RSH1 coding gene related to rice grain number per ear heterosis establishment and application of RSH1 coding gene

By identifying and applying the RSH1 coding gene related to heterosis in rice panicle number, and knocking out the rice gene using the CRISPR/Cas9 system, the problem of unclear gene mechanism in the genetic improvement of rice yield was solved, and the rice panicle number and yield were improved, providing new breeding resources.

CN122012452APending Publication Date: 2026-05-12CHINA AGRI UNIV SANYA RES INST +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610212022.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-13
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

There is a lack of basic theoretical research on heterosis genes for rice panicle number in existing technologies. The molecular mechanism by which a single rice gene forms heterosis in yield is unclear, which affects the genetic improvement effect of rice yield.

Method used

The RSH1 coding gene associated with heterosis in rice panicle number was identified and applied. By knocking out the RSH1 gene in recipient rice using the CRISPR/Cas9 system, the number of grains per panicle and yield of rice were regulated, and transgenic rice with heterosis characteristics in panicle number was bred.

Benefits of technology

This study enabled the analysis of the overdominance effect of heterosis at the single gene level, which improved the number of grains per panicle and yield of rice, provided new gene resources and breeding methods, and deepened the understanding of the genetic basis of heterosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012452A_ABST
    Figure CN122012452A_ABST
Patent Text Reader

Abstract

The invention relates to an RSH1 coding gene related to rice grain number per ear heterosis establishment and application of the RSH1 coding gene. Specifically, the invention discloses an RSH1 protein and a biological material related to the RSH1 protein, the protein is a protein A1), A2) or A3), the amino acid sequence of the protein A1) is SEQ ID No.3 in a sequence table, and the amino acid sequence of the protein A2) is SEQ ID No.3 in a sequence table; a2) protein with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues to the protein of A1), and A3) fusion protein obtained by connecting a protein label to the N terminal or / and the C terminal of A1) or A2). The RSH1 protein and the related biological material can be used for regulating and controlling the grain number per ear and / or the yield of rice.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the RSH1 coding gene related to the establishment of heterosis in rice panicle number and its application. Background Technology

[0002] Rice (Oryza sativa L.) is widely cultivated, and more than half of my country's population relies on rice as a staple food. Rice production plays a crucial role in my country's food security. Since the 1970s, the three-line hybrid rice and two-line hybrid rice developed by Chinese scientists have been widely promoted throughout the country, resulting in a significant increase in rice yield per unit area. In this process, increasing the number of grains per panicle and effectively utilizing heterosis were key to this significant increase in rice yield.

[0003] The number of grains per panicle in rice is determined by the various levels of branches on a single panicle and the grains growing on them. This determines the complexity of the grain number per panicle. Among the three factors of yield, the number of grains per panicle has the largest range of variation among varieties and usually plays an important role in the genetic improvement of rice yield. Heterosis refers to a natural phenomenon in which the F1 generation of hybrids obtained by crossing two genetically different parents is significantly superior to both parents in terms of growth vigor, yield, and reproductive ability. It is also the key to the widespread application of hybrid rice. Although the improvement of grain number per panicle and the effective utilization of heterosis have made a great contribution to the improvement of rice yield, basic theoretical research on yield heterosis genes is still lacking. In particular, there are no reports on the research of obtaining new rice yield-related genes through heterosis localization cloning, and the molecular mechanism by which a single rice gene forms yield heterosis is still unclear.

[0004] Therefore, elucidating the genetic basis for heterosis in rice panicle number and identifying heterosis genes in rice panicle number are of great significance for future genetic improvement of rice varieties. Summary of the Invention

[0005] To address the shortcomings of existing technologies and practical needs, this invention provides an RSH1 encoding gene related to the establishment of heterosis in rice panicle grain number and its application.

[0006] Specifically, the present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides a protein, said protein being a protein as follows: A1), A2), or A3):

[0008] A1) The amino acid sequence of the protein RSH1 is shown in SEQ ID No. 2;

[0009] A2) A protein with the same function as the protein shown in A1) obtained by substituting and / or deleting and / or adding one or more amino acid residues of the protein in A1).

[0010] A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).

