Application of double-stranded RNA (Ribonucleic Acid) molecule and related biological material thereof in prevention and treatment of megalurothrips usitatus

By designing a double-stranded RNA molecule targeting the Muhsp68 gene of soybean thrips and combining it with a biopesticide, the problem of soybean thrips' resistance to chemical pesticides was solved, achieving a highly efficient and green pest control effect.

CN122012508APending Publication Date: 2026-05-12CHINA AGRI UNIV
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202610492023.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-15
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Soybean thrips have developed resistance to existing chemical pesticides such as abamectin and spinosad, necessitating the development of green and efficient control technologies.

Method used

A double-stranded RNA molecule targeting the Muhsp68 gene of soybean thrips was designed and delivered through a polymer vector system to penetrate the intestinal wall of the thrips' digestive tract. This molecule then combines with biopesticides such as emamectin benzoate or spinosad to achieve RNA interference and insecticidal effects on soybean thrips.

Benefits of technology

It significantly reduces the survival rate of soybean thrips and the expression of the Muhsp68 gene, improves the control effect, reduces pesticide use, reduces environmental residues, and achieves green control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012508A_ABST
    Figure CN122012508A_ABST
Patent Text Reader

Abstract

The invention discloses an application of a double-stranded RNA molecule and a related biological material thereof in prevention and control of megalustris usitatus, and relates to the technical field of prevention and control of agricultural pests. The double-stranded RNA molecule provided by the invention is targeted to the Muhsp68 gene of the megalurothrips megalurothrips, and the coding sequence of the Muhsp68 gene is SEQ ID NO: 1. The double-stranded RNA molecule provided by the invention can effectively interfere with the expression of the megalurothrips megalurothrips Muhsp68 gene, thereby causing death of the megalurothrips megalurothrips; the double-stranded RNA molecule is further applied together with a biogenic pesticide, so that the death rate of the megalurothrips megalurothrips can be further improved. Precise prevention and control of the megalurothrips megalurothrips can be achieved, the prevention and control efficiency of biological source pesticides is improved, and the method has good application prospects and agricultural sustainable development value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of agricultural pest control technology, specifically to the application of a double-stranded RNA molecule and related biological materials in the control of soybean thrips. Background Technology

[0002] Bean thrips ( Megalurothrips usitatus Bean thrips, belonging to the family Thripidae in the order Thysanoptera, are devastating pests of leguminous plants. They primarily feed directly on the sap of leaves, flowers, and pods using their rasping-sucking mouthparts, causing leaf wrinkling, flower drop, and blackening of the pods' heads and tails. They can also transmit various plant viruses, severely impacting crop yield and quality. This insect is small, highly concealed, reproduces rapidly, and spreads quickly, making control extremely difficult. In the context of reducing chemical pesticide use and increasing efficiency, commonly used biopesticides such as abamectin and spinosad have developed resistance, and this resistance is increasing year by year. Therefore, there is an urgent need to develop green and efficient new control technologies to address this resistance pressure.

[0003] RNA interference (RNAi) technology utilizes double-stranded RNA (dsRNA) to mediate the specific degradation of target mRNA, thereby achieving gene silencing. In the field of pest control, this technology, by designing dsRNAs targeting key pest genes, can effectively interfere with their normal growth, development, or physiological functions, even leading to pest death. In particular, the international approval of Ledprona, the world's first sprayable RNA biopesticide, at the end of 2023 marks the entry of pest control into the nucleic acid era. RNA pesticides based on artificially synthesized dsRNA are gradually developing into an important green pest control strategy, demonstrating broad application prospects. Therefore, identifying highly efficient functional genes and constructing stable double-stranded RNA (dsRNA) delivery systems are of great significance for improving the application potential of RNAi technology. Summary of the Invention

[0004] This invention provides the application of a double-stranded RNA molecule and related biological materials in the control of soybean thrips, which reduces the survival rate of soybean thrips and thus effectively protects plants from soybean thrips damage.

[0005] In a first aspect, the present invention provides a double-stranded RNA molecule that targets *Thrips tigrinus*. Muhsp68 ( heat shock protein 68 ) gene, the Muhsp68 The gene's coding sequence is SEQ ID NO:1.

[0006] The double-stranded RNA molecule described above is composed of a sense strand and an antisense strand, wherein the nucleotide sequence of the sense strand is SEQ ID NO:2 and the nucleotide sequence of the antisense strand is SEQ ID NO:3.

[0007] The double-stranded RNA molecule described above can... Muhsp68 The gene is transcribed in vitro using a coding sequence fragment (nucleotide sequence shown at positions 61-567 of SEQ ID NO:1) as a template.

