Anti-Magnaporthe oryzae Schefferens spartinae QY22 and application thereof and application of anti-Magnaporthe oryzae Schefferens spartinae QY22

By screening and applying the yeast strain Scheffersomyces spartinae QY22, the problems of low control efficiency and environmental threat of rice blast were solved, achieving effective biological control of rice blast fungus and demonstrating its application potential in biological agents.

CN122012261APending Publication Date: 2026-05-12泉州医学高等专科学校
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
泉州医学高等专科学校
Filing Date
2024-11-07
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing technologies are inefficient in controlling rice blast and pose threats to the environment and human health. There are few biological control methods, especially a lack of effective microbial agents targeting rice blast fungus.

Method used

Using the yeast strain Scheffersomyces spartinae QY22, a strain with significant inhibitory ability against rice blast fungus was screened out by confrontation culture method, and its ITS gene sequence was confirmed to be Scheffersomyces spartinae QY22. It was then applied to biological agents to control rice blast.

Benefits of technology

Scheffersomyces spartinae QY22 significantly inhibits the growth of rice blast fungus, causing mycelial balls to show signs of dissolution and inducing autophagy. It provides a non-chemical, environmentally friendly control method, reducing pesticide use and improving crop safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012261A_ABST
    Figure CN122012261A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological prevention and control of plant diseases, and particularly relates to a strain of Scheffersomyces spartinae QY22 and application of the strain of Scheffersomyces spartinae QY22 in biological prevention and control of rice blast resistance. Experimental methods of strain separation, culture, identification, bacteriostatic effect evaluation and the like provided by the invention prove that the Schemersomes spartinae QY22 has a remarkable inhibition effect on a plurality of plant pathogenic bacteria, and shows a broad-spectrum antagonistic property. Through a co-culture experiment, the Schemersomes spartinae QY22 can obviously inhibit the growth of the magnaporthe oryzae, mycelium pellets have a dissolution sign, autophagy of the magnaporthe oryzae is induced, and the strong antibacterial ability of the Schemersomes spartinae QY22 is shown. As a novel biological control agent, the Scheeffersomes spartinae QY22 provides a novel non-chemical and environment-friendly method for control of the rice blast, potential threats to the environment and human beings are reduced, and the excellent performance of the Scheeffersomes spartinae QY22 in control of the rice blast indicates that the Scheeffersomes spartinae QY22 may be widely applied as an agricultural biological agent in the future, the use of pesticides is reduced, and the safety of crops is improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological control technology for plant diseases, and specifically relates to a Scheffersomycesspartinae QY22 plant and its application in the biological control of rice blast. Background Technology

[0002] Rice blast fungus (Magnaporthe oryzae) is a fungus also known as rice fever, fire blast, and knock blast. It is one of the most devastating diseases of rice, damaging seedlings, leaves, panicles, and nodes, and is respectively called seedling blast, leaf blast, panicle blast, and node blast. Rice blast can occur throughout the entire rice growth cycle and is distributed throughout rice-growing areas worldwide, making it a major disease in rice production. Control methods for rice blast mainly include selecting resistant varieties, cultivating high-quality seedlings, fertilizer and water management techniques, strengthening field management, implementing control measures, and chemical control. These methods are not only inefficient but also pose certain threats to the environment, plants, and human health. Currently, biological control methods for rice blast fungus are limited, mainly relying on bacteria of the Bacillus genus. Therefore, developing microorganisms with effective control capabilities against rice blast fungus is also a key research focus.

[0003] Scheffersomyces spartinae is a type of yeast commonly found in plants such as Sparta. As a relatively new discovery, research on Scheffersomyces spartinae in agriculture and biotechnology is still in its early stages. However, yeasts have shown significant potential in many areas. In agriculture, researchers are increasingly interested in using natural microorganisms to combat crop diseases, and yeasts, as natural microorganisms, are extensively studied for their use in plant disease control.

[0004] Scheffersomyces spartinae, a symbiotic yeast with plants, possesses potential disease resistance properties, and its impact on plant health has attracted researchers' interest. In the field of biotechnology, yeast has always been an important research subject, widely used in food fermentation, biopharmaceutical production, enzyme engineering, and other fields. In recent years, research on non-traditional yeasts has received increasing attention, and Scheffersomyces spartinae, as a novel yeast, is gradually gaining interest in its potential applications in the food industry, bioenergy, and environmental protection. In conclusion, although research on Scheffersomyces spartinae is still in its early stages, as a novel yeast, it has broad application prospects and may play an important role in agricultural production, biotechnology, and environmental protection.