[0011] In one or more embodiments, the protein is derived from rice; preferably, the rice variety is Nipponbare.

[0012] Secondly, the present invention provides biological materials related to the proteins described herein, which are any one of B1) to B7) below:

[0013] B1) The DNA molecule encoding the protein RSH1 described in this invention;

[0014] B2) An expression cassette containing the DNA molecule described in B1);

[0015] B3) A recombinant vector containing the DNA molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0016] B4) Recombinant microorganisms containing the DNA molecule described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0017] B5) A transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the DNA molecule described in B1), or a transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the expression cassette described in B2);

[0018] B6) Reduce the expression of nucleic acid molecules by the DNA molecules described in B1);

[0019] B7) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues, or transgenic plant organs containing the nucleic acid molecules described in B6).

[0020] In the aforementioned biological materials, the expression cassette refers to DNA capable of expressing the corresponding protein in a host cell. This DNA may include not only promoters that initiate transcription of the relevant gene, but also terminators that terminate transcription of the relevant gene. Furthermore, the expression cassette may also include enhancer sequences. Promoters that can be used in this invention include, but are not limited to: constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters, which can be selected by those skilled in the art according to actual needs.

[0021] The recombinant vectors mentioned above are not limited to any particular biomaterial. Those skilled in the art can select them according to actual needs, such as pET-28a, pCAMBIA2301, pSP72, pROKII, pBin438, pCAMBIA1302, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb (CAMBIA Corporation), etc.

[0022] In the aforementioned biological materials, the recombinant microorganisms may specifically be bacteria, yeast, algae, or fungi; among them, the bacteria may be derived from one of the genera Escherichia, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Pseudomonas, or Bacillus.

[0023] The transgenic plant cell lines, transgenic plant tissues, or transgenic plant organs mentioned above do not include plant propagation materials.

[0024] In one or more embodiments, the DNA molecule in B1) is a gene as shown in b1) or b2) below:

[0025] b1) The coding sequence of the coding strand is the cDNA molecule shown in SEQ ID No. 1;

[0026] b2) The nucleotide sequence is the DNA molecule shown in SEQ ID No. 3.

[0027] In one or more embodiments, the nucleic acid molecule B6) is a gRNA that targets the protein-coding gene of the present invention, and the target sequence of the gRNA is the sequence shown in SEQ ID No. 4.

[0028] Thirdly, the present invention provides the use of any of the proteins or biological materials described in any one of the following C1)-C3):

[0029] C1) Regulates the number of grains per panicle in rice;

[0030] C2) Regulates rice yield;

[0031] C3) Develop transgenic rice with heterosis traits in the number of grains per panicle.

[0032] In one or more embodiments, the regulation of rice panicle grain number is to increase the rice panicle grain number; the regulation of rice yield is to increase rice yield by increasing the rice panicle grain number.

[0033] Fourthly, the present invention provides a method for increasing the number of grains per panicle and / or the yield of rice, the method comprising inhibiting or reducing the expression of a gene in a recipient rice variety to obtain a target rice variety with a higher number of grains per panicle and / or a transgenic rice variety with a higher number of grains per panicle and / or a heterosis trait in the number of grains per panicle than the recipient rice variety; wherein the gene is a gene encoding the protein described in the present invention.

[0034] In one or more embodiments, the inhibition or reduction of gene expression in recipient rice is achieved by knocking out the gene in recipient rice using a CRISPR / Cas9 system; the CRISPR / Cas9 system includes a plasmid expressing Cas9 and gRNA, wherein the target sequence of the gRNA is positions 2141-2160 of SEQ ID No. 2.

[0035] In one or more embodiments, the inhibition or reduction of gene expression in recipient rice can be achieved by introducing a knockout vector into recipient rice. Specifically, the knockout vector is pC1300-Cas9; the knockout vector pC1300-Cas9 is a fragment in which the target sequence of the gRNA is set to conform to the 5'-NX-NGG-3' or 5'-CCN-NX-3' sequence arrangement rule of the DNA fragment shown in SEQ ID No. 2, where N represents any one of A, G, C, and T, 14≤X≤30, and X is an integer, and NX represents X consecutive deoxyribonucleotides. The target sequence of the gRNA can specifically be positions 148-167 of SEQ ID No. 1, and positions 2075-2080 of SEQ ID No. 2.

