was successfully overexpressed in sweet potato. Figure 4 Select positive plants. IbTGA -OE#1, #2, and #3 (overexpression) will be used for further research. The primer sequences for vector-specific detection are as follows: IbTGA-OE-tF: 5'-TGAGACTTTTCAACAAAGGATAAT-3' (SEQ ID NO. 11); IbTGA-OE-tR: 5'-TCACAAGTCCTCTTCAGAAATG-3' (SEQ ID NO. 12).

[0065] 3. Hi-TOM sequencing to identify gene knockout lines by IbTGA Using sweet potato DNA as a template, PCR amplification was performed using specific primers for IbTGA target1-F / R and IbTGA target2-F / R, respectively. Confirmation was achieved by gel electrophoresis. The PCR products were then subjected to high-throughput mutation analysis (Hi-TOM), which showed that target site 2 was effectively edited, and a gene knockout line was obtained. IbTGA -KO#1, #2 and #3 (Table 1).

[0066] Table 1 Sequencing results of IbTGA gene knockout transgenic sweet potato WT represents wild type; KO represents gene knockout; D represents base deletion.

[0067] The specific primer sequences for this experiment are as follows: IbTGA target1-F: 5'-GGAGTGAGTACGGTGTGCACATAGGATTGGAAACTGGTGT -3' (SEQ ID NO. 13); IbTGA target1-R: 5'- GAGTTGGATGCTGGATGGTAGTTTAATTTGCACGTTTGGT -3' (SEQ ID NO. 14); IbTGA target2-F: 5'- GGAGTGAGTACGGTGTGCAAAGCAAGGAGTCCAAAGTCAC -3' (SEQ ID NO. 15); IbTGA target2-R: 5'-GAGTTTGGATGCTGGATGGCTGAGCAAGGTTACTGTGGTTT-3' (SEQ ID NO. 16).

[0068] Example 5: Detection of transformed gene expression levels using real-time quantitative PCR (RT-qPCR). Total RNA was extracted from leaves of overexpression lines (OE#1, #2, #3) and gene knockout lines (KO#1, #2, #3), and cDNA was synthesized using a Toyobo reverse transcription kit (FSQ301). IbTGA gene-specific RT-qPCR primers (F: 5′-TGGTTTCAAATCCAATGGCA -3′, SEQ ID NO.17; R: 5′-AATTGGGCAGAGTCGCAGAT -3′, SEQ ID NO.18) were designed online using Primer 5. Real-time quantitative PCR was performed using the Master Mix kit (Toyobo, QPK-201) and ABIStepOne. Plus PCR system (ABI, QuantStudio) TM 6. RT-qPCR was used to detect the expression level of the IbTGA gene. RT-qPCR reaction conditions: 95℃ pre-denaturation for 3 min; 40 cycles (95℃ for 15 s, 60℃ for 15 s, 72℃ for 30 s, with fluorescence collected during the 72℃ extension phase). The relative gene expression level was calculated using the ΔΔCt method, with IbARF gene used as an internal control for normalization. Three biological replicates × three technical replicates were used, and the entire process was performed on ice.

[0069] The results are as follows Figure 5 As shown, compared to wild-type sweet potato (WT), the overexpression transgenic lines... IbTGA Expression levels were significantly upregulated (P < 0.05); in gene knockout lines IbTGA Expression levels were significantly downregulated (P < 0.05).

[0070] Example 6 IbTGA Phenotypic identification of transgenic sweet potato vines like Figure 6 As shown, compared to wild-type WT, the overexpressing transgenic lines OE#1, #2, and #3 exhibited significantly increased vine length; while the gene knockout lines KO#1, #2, and #3 showed significantly decreased vine length. Furthermore, observation of the internode phenotype of these lines revealed that the average internode length of the overexpressing transgenic lines was significantly higher than that of WT (P < 0.01), while the average internode length of the gene knockout lines was significantly lower than that of WT (P < 0.01). Figure 7 The above results indicate that IbTGA can positively regulate aboveground vine growth by increasing internode length.

[0071] The above embodiments are merely illustrative of preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Any equivalent modifications or improvements made to the technical solutions by those skilled in the art within the framework of the present invention's design spirit shall fall within the protection scope defined by the claims of the present invention.

Claims

1. An IbTGA protein, characterized in that, This protein is derived from sweet potato and is a protein of the following type (1) or (2): (1) A protein consisting of the amino acid sequence shown in SEQ ID NO: 2; (2) A protein derived from the protein described in (1) whose amino acid sequence shown in SEQ ID NO: 2 has been modified by substitution and / or deletion and / or addition of one or more amino acid residues and is associated with plant stem growth.

2. The gene encoding the IbTGA protein as described in claim 1.

3. The encoding gene as described in claim 2, characterized in that, The gene is any one of the following DNA molecules (1)-(3): (1) The DNA molecule shown in SEQ ID NO: 1; (2) A DNA molecule that hybridizes with the DNA molecule defined in (1) under strict conditions and encodes a protein related to plant stem growth; (3) A DNA molecule that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with the DNA sequence defined in (1) and encodes a plant stem growth-related protein.

4. The application of the IbTGA protein of claim 1 or the encoding gene of claim 2 or 3 in regulating the growth of sweet potato vines, wherein the regulation is achieved by changing the expression level of the encoding gene to increase or decrease the growth of sweet potato vines.

5. The application according to claim 4, characterized in that, improve IbTGA The level of gene expression increases the growth of sweet potato vines.

6. The application according to claim 4, characterized in that, inhibition IbTGA The level of gene expression reduces the growth of sweet potato vines.

7. A method for regulating the growth of sweet potato vines, characterized in that, Includes any of the following steps: (a) Overexpression in sweet potato IbTGA Genes that promote the growth of sweet potato vines; or (b) Inhibition IbTGA Gene expression to slow down sweet potato vine growth; The above IbTGA The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

8. The method for regulating sweet potato vine length according to claim 7, characterized in that, The overexpression in step (a) includes: converting the... IbTGA Genes were inserted into expression vectors to construct recombinant plasmids, which were then transferred into sweet potatoes through genetic transformation.

9. The method for regulating sweet potato vine length according to claim 7, characterized in that, In step (b), gene knockout is used to suppress... IbTGA Gene expression.

10. The method for regulating sweet potato vine length according to claim 8, characterized in that, The genetic transformation was performed using Agrobacterium-mediated transformation, with sweet potato callus tissue as the infection recipient.

Images