[0008] In a second aspect, the present invention provides biological materials related to any of the double-stranded RNA molecules described above, wherein the biological materials are selected from at least one of A1)-A5): A1) The DNA molecule encoding the double-stranded RNA molecule; A2) An expression cassette containing the DNA molecule described in A1); A3) A recombinant vector containing the DNA molecule described in A1) or a recombinant vector containing the expression cassette described in A2); A4) Recombinant microorganisms containing the DNA molecule described in A1), or recombinant microorganisms containing the expression cassette described in A2), or recombinant microorganisms containing the recombinant vector described in A3); A5) A transgenic cell line containing the DNA molecule described in A1), or a transgenic cell line containing the expression cassette described in A2), or a transgenic cell line containing the recombinant vector described in A3).

[0009] In the biological material described above, A1), the DNA molecule comprises the nucleotide sequence shown in positions 61-567 of SEQ ID NO:1.

[0010] Thirdly, the present invention provides a product comprising any of the double-stranded RNA molecules described above.

[0011] The product as described above also includes a double-stranded RNA molecule delivery carrier and / or an insecticide.

[0012] It is understood that the double-stranded RNA molecule can be delivered by methods such as injection, feeding, or epidermal delivery, and the delivery vector used varies depending on the delivery method; furthermore, the product is suitable for delivery via feeding.

[0013] Furthermore, the double-stranded RNA molecule delivery carrier is a polymer carrier as shown in Formula 1, which can assist the double-stranded RNA molecule in penetrating the intestinal wall tissue of the bean thrips' digestive tract, thereby entering its body to exert its function.

[0014] ; In Equation 1, R1 and R2 are each independently selected from H, CH3, CH2CH3 or CH2CH2CH3; n1, n2, n3 and n4 are each independently integers from 1 to 100.

[0015] Furthermore, R1 and R2 are both CH3, and n1, n2, n3, and n4 are all 40.

[0016] Furthermore, the polymer carrier shown in Formula 1 can be prepared by the method disclosed in Example 2 of Chinese Invention Patent CN108794710A.

[0017] In the product described above, the mass ratio of the double-stranded RNA molecule to the polymer carrier described in Formula 1 is 1:1.

[0018] As described above, the final concentration of the double-stranded RNA molecule in the product can be 100-1000 ng / μL, preferably 500 ng / μL; the final concentration of the polymer carrier in the composition is determined accordingly based on the corresponding mass ratio.

[0019] As described above, the insecticide includes at least one of emamectin benzoate and spinosad. The concentration of the insecticide can be determined based on the LC50 of the insecticide. 50 Confirmed. Specifically, when the insecticide is emamectin benzoate, LC... 50 The value can be 0.497 mg / L; when the insecticide is spinosad, the LC50 value is... 50 The value can be 0.533 mg / L.

[0020] In the product described above, the mass ratio of the double-stranded RNA molecule, the double-stranded RNA molecule delivery carrier, and the insecticide is optimized and determined. Specifically, when the insecticide is emamectin benzoate, the mass ratio of the three is 1:1:0.217; when the insecticide is spinosad, the mass ratio of the three is 1:1:0.137.

[0021] The product described above also includes a solvent, which may be nuclease-free water.

[0022] As described above, the individual components of the product can be stored separately. When in use, the double-stranded RNA molecules are mixed with the polymer carrier described in Formula 1 and incubated at 0-35°C for at least 15 minutes to form a mixed system of double-stranded RNA molecules and the carrier, facilitating the delivery of the double-stranded RNA molecules. Preferably, the incubation temperature of the above mixed system is 18-28°C.

[0023] As described above, when the product includes an insecticide, the double-stranded RNA molecule and the double-stranded RNA molecule delivery vector can be mixed and incubated according to the above method, and then the insecticide can be added according to the above mass ratio. After mixing and incubating for 15 minutes, the product is obtained.

[0024] The product described above can be an RNA preparation.

[0025] As described above, the RNA formulation further includes one or more agriculturally acceptable excipients; the excipients include, but are not limited to, solvents, carriers, dispersants, stabilizers, surfactants, adhesives, or antifreeze agents.

[0026] As described above, the RNA preparation may contain other biological or non-biological components, and the other components of the RNA preparation can be determined by those skilled in the art based on the effects of the preparation.

[0027] As described above, the RNA preparation is suitable for delivery via methods such as feeding or leaf delivery.

[0028] As described above, the dosage form of the RNA preparation is a soluble concentrate, suspension concentrate, dispersible liquid, granule, or wettable powder.

[0029] Fourthly, the present invention provides the application of any of the above-described double-stranded RNA molecules, or the above-described biological materials, or any of the above-described products, wherein the application is selected from at least one of B1)-B6): B1) In reducing soybean thrips Muhsp68 Applications in gene expression levels; B2) In the preparation of thrips-reducing soybean thrips Muhsp68 Applications of gene expression levels in products; B3) Application in the prevention and control of plant damage by soybean thrips; B4) Application in the preparation of products for preventing and controlling plant damage by soybean thrips; B5) Application in reducing the survival rate of soybean thrips; B6) Application in the preparation of products that reduce the survival rate of soybean thrips.

[0030] Fifthly, the present invention provides a method for reducing the survival rate of bean thrips, comprising: feeding or contacting bean thrips with any of the double-stranded RNA molecules or any of the products described above, thereby reducing the survival rate of bean thrips after the double-stranded RNA molecules enter the bean thrips' body.