[0036] In one or more embodiments, the recombinant knockout vector pC1300-Cas9 can be introduced into plant cells or tissues using conventional biotechnological methods such as Agrobacterium-mediated transformation, Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, and electroporation.

[0037] In one or more embodiments, the method further includes the step of screening recipient rice containing a knockout vector with target sequence at positions 148-167 of SEQ ID No. 1 to obtain transgenic rice with the characteristic of heterosis in grain number per panicle by screening for changes in the function of the related coding gene RSH1.

[0038] The transgenic rice is understood to include not only the first-generation transgenic rice obtained by transforming recipient rice according to the gene target, but also its progeny; for transgenic rice, the gene can be propagated in the species, or the gene can be transferred into other varieties of the same species using conventional breeding techniques, especially commercial varieties; the transgenic rice includes seeds, callus tissue, complete plants and cells.

[0039] This invention uses the sequence 148-167 of SEQ ID No. 1 as a target to knock out the RSH1 gene in rice, obtaining transgenic rice with lost RSH1 gene function. The homozygous transgenic rice with complete loss of function has fewer grains per panicle than the recipient parent rice, while the heterozygous transgenic rice with partial loss of function has more grains per panicle than the recipient parent rice.

[0040] Fifthly, the present invention provides a plant reagent containing the protein described in the present invention and / or the protein-related biomaterial described in any one of the present invention.

[0041] In this invention, the protein with the amino acid sequence SEQ ID No.2 is named RSH1 protein, the nucleotide sequence of the gene RSH1 encoding the protein is SEQ ID No.3, and its CDS sequence is SEQ ID No.1.

[0042] Compared with the prior art, the present invention has the following advantages:

[0043] This invention is the first to identify the RSH1 gene, which is associated with heterosis in rice panicle number. In a heterozygous state with partial functional loss, the RSH1 gene produces transgenic rice with a higher number of grains per panicle than the recipient parent, demonstrating that the protein encoding the rice panicle number heterosis-related gene or its protein plays a crucial role in controlling heterosis in rice. This invention not only provides a foundation for further elucidating the molecular mechanisms of heterosis in rice panicle number but also offers new genetic and breeding resources for rice breeding.

[0044] This invention is the first to discover in rice that a single gene, in a heterozygous state, exhibits a superior phenotype compared to its homozygous counterparts in both parents. By modifying the function of this single gene, the heterosis effect in panicle number can be effectively established, exhibiting an overdominant effect compared to both parents. This discovery is the first to elucidate the existence of heterosis overdominance at the single-gene level. The related findings can be applied to the genetic improvement of panicle number in rice and various other crops, contributing to a deeper understanding of the genetic basis of heterosis and possessing significant application value for shaping heterosis overdominance through genetic breeding and genetic engineering methods. Attached Figure Description

[0045] Figure 1This is a Manhattan plot showing the genome-wide association analysis of the number of grains per panicle in the F1 generation of the indica rice subpopulation in Example 1 of this invention.

[0046] Figure 2 This is a diagram showing the expression patterns of each candidate gene within the qRSH1 region in Example 1 of the present invention.

[0047] Figure 3 This shows the expression of ORF2 and ORF5 genes in the parental materials and F1 materials in Example 1 of the present invention.

[0048] Figure 4 This is a schematic diagram of the target sequence location and target sequence changes in the RSH1 gene knockout experiment in Example 3 of the present invention.

[0049] Figure 5 The differences in panicle phenotypes among different types of RSH1 knockout materials in Example 4 of this invention reflect the role of RSH1 in regulating the heterosis effect of rice panicle grain number.

[0050] Figure 6 The phenotypic statistics of the number of grains per ear, ear length, number of primary branches, and number of secondary branches of different types of RSH1 knockout materials in Example 4 of this invention are shown. Different letters represent the significance analysis results, and P < 0.05. Detailed Implementation

[0051] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0052] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention.