[0005] Rice blast fungus is the main cause of rice blast disease, and its control has always been a focus of scientific research. This study aims to use Scheffersomyces spartinae QY22 to inhibit the growth of rice blast pathogen, thus contributing to the control of rice blast disease. Summary of the Invention

[0006] To address the shortcomings of existing technologies, this invention provides a Scheffersomycesspartinae QY22 fungus resistant to rice blast fungus and its applications.

[0007] The technical solution of the present invention is as follows:

[0008] In a first aspect, the present invention provides a strain of Scheffersomyces spartinae QY22, which is resistant to rice blast. The strain has the accession number GDMCC No: 65109, is deposited at the Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, and the deposit date is September 6, 2024. It is classified and named Scheffersomyces spartinae.

[0009] Secondly, this method provides a blast fungus resistant to rice, whose ITS gene sequence includes SEQ ID NO.1.

[0010] SEQ ID NO.1 is:

[0011] TTGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAAACATGGTTTGTTTTTGTAAGGCTGGGCCTGAAC

[0012] AAACAGTTTCCAAGACTTCAATGATGGATAAACCTAATACATTGATTGTCGAGTGCGCTGTATTGCACCGCTCCTGCCAA

[0013] TACTTTTCAAGCAAACACCTAGTCTGACTAAGAGTATCACTCAAAACCAAACCCGAAGGTTTGAGAGAGAAATGACGCTC

[0014] AAACAGGCATGCCCCTTGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGAAAATCTGCAATTCAT

[0015] ATTACTTATCGCAATTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGAAATTAAATTT

[0016] CATATTGACAATTAAAATTAATAAACCATTCAATAAAAATTGAAGTTAGTTAAACCTCTGGCCCAACATCATTTCTGATG

[0017] ACAGACCAAAGCAATGAGTTCAAAAAAGAAAACACAGTGTGTAATGTTCACCGCGCAGTTAAGCGCAGGCAAAATACTGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTTTACTTTCCA.

[0018] Thirdly, based on the same invention, this invention also provides the application of Scheffersomyces spartinae QY22, as described in the first or second aspect, in the control of rice blast fungus, and in biological agents.

[0019] Fourthly, based on the same invention, this invention also provides a screening method for Scheffersomycesspartinae, which is a confrontation culture method, characterized by comprising the following steps:

[0020] Step 1: Cut a fungal cake from the plate containing plant disease fungi and accurately inoculate it in the center of the PDA medium plate.

[0021] Step 2: Inoculate Scheffersomycesspartinae by streaking along a circumference 20-30 mm from the edge of the mycelium cake.

[0022] Step 3: Directly observe and record whether Scheffersomyces spartinae has an inhibitory effect on the growth of plant pathogenic fungi;

[0023] Step 4: Initially screen out strains that show significant inhibitory ability against rice blast fungus.

[0024] The present invention has the following advantages:

[0025] 1. The experimental methods for strain isolation, culture, identification, and antibacterial effect evaluation provided by this invention demonstrate that Scheffersomyces spartinae QY22 has a significant inhibitory effect on a variety of plant pathogens, exhibiting broad-spectrum antagonistic properties.

[0026] 2. Through co-culture experiments, this invention demonstrated that *Scheffersomyces spartinae* QY22 significantly inhibited the growth of *Strombus oryzae*, showing signs of mycelial ball dissolution and inducing autophagy in *Strombus oryzae*, exhibiting its strong antibacterial ability. As a novel biocontrol agent, *Scheffersomyces spartinae* QY22 provides a non-chemical, environmentally friendly method for controlling rice blast, reducing potential threats to the environment and humans. Its excellent performance in rice blast control suggests its potential widespread application as an agricultural biological agent in the future, reducing pesticide use and improving crop safety.

[0027] 3. This invention provides a novel yeast strain, Scheffersomyces spartinae QY22, whose potential applications in the food industry, bioenergy, and environmental protection are worth further exploration. Attached Figure Description

[0028] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only one embodiment of the present invention. For those skilled in the art, other embodiments can be derived from the provided drawings without creative effort.

[0029] Figure 1 Figure: Results of QY22's inhibition of 12 plant pathogen strains

[0030] Figure 2 Phylogenetic tree of QY22

[0031] Figure 3 Analysis of the co-culture results of QY22 and rice blast fungus

[0032] Figure 4 Graph showing the control effect of QY22 on rice blast disease

[0033] Figure 5 QY22 colony diagram Detailed Implementation

[0034] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. In the present invention, unless otherwise specified, the equipment and raw materials used can be purchased from the market or are commonly used in the art. Unless otherwise specified, the methods in the following embodiments are conventional methods in the art.