[0031] In a sixth aspect, the present invention provides a method for preventing and controlling plant damage caused by soybean thrips, comprising: applying any of the above-described double-stranded RNA molecules or any of the above-described products to the surface of a plant, wherein the double-stranded RNA molecules are ingested or come into contact with soybean thrips and enter the soybean thrips' body, thereby preventing and controlling plant damage caused by soybean thrips by reducing the survival rate of soybean thrips.

[0032] As described above, the double-stranded RNA molecule or a product containing the double-stranded RNA molecule can be sprayed onto the bean thrips. Specifically, the spray can be applied directly to the surface of the bean thrips or to the surface of the plant for the bean thrips to feed on.

[0033] As described above, the amount of the double-stranded RNA molecule or the product containing the double-stranded RNA molecule applied is determined according to the specific circumstances.

[0034] As described above, the plant is one that is susceptible to damage by bean thrips. The plant is preferably a legume, including but not limited to cowpea, green bean, string bean, mung bean, red bean, broad bean, soybean, alfalfa and peanut; it can also be an eggplant or pepper from the Solanaceae family, a cucumber or watermelon from the Cucurbitaceae family, cotton from the Malvaceae family, etc.

[0035] The methods described above include prevention and control of plant damage caused by bean thrips.

[0036] This invention focuses on the genes related to key stress-resistance proteins in soybean thrips. Muhsp68 A specific double-stranded RNA molecule was provided as the target, which can be used to target the bean thrips. Muhsp68 RNA interference was performed on the gene, resulting in a phenotype of soybean thrips mortality while ensuring interference efficiency. Furthermore, this invention provides a product comprising the aforementioned double-stranded RNA molecule, which helps to further improve the mortality rate of soybean thrips. This invention enables precise control of soybean thrips, improves control efficacy, and prevents plant damage from soybean thrips; simultaneously, it reduces pesticide application and environmental residues, representing an innovative green control technology with positive implications for sustainable agricultural development. Attached Figure Description

[0037] Figure 1 For use Muhsp68 dsRNA / SPc and EGFP After treating soybean thrips with dsRNA / SPc for 24 h, 48 h, 72 h, and 96 h, respectively, Muhsp68 The relative expression level of genes; Figure 2 For use Muhsp68 dsRNA / SPc and EGFPMortality of soybean thrips after treatment with dsRNA / SPc for 24 h, 48 h, 72 h, and 96 h, respectively; Figure 3 For use EGFP dsRNA / SPc, emamectin benzoate (ethyl spinosad), Muhsp68 dsRNA / SPc and Muhsp68 The mortality rates of soybean thrips after treatment with dsRNA / SPc / emamectin benzoate (ethyl spinosad) composite solution for 24 h, 48 h, 72 h, and 96 h were determined; where A represents emamectin benzoate treatment and B represents spinosad treatment. Figure 4 For use EGFP dsRNA / SPc, emamectin benzoate (ethyl spinosad) and Muhsp68 After treatment with a dsRNA / SPc / emamectin benzoate (ethyl spinosad) complex solution for 12 h, 24 h, 36 h, and 48 h, the soybean thrips showed... Muhsp68 The relative expression levels of genes; where A represents emamectin benzoate treatment and B represents spinosad treatment. Detailed Implementation

[0038] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, embodiments of this invention, and should not be construed as limiting the invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention. In the description of this invention, it should be understood that the terminology used is for descriptive purposes only and should not be construed as indicating or implying relative importance.

[0039] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0040] Data processing in the following examples was performed using GraphPad Prism 9.5.1 statistical software. Experimental results are expressed as mean ± standard deviation. Statistical analysis employed t-tests and Tukey HSD tests. In the t-test, * indicates a significant difference (P < 0.05), ** indicates a highly significant difference (P < 0.01), *** indicates a highly significant difference (P < 0.001), **** indicates a highly significant difference (P < 0.0001), and ns indicates no statistical significance. In the Tukey HSD test, different letters represent significant differences (P < 0.05).

[0041] The bean thrips used in the following examples were collected from Nanbin Farm, Yazhou District, Sanya City, Hainan Province, and reared indoors in the laboratory of the Sanya Research Institute of China Agricultural University. The indoor rearing conditions were: temperature 26±0.5℃, relative humidity maintained at 70±5%, and photoperiod of 14h:10h (day:night). The rearing method for bean thrips was as follows: separate egg-laying tanks and hatching tanks were set up in the rearing tanks. Fresh cowpeas were used for egg-laying and nymph development, and the cowpeas were replaced regularly under the aforementioned environmental conditions.

[0042] The emamectin benzoate (CAS No. 137512-74-4, also known as emamectin benzoate) used in the following examples was purchased from Shandong Shangnong Agricultural Technology Co., Ltd., and its formulation is a microemulsion; spinosad (CAS No. 187166-40-1) was purchased from Dow AgroSciences, Inc., and its formulation is a suspension.