[0053] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0054] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0055] The rice varieties used in the following examples, namely Nipponbare (also known as wild-type rice, abbreviated as NT) and Zhenshan 97B, are commercially available. The public can also obtain this biological material from China Agricultural University. This biological material is only used to repeat the relevant experiments of this invention and cannot be used for other purposes.

[0056] The knockout vectors SK-gRNA and pC1300-Cas9 used in the following examples are described in the non-patent literature “Wang, Chun et al., A simple CRISPR / Cas9 system for multiplex genome editing in rice. Journal of Genetics and Genomics”, which can be obtained from China Agricultural University for the purpose of replicating the experiments in this application, but should not be used for other purposes.

[0057] The Agrobacterium used in the following examples is Agrobacterium tumefaciens EHA105 (New Agrobacterium helper plasmids for gene transfer to plants. Hood, Elizabeth E; Gelvin, Stanton B; Melchers, Leo S; Hoekema, Andre. Transgenic research, 2(4): p.208-218 (1993)), which is commercially available. This biological material can also be obtained from China Agricultural University. This biological material is only used to repeat the relevant experiments of this invention and cannot be used for other purposes.

[0058] Example 1: Obtaining the RSH1 gene encoding heterosis in rice panicle number

[0059] This invention utilizes 162 core indica rice germplasm materials and test line 93-11 to construct an F1 population. By investigating the phenotype of F1 plants and calculating the parental dominance (Hmp) for traits, combined with genotype data from deep sequencing of the parents, the genotypes of the F1 generation were simulated. Association analysis was then performed using the F1 generation genotypes and phenotypes, revealing a QTL that could be stably detected using phenotypic data from Sanya and Changsha (e.g., ...). Figure 1 (As shown). Interval candidate gene analysis identified 12 genes, and expression pattern analysis showed that only ORF2 and ORF5 were highly expressed during the young panicle development stage of rice (e.g., ...). Figure 2(As shown). The transcriptional expression of ORF2 and ORF5 in the 1-2 mm young panicles of the two-line hybrid rice LYP9 and its parents 93-11 and PA64S was examined (e.g., ...). Figure 3 As shown in the figure, only ORF2 showed non-additive expression, and its expression level in the F1 generation material LYP9 was higher than that of the parents 93-11 and PA64S, which is consistent with the expression basis for participating in the construction of heterosis in ear grain number.

[0060] The RSH1 gene was obtained by PCR amplification using cDNA from the rice variety Nipponbare as a template.

[0061] The primers for PCR amplification are:

[0062] F: 5'-ATGGATGGTAGTAATGAGAATATC-3' (SEQ ID No. 5);

[0063] R: 5'-TCACCTTTCCCATCTTACTCGCAAAG-3' (SEQ ID No. 6).

[0064] The PCR amplification program was as follows: 94℃ for 1 min; 98℃ for 10 s, 58℃ for 15 s, 68℃ for 1 min, 35 cycles; 68℃ for 5 min.

[0065] Sequencing revealed that the nucleotide sequence of the RSH1 gene is shown in SEQ ID No. 3, encoding the protein RSH1, whose amino acid sequence is shown in SEQ ID No. 2.

[0066] Analysis revealed that the nucleotide sequence of the RSH1 genome contains 10 exons and 10 introns (wherein, in SEQ ID No. 2, positions 1-139 are the 5' UTR, positions 140-1872 are the first intron, positions 1873-1916 are the 5' UTR, positions 1917-2249 are the first exon, positions 2250-3035 are the second intron, positions 3036-3204 are the second exon, positions 3205-3317 are the third intron, positions 3318-3763 are the third exon, positions 3764-4558 are the fourth intron, positions 4559-4582 are the fourth exon, positions 4583-4754 are the fifth intron, and positions 4755-4847 are the fifth intron). Position 4848-5824 is the fifth exon, positions 5825-5903 are the sixth exon, positions 5904-5997 are the seventh exon, positions 5998-6082 are the seventh exon, positions 6083-6497 are the eighth exon, positions 6498-6609 are the eighth exon, positions 6610-6690 are the ninth exon, positions 6691-6807 are the ninth exon, positions 6808-6901 are the tenth exon, positions 6902-6949 are the tenth exon, and positions 6950-7468 are the 3'UTR.