[0035] Example 1: Preliminary screening of strains resistant to rice blast fungus

[0036] Step 1: Preparation of Culture Media. 1) PDA Culture Media: Weigh 37g of glucose-potato broth medium, then slowly add 1000ml of pre-measured deionized water to the container, stirring thoroughly until all components are evenly dispersed. Next, weigh 15g of agar powder and slowly add it to the solution while stirring. Continue heating the mixture while maintaining moderate stirring until the agar is completely dissolved and the solution becomes clear, transparent, and homogeneous. Place in an autoclave and sterilize at 121℃ for 20 minutes. 2) YPD Culture Media: 10g / L yeast extract, 20g / L peptone, and 20g / L glucose. For solid culture media preparation, an additional 2% agar powder needs to be added. During preparation, heat to boiling for about 1 minute to completely dissolve the components. Adjust the pH to 6.5±0.2 (25℃) with concentrated hydrochloric acid or sodium hydroxide. Dispense the solution into appropriate containers and autoclave at 121℃ for 15 minutes.

[0037] The second step is strain isolation. The sediment was diluted and evenly spread on the surface of PDA medium, then incubated at a constant temperature of 28°C in an aerobic environment until diverse colony morphologies appeared on the PDA medium. Next, colonies with distinct appearance characteristics were carefully observed and selected, and inoculated onto both PDA and YPD media for further purification. This process of spot purification and transfer was repeated 2-3 times to ensure the acquisition of pure single strains. Afterward, detailed morphological observation of the isolated single colonies was performed, and finally, these strains were preserved at -80°C using 30% glycerol as a cryoprotectant for subsequent use.

[0038] The third step is strain purification. The purity of the obtained strain is verified using biochemical reaction tests.

[0039] The fourth step is preliminary screening of strains exhibiting significant inhibitory activity against rice blast fungus. The confrontation culture method is essential for clarifying the antibacterial (bactericidal) effects and scope of action of beneficial microorganisms or their secondary metabolites. It can serve as a preliminary screening tool to assess the inhibitory potential of fungi from different sources against plant pathogenic fungi. The specific steps are as follows: First, a mycelial cake is cut from a plate containing plant pathogenic fungi and accurately inoculated into the center of a PDA medium plate. Then, the test strain is streaked in a circle approximately 25 mm from the edge of the mycelial cake. The inhibitory effect of the test strain on the growth of plant pathogenic fungi is directly observed and recorded, thus preliminarily screening for strains exhibiting significant inhibitory activity against rice blast fungus.

[0040] Step 5: Observe and record the results. For example... Figure 1 The results showed that Scheffersomyces spartinaeQY22 exhibited a broad and significant inhibitory effect on 12 different plant pathogens, indicating that it has broad-spectrum antagonistic properties and potential control value for a variety of plant diseases.

[0041] Sources of plant pathogens: Magnaportheoryzae, Fusarium verticillioides, and Fusarium graminearum were supplied by the China Agricultural Microbial Culture Collection Center; Diaporthe TI-DY1-A2, Diaporthe YIDY2-A, Altermania HS-2-YR-5, Diaporthe B1-DG2-B, Diaporthe B1-DG4-B, Colltotrichum GIB-1, Pestalotiopsis GIL-G-5, Alternania GI-G-2, and Pestalotiopsis LW-1 were isolated in the laboratory in the early stages.

[0042] Example 2: Molecular biological identification of strain Scheffersomyces spartinaeQY22

[0043] The first step is the preparation of the cell lysis buffer. Prepare the cell lysis buffer according to the instructions in Table 1. This step involves accurately measuring and mixing all the required chemical components to achieve the predetermined formulation ratios. Add each component, concentration, and volume requirement listed in the table to the appropriate container one by one, using a stirrer or vortex mixer if necessary to ensure thorough dissolution and homogeneity. Once prepared, the resulting cell lysis buffer will be used for subsequent cell lysis operations to release intracellular DNA as a template for PCR amplification.