[0043] The polymer carrier SPc used in the following examples is the star-shaped polymer P2 disclosed in Example 2 of Chinese Invention Patent Application Publication No. CN108794710A, and its structural formula is as follows: .

[0044] Example 1: Synthetic Targeting Muhsp68 dsRNA of genes 1. Acquisition of the target fragment Thirty adult soybean thrips were randomly selected, and total RNA was extracted from them using the SteadyPure Universal RNA Extraction Kit (purchased from Hunan Aikerui Biotechnology Co., Ltd.). The purity and concentration of the obtained RNA were determined using both 1% agarose gel electrophoresis and a ThermoFisher Scientific Nanodrop OneOneC spectrophotometer. cDNA was synthesized using the HiScript III All-in-one RT SuperMixPerfect for qPCR kit (purchased from Vazyme).Muhsp68 The CDS sequence of the gene (nucleotide sequence SEQ ID NO:1) was designed using the National Center for Biotechnology Information (NCBI) online website. Muhsp68 Gene amplification primers Muhsp68 -F (nucleotide sequence is SEQ ID NO:4) and Muhsp68 -R (nucleotide sequence is SEQ ID NO:5). Primers were synthesized by Hainan Qingke Biotechnology Co., Ltd.

[0045] Muhsp68 The gene's coding sequence (SEQ ID NO:1): 5'-ATGGCCGAGGCGGTGGGAATCGATCTGGGAACCATGTACTCTTGCGCCGCCTTCGTCACC AACGG CAAGGTGGAAGTGATCCAGGCCGACGATTCTGGGAAGCGTGTCGTTCCGTCTTGTGTCGCGTTCGTGGGCGAGGAG GAGCTGGTAGGGGATGGTGCACTTGCCAAGGCCAGGCGGGATCCAACCAAAGTTATTTACGATGCCAAGAGACTGA TCGGCCGTAGCTACAACGAGCAGTCTGTGCAGGATGACATAGAGAAATGGCCGTTCAAAGTGGTCGACAGTGAAGG CAGACCCACGATACAGGTCGAGCACAAAGGCCAGACCAAGTCCATTGTAGCCGAGGAGGTTTCTGCCATGGTACTG CGGAAACTCATTGCAGACGCTACAAAACGGATCGGCCAAGAAGTGAAGAAAGCCGTCATCACAGTGCCGGCGTATT TCACGGACAGCCAGAAGCGCGCCACCAAGGAGGCAGCTAGAATGGCGGGCATCGAAGTGTTGCGCCTCCTCCCGGA GCCGACGGCGGCTGCCGTGGCGTACGGACGGGAGAACAAGGGTCTG upstream primer Muhsp68 -F (SEQ ID NO:4): 5'-AACGGCAAGGTGGAAGTGAT-3'; Downstream primer Muhsp68 -R (SEQ ID NO: 5): 5'-CAGACCCTTGTTTCCCCGTC-3'.

[0046] Using the cDNA obtained from reverse transcription as a template, and with upstream primers... Muhsp68 -F and downstream primers Muhsp^68 -R was used as the amplification primer, and PCR amplification was performed using a 2×Taq PCR Master Mix kit (purchased from Vazyme). The PCR amplification conditions were: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s; 60℃ annealing for 15 s; 72℃ extension for 30 s, for a total of 30 cycles; final extension at 72℃ for 5 min; and storage at 4℃. In SEQ ID NO:1, the underlined sequence is the sequence amplified using the above primers.

[0047] The size of the PCR products was determined by 1% agarose gel electrophoresis. The gel blocks containing the target bands were cut off with a clean blade using a blue light gel cutter (purchased from Mona Biotechnology Co., Ltd.) and the gels were recovered using the FastPure Gel DNAExtraction Mini Kit (purchased from Vazyme).

[0048] The recovered gel product was ligated into the pCE2 TA / Blunt-Zero Vector (purchased from Vazyme) and then transformed into *E. coli* DHDH5α competent cells (purchased from Vazyme). The bacterial culture was plated on medium containing 100 mg / mL Amp resistance and cultured overnight. Single colonies were picked for PCR and identified by 1% agarose gel electrophoresis. The correctly identified bacterial cultures were sent to Hainan Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were compared with the NCBI database to obtain the results containing... Muhsp68 The target sequence fragment was obtained from a bacterial strain. Plasmids from the target strain were extracted using the Fast Pure Plasmid Mini Kit (purchased from Vazyme) and used as templates for the next reaction.

[0049] 2. Synthesis of dsRNA Design primers containing the T7 promoter sequence, respectively, using the above-mentioned primers containing... Muhsp68 plasmids containing the target sequence and EGFPUsing plasmid (purchased from Zhuangmeng Biotechnology, catalog number ZK427) as a template, PCR amplification was performed with primers containing the T7 promoter sequence. The amplification conditions were the same as above, and the target product was purified and recovered to obtain a template for dsRNA synthesis.