[0067] Example 2: Construction of RSH1 gene knockout vector

[0068] To demonstrate the gene function of RSH1, this embodiment performed gene knockout on the gene. The specific steps are as follows:

[0069] (1) Log in to http: / / www.genome.arizona.edu / crispr / CRISPRsearch.html to screen target sites. Then, evaluate off-target effects at http: / / www.rgenome.net / cas-offinder / . Select sequences with low off-target rates as target sequences for this study, as follows:

[0070] Target sequence: 5'-GGTGAGTCTGAACCTTACAT-3' (SEQ ID No. 4, same as positions 2064-2083 of SEQ ID No. 2).

[0071] The location of the RSH1 gene knockout target sequence in its genome is as follows: Figure 1 As shown, it is located in the first exon.

[0072] (2) Design two complementary DNA sequences, add GGCA before the forward target sequence and add AAAC before the reverse complementary target sequence, as follows:

[0073] F: 5'-GGCA GGTGAGTCTGAACCTTACAT -3' (SEQ ID No. 7);

[0074] R: 5'-AAAC ATGTAAGGTTCAGACTCACC -3' (SEQ ID No. 8) (The underlined sequence is the reverse complementary sequence to the underlined sequence in F).

[0075] (3) Construction of intermediate carriers:

[0076] a. The vector SK-gRNA is digested with AarI (Ferment) to form a linear vector with sticky ends;

[0077] b. After mixing the F chain and R chain, denaturation annealing is performed to form fragments with sticky ends;

[0078] c. Ligate the linear vector obtained in step a and the fragment obtained in step b (molar concentration 1:3-10), transform DH5α, and obtain the recombinant plasmid; colony PCR positive detection can be performed using primer T3 with the R strand, and the primer sequences are as follows:

[0079] T3: 5'-ATTAACCCTCACTAAAGGGA-3' (SEQ ID No. 9);

[0080] R: 5'-AAACATGTAAGGTTCAGACTCACC-3' (SEQ ID No. 10).

[0081] d. Use common primers T7 or T3 for sequencing to verify correctness. The correct vector is named SK-gRNA-RSH1. The T7 primer sequence is as follows:

[0082] T7: 5'-TAATACGACTCACTATAGGG-3' (SEQ ID No. 11)

[0083] (4) Construction to the final carrier:

[0084] The pC1300-Cas9 vector was digested with KpnI and BamHI to obtain a linearized pC1300-Cas9 vector. The SK-gRNA-RSH1 constructed in step (3) was digested with KpnI and BglII, and the target fragment was recovered. The aforementioned target fragment was ligated into the linearized pC1300-Cas9 vector to obtain a knockout vector. Specifically, the target fragment digested with SK-gRNA-RSH1 replaced the fragment between the restriction endonuclease KpnI and BamHI recognition sites of the pC1300-Cas9 vector (including the small fragment containing the KpnI and BamHI recognition sites), while keeping the other sequences of the pC1300-Cas9 vector unchanged. After correct sequencing, the resulting knockout vector was named RSH1-CR.

[0085] The gRNA is expressed by the knockout vector RSH1-CR. The target sequence of the gRNA is located on the first exon of the rice RSH1 gene. The specific target sequence is shown in positions 148-167 of SEQ ID No. 2.

[0086] Example 3: Cultivation and identification of RSH1 gene knockout transgenic plants with loss of function

[0087] 3.1 Cultivation of RSH1 gene knockout transgenic plants

[0088] In this embodiment, the knockout vector RSH1-CR constructed in Example 2 was transformed into Nipponbare japonica rice via Agrobacterium tumefaciens EHA105-mediated transformation. The specific method is as follows:

[0089] (1) The knockout vector RSH1-CR obtained in Example 1 was introduced into Agrobacterium tumefaciens EHA105 by heat shock to obtain recombinant Agrobacterium tumefaciens EHA105 containing the recombinant vector RSH1-CR; the recombinant Agrobacterium tumefaciens EHA105 containing the recombinant vector RSH1-CR was cultured at 28℃ for 16h and the bacterial cells were collected; the bacterial cells were diluted with N6 liquid medium (Sigma, product catalog number C1416) containing 100 μM acetylsuccinone to obtain diluted bacterial solution with OD600≈0.5;

[0090] (2) Mix the mature embryonic callus of rice cultured for one month with the diluted bacterial solution obtained in step 1 and infect for 30 min. After the bacterial solution is dried with filter paper, it is transferred to N6 solid co-culture medium and co-cultured at 24℃ for 3 days to obtain the co-cultured callus.