[0044] Table 1. Preparation of cell lysis buffer

[0045]

[0046] The second step is the preparation of the PCR amplification template. The specific steps are as follows: First, add 100 μl of cell lysis buffer to a clean 1.5 ml centrifuge tube. Next, using a sterile inoculation loop, carefully pick a well-grown *Scheffersomyces spartinae* QY22 colony from PDA medium and add it directly to the lysis buffer in the centrifuge tube. Then, gently shake the centrifuge tube to mix the bacterial culture and lysis buffer, ensuring the colony is fully infiltrated. Next, place the entire centrifuge tube in a water bath preheated to 95°C for lysis reaction for 30 min. This step aims to disrupt the cell wall and cell membrane, releasing intracellular DNA. After lysis, remove the centrifuge tube, briefly cool it at room temperature, and then place it in a centrifuge. Centrifuge at 10000 rpm for 5 min. This step aims to precipitate lysed cell debris and proteins to the bottom of the tube, while the supernatant is rich in purified DNA. Finally, carefully transfer the supernatant (i.e., the DNA template solution) to another clean centrifuge tube using a pipette to obtain the DNA template for subsequent PCR amplification experiments.

[0047] The third step is to perform PCR amplification. After obtaining the DNA template, the next step is to perform PCR amplification to find the fungal ITS gene. First, add an appropriate amount of DNA template, fungal ITS universal primers ITS4 (5′-TCCTCCGCTTATTGATATGC-3′) and ITS5 (5′-GGAAGTAAAAGTCGTAACAAGG-3′), PCR buffer, dNTPs, MgCl2 and Taq DNA polymerase to the PCR reaction tube in a predetermined ratio and mix gently. Then, place the PCR reaction tube in the PCR instrument and set the following amplification program, including: (1) 95℃ pre-denaturation for 5 minutes to untangle the DNA double strand;

[0048] (2) Enter the cyclic amplification stage. Each cycle includes denaturation at 95°C for 30 seconds to separate the DNA double strands; (3) annealing at 55°C for 15 seconds to allow the primers to bind to the template DNA; (4) extension at 72°C for 30 seconds, where DNA polymerase catalyzes the synthesis of new DNA strands; (5) repeat the above steps for 40 cycles; (6) final extension at 72°C for 5 minutes to ensure that all incomplete DNA fragments are fully extended. After amplification, take an appropriate amount of PCR product for 1.0% agarose gel electrophoresis. During electrophoresis, DNA fragments will migrate in the gel according to their size, forming visible bands. By observing the position and brightness of the bands, it is possible to preliminarily determine whether the PCR amplification was successful and the quality of the product.

[0049] The fourth step is ITS sequence analysis. The PCR products are sent to PlatinumRay Biotech for sequencing. After sequencing, the obtained ITS sequences are compared with known sequences in the NCBI database to determine the amplified fungal species and its taxonomic position. Sequence alignment can also reveal genetic differences and evolutionary relationships between different strains.

[0050] Step 5: ITS sequence analysis results for QY22. (For example...) Figure 2 The phylogenetic tree presented shows that the QY22 strain of the present invention exhibits a remarkable 100% similarity at the ITS sequence level to the known Scheffersomyces spartinae NR_111290.1 ​​strain, whose ITS sequence is shown in SEQ ID No. 1.

[0051] TTGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAAACATGGTTTGTTTTTGTAAGGCTGGGCCTGAAC

[0052] AAACAGTTTCCAAGACTTCAATGATGGATAAACCTAATACATTGATTGTCGAGTGCGCTGTATTGCACCGCTCCTGCCAA

[0053] TACTTTTCAAGCAAACACCTAGTCTGACTAAGAGTATCACTCAAAACCAAACCCGAAGGTTTGAGAGAGAAATGACGCTC

[0054] AAACAGGCATGCCCCTTGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGAAAATCTGCAATTCAT

[0055] ATTACTTATCGCAATTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGAAATTAAATTT

[0056] CATATTGACAATTAAAATTAATAAACCATTCAATAAAAATTGAAGTTAGTTAAACCTCTGGCCCAACATCATTTCTGATG

[0057] ACAGACCAAAGCAATGAGTTCAAAAAAGAAAACACAGTGTGTAATGTTCACCGCGCAGTTAAGCGCAGGCAAAATACTGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTTTACTTTCCA.

[0058] like Figure 5 The results showed that the colonies were milky white, opaque, regularly round, with smooth surfaces and neat edges. Based on the combined colony morphology and ITS sequence analysis, the strain of this invention was identified as Scheffersomyces spartinae and named Scheffersomyces spartinae QY22.