[0050] Primers containing the T7 sequence are as follows: Upstream primer T7- Muhsp68 -F (SEQ ID NO:6): 5'- TAATACGACTCACTATAGGG AACGGCAAGGTGGAAGTGAT-3'; Downstream primer T7- Muhsp68 -F (SEQ ID NO:7): 5'- TAATACGACTCACTATAGGG CAGACCCTTGTTCTCCCGTC-3'; Upstream primer T7- EGFP -F (SEQ ID NO:8): 5'- TAATACGACTCACTATAGGG ACAAGTTCAGCGTGTCCG-3'; Downstream primer T7- EGFP -R (SEQ ID NO:9): 5'- TAATACGACTCACTATAGGG GTTCACCTTGATGCCGTTC-3'.

[0051] In SEQ ID NO:6-9, the underlined sequence is the T7 promoter sequence, and the non-underlined sequence is the gene sequence.

[0052] dsRNA of the target gene was synthesized using the T7 RNAi Transcription Kit (purchased from Vazyme). A 20 μL mixture was prepared in a 200 μL centrifuge tube, consisting of 8 μL NTP Mix, 2 μL 10×Transcription Buffer, 2 μL T7 Enzyme Mix, and 1 μg of T7 product. RNase-free H2O was then added to bring the volume to 20 μL. The mixture was incubated overnight at 37°C. After overnight incubation, unreacted single-stranded RNA was removed according to the kit instructions. RNase T1 (100 U / μL) was diluted to 10 U / μL using RNase T1 Dilution Buffer. Then, 20 μL of Transcription Product, 17 μL of RNase-free H2O, 1 μL of DNase I, and 2 μL of RNase T1 (10 U / μL) were added. The mixture was then incubated in a PCR instrument at 37°C for 30 min. The reaction mixture was then transferred to a 1.5 mL centrifuge tube, and 4 μL of 3M Solution Acetate and 44 μL of isopropanol solution were added. After mixing thoroughly, the mixture was incubated on ice for 5 min, and then centrifuged at 12000 rpm for 20-30 min at 4°C. The supernatant was discarded, and the precipitate was washed with 500 μL of 75% ethanol solution. The precipitate was centrifuged at 12000 rpm for 10 min at 4°C, and the supernatant was carefully discarded. The centrifuge tube was placed in a fume hood and incubated at room temperature for 10 min to allow the ethanol to evaporate. Then, 30 μL of RNase-free ddH2O was added to dissolve the precipitate, yielding dsRNA, named... Muhsp68 dsRNA and EGFP dsRNA.

[0053] Muhsp68 The dsRNA consists of a sense strand with the nucleotide sequence SEQ ID NO:2 and an antisense strand with the nucleotide sequence SEQ ID NO:3. EGFP The dsRNA consists of a sense strand with the nucleotide sequence SEQ ID NO:10 and an antisense strand with the nucleotide sequence SEQ ID NO:11.

[0054] SEQ ID NO:2 is shown below: 5’-AACGGCAAGGUGGAAGUGAUCCAGGCCGACGAUUCUGGGAAGCGUGUCGUUCCGUCUUGUGUCGCGUUCGUGGGCGAGGAGGAGCUGGUAGGGGAUGGUGCACUUGCCAAGGCCAGGCGGGAUCCAACCAAAGUUAUUUACGAUGCCAAGAGACUGAUCGGCCGUAGCUACAACGAGCAGUCUGUGCAGGAUGACAUAGAGAAAUGGCCGUUCAAAGUGGUCGACAGUGAAGGCAGACCCACGAUACAGGUCGAGCACAAAGGCCAGACCAAGUCCAUUGUAGCCGAGGAGGUUUCUGCCAUGGUACUGCGGAAACUCAUUGCAGACGCUACAAAACGGAUCGGCCAAGAAGUGAAGAAAGCCGUCAUCACAGUGCCGGCGUAUUUCACGGACAGCCAGAAGCGCGCCACCAAGGAGGCAGCUAGAAUGGCGGGCAUCGAAGUGUUGCGCCUCCUCCCGGAGCCGACGGCGGCUGCCGUGGCGUACGGACGGGAGAACAAGGGUCUG-3’; SEQ ID NO:3 is specifically as follows: 5’-CAGACCCUUGUUCUCCCGUCCGUACGCCACGGCAGCCGCCGUCGGCUCCGGGAGGAGGCGCAACACUUCGAUGCCCGCCAUUCUAGCUGCCUCCUUGGUGGCGCGCUUCUGGCUGUCCGUGAAAUACGCCGGCACUGUGAUGACGGCUUUCUUCACUUCUUGGCCGAUCCGUUUUGUAGCGUCUGCAAUGAGUUUCCGCAGUACCAUGGCAGAAACCUCCUCGGCUACAAUGGACUUGGUCUGGCCUUUGUGCUCGACCUGUAUCGUGGGUCUGCCUUCACUGUCGACCACUUUGAACGGCCAUUUCUCUAUGUCAUCCUGCACAGACUGCUCGUUGUAGCUACGGCCGAUCAGUCUCUUGGCAUCGUAAAUAACUUUGGUUGGAUCCCGCCUGGCCUUGGCAAGUGCACCAUCCCCUACCAGCUCCUCCUCGCCCACGAACGCGACACAAGACGGAACGACACGCUUCCCAGAAUCGUCGGCCUGGAUCACUUCCACCUUGCCGUU-3’; SEQ ID NO:10 is specifically as follows: 5’-UGGAGAGGGUGAAGGUGAUGCAACAUACGGAAAACUUACCCUUAAAUUUAUUUGCACUACUGGAAAACUACCUGUUCCAUGGCCAACACUUGUCACUACUUUCUCUUAUGGUGUUCAAUGCUUUUCAAGAUACCCAGAUCAUAUGAAACGGCAUGACUUUUUCAAGAGUGCCAUGCCCGAAGGUUAUGUACAGGAAAGAACUAUAUUUUUCAAAGAUGACGGGAACUACAAGACACGUGCUGAAGUCAAGUUUGAAGGUGAUACCCUUGUUAAUAGAAUCGAGUUAAAAGGUAUUGAUUUUAAAGAAGAUGGAAACAUUCUUGGACACAAAUUGGAAUACAACUAUAACUCACACAAUGUAUACAUCAUGGCAGACAAACAAAAGAAUGGAAUCAAAGUUAACUUCAAAAUUAGACACAACAUUGAAGAUGGAAGCGUUCAACUAGCAGACCAUUAUCAACAAAAUACUCCAAUUGGCGAUGGCCCUGUCCUUUUACCAGACAACCAUUACCUGUCCACACAAUCUG-3’; SEQ ID NO:11 is specifically shown as follows: 5'--3'.