[0091] (3) The callus tissue after co-culture treatment in step (2) was inoculated on N6 solid screening medium containing hygromycin at a mass concentration of 150 mg / L (N6 solid screening medium was obtained by adding hygromycin to N6 solid screening medium, and the mass concentration of hygromycin in N6 solid screening medium was 150 mg / L) for the first screening.

[0092] (4) On the 16th day after the first screening, healthy callus tissue was picked and transferred to N6 solid screening medium containing 200 mg / L hygromycin (N6 solid screening medium was obtained by adding hygromycin to N6 solid screening medium, and the mass concentration of hygromycin in N6 solid screening medium was 200 mg / L) for a second screening. Subculture was performed every 15 days for a total of 1 subculture to obtain anti-callus tissue.

[0093] (5) Select the resistant callus obtained in step (4) and transfer it to a differentiation medium containing hygromycin at a concentration of 150 mg / L (differentiation medium: 6-BA 2 mg, NAA 0.2 mg, N6 4 g, hydrolyzed casein 1 g, inositol 0.1 g, sucrose 25 g, sorbitol 2.4 g, agar powder 7 g, deionized water 1 L) for differentiation. Culture at 24℃ for 45 days (at this time, the aboveground part of the plant is about 15 cm tall). Open the bottle mouth to harden the seedlings for 3 days, and then transplant them to a greenhouse for cultivation. This is the RSH1-CR transgenic plant (T0 generation). Different transformation events are named Ho. 6 / 6 He 6 / T These represent knockout-positive plants transformed into the recombinant vector RSH1-CR, respectively. The aforementioned Ho... 6 / 6 He 6 / T F1 generation He was obtained by crossing knockout positive materials with wild-type materials. 6 / 0 He T / 0 .

[0094] 3.2 Identification of RSH1 gene knockout transgenic plants

[0095] The transformed RSH1-CR (Ho) obtained by conversion 6 / 6 He 6 / T DNA-level PCR and sequencing identification were performed on T0 generation seedlings of the plant and seedlings of the recipient parent rice Nipponbare (referred to as NT).

[0096] Specifically, the following primers were used for PCR amplification, and the PCR amplification products were sequenced for identification.

[0097] RSH1-CR-check-F: 5'-GGTTTGTATGTTTGTTGACCACC-3' (SEQ ID No. 12);

[0098] RSH1-CR-check-R: 5'-TCTAGCTACCGATATGGCTTCTC-3' (SEQ ID No. 13).

[0099] The sequence changes at the target site in T0 generation RSH1-CR transgenic materials (i.e., RSH1 knockout materials) are as follows: Figure 4 As shown, the homozygous material is named Ho. 6 / 6 and Ho T / T Ho 6 / 6 The material has a six-base deletion at the target site, resulting in a change in three amino acids, Ho T / T The material has a single T base inserted at the target site, causing premature protein termination; the hybrid material is named He. 6 / T The target site sequence variation type is a deletion of 6 bases on one chromosome and an insertion of one T base on another chromosome; Ho 6 / 6 and Ho T / T The materials were hybridized with wild-type materials to obtain He 6 / 0 and He T / 0 Hybrid materials, Ho 6 / 6 The material target site sequence variation type is a deletion of 6 bases on one chromosome, while the other chromosome is normal, Ho T / T The material target site sequence variation type is that one chromosome has an insertion of a T base, while the other chromosome remains normal.

[0100] Example 4: Phenotypic identification of transgenic plants encoding the gene RSH1, which was knocked out, to determine the heterosis of rice panicle number.