[0059] Example 3: Inhibitory effect of strain Scheffersomyces spartinaeQY22 on rice blast fungus

[0060] *Magnaporum oryzae* was inoculated into PDA medium and cultured in shake flasks for 24 hours, after which the bacterial cells were collected. Similarly, *Scheffersomyces spartinae* QY22 strain was inoculated into LB medium and cultured in shake flasks for 24 hours, after which the bacterial cells were collected. In the control group, the two bacterial strains were directly mixed and stored at -80°C. In the experimental group, a 1% *Scheffersomyces spartinae* QY22 strain seed culture, which had been cultured for 24 hours, was added to the *Magnaporum oryzae* culture system, and the culture was continued for another 24 hours. After the culture was completed, the bacterial mixture was collected and stored at -80°C for later use. After a period of time, the stored bacterial mixture was removed from the -80°C freezer for resuscitation and further culture.

[0061] like Figure 3 The results showed that after co-culturing *Magnaporum oryzae* with QY22, the mycelial balls clearly showed signs of dissolution, while the control group of *Magnaporum oryzae* without QY22 inoculation continued to grow normally in PDA medium. This observation suggests that the presence of strain QY22 may have some influence on the growth and morphology of *Magnaporum oryzae*, leading to changes in the structure of the mycelial balls.

[0062] Example 4: Control effect of strain Scheffersomyces spartinae QY22 on rice blast

[0063] First, freshly grown *Bacillus oryzae* was treated with a high-density (5 ml, 10^9 cells / ml) culture at 28°C for 4 hours to enhance its infectivity. Then, this treated *Bacillus oryzae* was inoculated onto the leaves of 45-day-old rice varieties. Next, a previously cultured *Scheffersomyces spartinae* QY22 bacterial suspension was evenly sprayed onto the surface of the inoculated rice leaves to evaluate its biocontrol effect. Two control groups were established: one was untreated rice leaves, serving as the baseline under natural conditions; the other was rice leaves treated with *Escherichia coli*, which has no inhibitory effect on *Bacillus oryzae*, serving as a negative control to exclude non-specific influences.

[0064] All treated rice plants were placed in a carefully controlled plant growth chamber, maintaining a constant temperature of 28°C and a relative humidity of 80%, and were further cultured under simulated natural light conditions (16 hours of light / 8 hours of darkness).

[0065] On the fifth day after pathogen inoculation, detailed phenotypic observations were performed on rice leaves, and key results were recorded. To enhance the reliability and statistical significance of the experiment, it was repeated at least three times, with at least 15 rice leaves inoculated in each experiment.

[0066] like Figure 4 The results showed that rice leaves treated with Scheffersomyces spartinae QY22 were not affected by rice blast fungus, and their growth status was not significantly different from the untreated control group. This study demonstrates that Scheffersomyces spartinae QY22 not only exhibits significant inhibitory effects against rice blast fungus in vitro but also maintains good control efficacy against the fungus in vivo. It is a high-quality strain resource with the potential to be developed into an agricultural biological agent.

[0067] The above description is merely an illustration of preferred embodiments of the present invention, intended to demonstrate its core concepts and applications, and not to limit the wide applicability of the present invention. Any modifications, equivalent substitutions, technical improvements, or innovations of any kind, provided they adhere to the basic spirit and core principles of the present invention, should be considered to fall within the scope of protection claimed by the present invention.

Claims

1. A strain of Scheffersomyces spartinae QY22, resistant to rice blast fungus, characterized in that, It was deposited at the Guangdong Provincial Center for Microbial Culture Collection on September 6, 2024, with accession number GDMCC No: 65109.

2. A fungus resistant to rice blast, characterized in that, Its ITS gene sequence is shown in SEQ ID NO.

1.

3. The application of the anti-blast fungus Scheffersomyces spartinae QY22 as described in claim 1 or the anti-blast fungus as described in claim 2 in the prevention and control of rice blast fungus.

4. A biological agent, characterized in that, The active ingredient of the biological agent includes Scheffersomyces spartinae QY22, the anti-rice blast fungus as described in claim 1 or 2.

5. A screening method for Scheffersomyces spartinae, characterized by a confrontation culture method, wherein... Includes the following steps: Step 1: Cut a fungal cake from the plate containing plant disease fungi and accurately inoculate it in the center of the PDA medium plate. Step 2: Inoculate Scheffersomyces in a streaking pattern on a circumference 20-30 mm from the edge of the mycelium cake. spartinae; Step 3: Directly observe and record whether Scheffersomyces spartinae has an inhibitory effect on the growth of plant pathogenic fungi; Step 4: Initially screen out strains that show significant inhibitory ability against rice blast fungus.