[0055] Take 1 μL of dsRNA solution, dilute it 10-fold, and determine its fragment size and quality by agarose gel electrophoresis. dsRNA concentration is measured using a micro-spectrophotometer. The validated dsRNA product is aliquoted and stored at -20℃ for subsequent experiments.

[0056] Example 2 Muhsp68 Application of dsRNA nanoformulation in the control of soybean thrips 1. Preparation of dsRNA / SPc pollen feeding solution Take the sample obtained from Example 1 Muhsp68 dsRNA and [[ID=5^9]]EGFP The dosage of dsRNA is calculated based on the measured concentration. Taking the preparation of a 50 μL compound formulation as an example, take 12.5 μL of dsRNA solution with a concentration of 2000 ng / μL, add an equal mass of polymer carrier at a dsRNA to SPc mass ratio of 1:1, mix thoroughly, and let stand at room temperature for 20 min to allow SPc and dsRNA to fully bind. Then, make up the volume to 50 μL with 1% pollen solution to obtain a pollen feeding solution containing dsRNA / SPc complex with a final concentration of 500 ng / μL.

[0057] 2. Delivery of dsRNA via pollen solution feeding method Take a 10 mL centrifuge tube and use a preheated soldering iron to melt and cut along the bottom perimeter of the tube, completely removing the bottom. Cover the bottom opening with a 200-mesh gauze and secure it with hot melt glue along the edges to form a breathable bottom surface. During the experiment, a sealing film should be placed over the top opening of the centrifuge tube to prevent insects from escaping; it can also be used to fix the pollen solution placed on it.

[0058] Take 1-day-old juvenile thrips (about the size of a bean), and place 30 thrips in each RNAi tube. Cover the tube opening with a thin, translucent sealing film, and take 50 μL of the solution containing... Pollen feeding solution containing the dsRNA / SPc complex was dropped onto the membrane and then covered with a sealing film to prevent evaporation. Each treatment had three biological replicates, with the control group receiving an equal volume of [a specific type of feed containing dsRNA / SPc]. Muhsp68 Pollen feeding medium containing dsRNA / SPc complex. After 24 h of treatment, the pollen feeding medium was removed, and a washed and dried cowpea pod was placed in the RNAi tube for continued feeding.

[0059] The RNAi tubes were cultured at a temperature of 26 ± 0.5 ℃, a relative humidity of 70 ± 5%, and a photoperiod of 14:10 h (day:night).

[0060] 3. Determination of RNA interference effect After feeding pollen containing dsRNA / SPc complex, surviving bean thrips were collected at 24 h, 48 h, 72 h, and 96 h, and divided into 3 groups. Total RNA was extracted and reverse transcribed into cDNA, using the same method as in Example 1.

[0061] Design qPCR primers using the NCBI online website ( EGFP The nucleotide sequences of the amplification primers are SEQ ID NO:12-13. Muhsp68 For internal reference gene ( RPL The nucleotide sequences of the amplification primers are SEQ ID NO:14-15. The quantitative real-time PCR (qPCR) assay was performed using the Taq ProUniversal STBR qPCR Master Mix kit (purchased from Vazyme).