[0101] The Ho samples obtained from the above-mentioned "PCR identification and extraction of RSH1-CR transgenic plants with loss of function of the RSH1 gene related to the construction of heterosis in rice panicle number" were respectively... 6 / 6 Ho T / T He 6 / T He 6 / 0 He T / 0 Rice plants of the recipient parent, Nipponbare (NIP), were planted at the Shangzhuang Base of China Agricultural University in Beijing. The differences in panicle phenotypes between mature RSH1-CR plants and Nipponbare (NIP) plants were investigated. Observations and measurements are as follows: Figure 5-6 Compared with the recipient parent rice Nipponbare panicle phenotype, Ho 6 / 6 Ho T / T He 6 / T All materials exhibited a smaller ear phenotype, with significant decreases in ear length, number of primary branches, number of secondary branches, and number of grains per ear. 6 / 0 and He T / 0 The grain number phenotype of the material showed better performance than Ho.6 / 6 Ho T / T The results, comparing the phenotypes of wild-type NIP with those of rice, demonstrate that the RSH1 gene is involved in the development of heterosis in rice panicle grain number, and that overdominance of rice panicle grain number can be achieved by regulating this gene.

[0102] Although the present invention has been described in detail through the preferred embodiments above, it should be understood that the above description should not be considered as a limitation of the present invention. Various modifications and substitutions to the present invention will be apparent to those skilled in the art after reading the above description. Therefore, the scope of protection of the present invention should be defined by the appended claims.

Claims

1. A protein, characterized in that, The protein is a protein that is, as shown in A1), A2), or A3): A1) A protein whose amino acid sequence is shown in SEQ ID No. 2; A2) A protein with the same function as the protein shown in A1) obtained by substituting and / or deleting and / or adding one or more amino acid residues of the protein in A1). A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).

2. The protein as described in claim 1, characterized in that, The protein is derived from rice.

3. A biomaterial relating to the protein of claim 1 or 2, characterized in that, It is any one of B1) to B7) below: B1) A DNA molecule encoding the protein of claim 1; B2) An expression cassette containing the DNA molecule described in B1); B3) A recombinant vector containing the DNA molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the DNA molecule described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the DNA molecule described in B1), or a transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the expression cassette described in B2); B6) Reduce the expression of nucleic acid molecules by the DNA molecules described in B1); B7) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues, or transgenic plant organs containing the nucleic acid molecules described in B6).

4. The biomaterial as described in claim 3, characterized in that, B1) The DNA molecule described is a gene as shown in b1) or b2) below: b1) The coding sequence of the coding strand is the cDNA molecule shown in SEQ ID No. 1; b2) The nucleotide sequence is the DNA molecule shown in SEQ ID No.

3.

5. The biomaterial as described in claim 3, characterized in that, B6) The nucleic acid molecule is a gRNA that targets the protein-coding gene of claim 1, and the target sequence of the gRNA is the sequence shown in SEQ ID No.

4.

6. The use of the protein according to claim 1 or 2, or the biological material according to any one of claims 3-5, in any one of C1)-C3) below: C1) Regulates the number of grains per panicle in rice; C2) Regulates rice yield; C3) Develop transgenic rice with heterosis traits in the number of grains per panicle.

7. The application as described in claim 6, characterized in that, The regulation of rice panicle grain number is to increase the number of rice panicles; the regulation of rice yield is to increase rice yield by increasing the number of rice panicles.

8. A method for increasing the number of grains per panicle and / or the yield of rice, characterized in that, The method includes inhibiting or reducing gene expression in recipient rice to obtain target rice with higher grain number per panicle and / or higher yield than the recipient rice and / or transgenic rice with heterosis characteristics in grain number per panicle; the gene is a gene encoding the protein of claim 1.

9. The method as described in claim 8, characterized in that, The inhibition or reduction of gene expression in the recipient rice is achieved by knocking out the gene in the recipient rice using a CRISPR / Cas9 system; the CRISPR / Cas9 system includes a plasmid expressing Cas9 and gRNA, wherein the target sequence of the gRNA is positions 2141-2160 of SEQ ID No.

2.

10. A plant-based reagent, characterized in that, The reagent contains the protein of claim 1 or 2 and / or the protein-related biomaterial of any one of claims 3-5.