[0062] The specific primer sequences are as follows: upstream primer q- RPL -F (SEQ ID NO: 12): 5'-TAGGATCTCTGGTCGGTAGC-3'; Downstream primer q- Muhsp68-R (SEQ ID NO: 13): 5'-ATCACCTCGTCAATGTCCGC-3'; upstream primer q- Muhsp68 -F(SEQ ID NO:14):5'-ACATCGAGCTGGGTACTG-3'; Downstream primer q- RPL -R (SEQ ID NO: 15): 5'-CACCACCATTTACTGAGCAT-3'.

[0063] The specific reaction mixture consisted of 10 μL of 2×Taq Pro Universal SYBR qPCR Master Mix, 0.4 μL of upstream primer, 0.4 μL of downstream primer, 1 μL of cDNA, and 8.2 μL of ddH2O. The reaction conditions were 95℃ for 10 s, 60℃ for 30 s, and 72℃ for 30 s, for a total of 40 cycles. The reaction was performed using a QuantStudio™ 3 Real-Time PCR System (ThermoFisher Scientific, USA).

[0064] The results are as follows RPL As shown. (In the control group) Figure 1 The gene expression level was used as a baseline (set to 1.0), and then... Muhsp68 After dsRNA treatment, the expression level of this gene in soybean thrips was downregulated at different time points: it decreased to 44.0% of the control group after 24 h, to 64.9% after 48 h, to 86.5% after 72 h, and to 89.9% after 96 h. These results indicate that... Muhsp68 dsRNA can effectively silence endogenous genes in soybean thrips Muhsp68 The expression.

[0065] 4. Mortality Statistics After feeding the bean thrips with pollen containing the dsRNA / SPc complex, the number of dead thrips was counted every 24 hours until 96 hours.

[0066] The mortality rate of soybean thrips (%) = number of dead individuals / initial number of individuals × 100%.

[0067] The results are as follows Muhsp68 As shown, delivery Figure 2 Following the administration of dsRNA / SPc formulation, the mortality rate of soybean thrips gradually increased over time, reaching 17.43%, 22.98%, 27.99%, and 43.22% at 24 h, 48 h, 72 h, and 96 h, respectively. The mortality rates at each time point were significantly higher than those at other time points.Muhsp68 dsRNA / SPc control group. The above results indicate that silencing bean thrips in vivo... EGFP Muhsp68 Note: There seems to be a possible error in the original text where "Muhsp^68" and "5^9" are likely incorrect notations. I've translated them as they are but they might need to be corrected in the source. Gene expression can cause death.

[0068] Example 3 Muhsp68 Combined use of dsRNA / SPc / biopesticides for the control of soybean thrips 1. LC50 of abamectin and spinosad 50 Measurement To determine the toxicity levels of abamectin and spinosad to soybean thrips, the LC50 of the two commercially available formulations was determined using the leaf-tube film-coating method. 50 The mortality rate of soybean thrips was calculated after 48 h of treatment and analyzed using SPSS software. The specific settings were as follows: six concentration gradients of abamectin were set (3.0, 2.0, 1.0, 0.5, 0.25, 0.125 mg / L), and the LC50 values ​​were calculated. 50 The value was 0.497 mg / L; nine concentration gradients of ethyl spinosad were set (5.0, 2.5, 1.25, 1.0, 0.8, 0.6, 0.4, 0.2, 0.1 mg / L), and its LC50 was calculated. 50 The value was 0.533 mg / L.

[0069] 2. Muhsp68 dsRNA / SPc / biopesticide preparation method To build Muhsp68 In the dsRNA / SPc / pesticide complex system, the loading efficiency of the SPc vector for different pesticides was first determined. According to the literature (Yan et al., 2025), the encapsulation efficiency (PLC) of SPc loaded with abamectin was 21.85%, and the encapsulation efficiency of SPc loaded with spinosad was 13.76%. Based on this, and according to Example 2... Muhsp68 Based on the principle of mixing dsRNA and SPc at a mass ratio of 1:1, the mass ratios of the two groups were calculated: Muhsp68 The mass ratio of dsRNA, SPc, and emamectin benzoate was 1:1:0.217. Muhsp68 The mass ratio of dsRNA, SPc and ethyl spinosad was 1:1:0.137.

[0070] 2.1 Muhsp68 Preparation of dsRNA / SPc / emamectin benzoate complex solution To prepare 5 mL Muhsp68 Taking the dsRNA / SPc / emamectin benzoate complex solution as an example, where the final concentration of emamectin benzoate is 0.497 mg / L, based on a mass ratio of 1:1:0.217, it is calculated that 1.95 μL of SPc solution (concentration 5.83 μg / μL) and 2.85 μL of...Muhsp68 Add dsRNA solution (concentration 4.00 μg / μL) to 2 mL ddH2O, mix well, and incubate at room temperature for 15 min; then add 828 μL abamectin solution (concentration 3 mg / L), bring the volume to 5 mL with ddH2O, mix well, and incubate at room temperature for another 15 min to prepare the target complex solution.

[0071] 2.2 Muhsp68 Preparation of dsRNA / SPc / ethyl spinosad complex solution To prepare 5 mL Muhsp68 Taking the dsRNA / SPc / ethyl spinosad complex solution as an example, where the final concentration of ethyl spinosad is 0.533 mg / L, based on a mass ratio of 1:1:0.137, calculate and use 3.45 μL of SPc solution (concentration 5.83 μg / μL) and 5.03 μL of... Add dsRNA solution (concentration 4.00 μg / μL) to 2 mL ddH2O, mix well, and incubate at room temperature for 15 min; then add 26.65 μL ethyl spinosad solution (concentration 100 mg / L), bring the volume to 5 mL with ddH2O, mix well, and incubate at room temperature for another 15 min to prepare the target complex solution.

[0072] 3. Muhsp68 Determination of the lethal effect of dsRNA / SPc / biopesticide complex on soybean thrips Washed and dried cowpea pods were immersed in the prepared compound solution for 20 seconds, then removed and dried. Thirty adult bean thrips were collected using a siphon and placed into one RNAi tube. Each treatment was performed in triplicate. The tubes were immediately sealed with sealing film after being placed in the cowpea pods that had been immersed in the compound solution. The RNAi tubes were incubated under the same environmental conditions, and the mortality rate of bean thrips was recorded at 24 h, 48 h, 72 h, and 96 h after treatment (refer to Example 2).

[0073] The results are as follows Muhsp68 As shown, via Figure 3 After treatment with a dsRNA / SPc / emamectin benzoate complex solution, the mortality rates of soybean thrips at 24 h, 48 h, 72 h, and 96 h were 52.22%, 75.67%, 81.11%, and 93.33%, respectively; in contrast, the mortality rates of soybean thrips treated with a single dsRNA / SPc / emamectin benzoate complex solution were significantly lower. 50 In the abamectin-treated group, the mortality rates of soybean thrips at 24 h, 48 h, 72 h, and 96 h were 30%, 43.33%, 58.89%, and 64.44%, respectively, significantly lower than those in the compound solution-treated group. Muhsp68 (A) Figure 3After treatment with the dsRNA / SPc / ethyl spinosad compound solution, the mortality rates were 55.56%, 75.67%, 84.44%, and 88.89%, respectively. In the group treated with ethyl spinosad alone, the mortality rates of soybean thrips at 24 h, 48 h, 72 h, and 96 h were 32.22%, 43.33%, 58.89%, and 64.44%, respectively, significantly lower than those in the compound solution treatment group. Muhsp68 (B) Use alone. Figure 3 The mortality rate in the dsRNA / SPc complex treatment group was also significantly lower than that in the corresponding complex solution treatment group.

[0074] The above results indicate that, compared with the application of biopesticides (emamectin benzoate or spinosad) alone or using alone... Muhsp68 Compared to the dsRNA / SPc complex, Muhsp68 Treatment with a compound solution of dsRNA / SPc / bio-based pesticides significantly increased the mortality rate of soybean thrips, demonstrating a synergistic effect.

[0075] 4. Muhsp68 After application of dsRNA / SPc / bio-based pesticide compound solution Muhsp68 Determination of gene expression levels Treat soybean thrips with the following solutions respectively: Muhsp68 dsRNA / SPc complex, emamectin benzoate LC 50 Solution, ethyl spinosad LC 50 Solution EGFP dsRNA / SPc / emamectin benzoate complex solution Muhsp68 dsRNA / SPc / ethyl spinosad complex solution. After treatment for 12 h, 24 h, 36 h, and 48 h, surviving bean thrips were collected, with three biological replicates for each treatment. Total RNA was extracted and reverse transcribed into cDNA for qPCR detection. Muhsp68 Relative gene expression levels.

[0076] The results are as follows Muhsp68 As shown, with Figure 4 Compared with the dsRNA control group, treatment with abamectin solution alone for 12 h, 24 h, 36 h, and 48 h resulted in... EGFP Gene expression levels were upregulated to 4.94-fold, 4.98-fold, 3.73-fold, and 3.42-fold compared to the control group, respectively; while using Muhsp68 Treatment with the dsRNA / SPc / emamectin benzoate complex solution significantly inhibited its expression level, decreasing to 0.56-fold, 0.72-fold, 0.53-fold, and 0.57-fold compared to the control group, respectively. Muhsp68 (A). Similarly, ethyl spinosad alone LC 50After treatment with the solution for 12 h, 24 h, 36 h, and 48 h, the gene expression levels were 1.66-fold, 1.56-fold, 1.48-fold, and 1.33-fold higher than those in the control group, respectively; while after treatment with the solution... Figure 4 Treatment with the dsRNA / SPc / ethyl spinosad complex solution inhibited expression levels to 1.04-fold, 0.67-fold, 0.63-fold, and 0.59-fold of the control group, respectively. Muhsp68 (B)

[0077] The above results indicate that Figure 4 The dsRNA / SPc / bio-based pesticide compound solution can effectively inhibit the effects of pesticides used alone. Muhsp68 Muhsp68 Gene expression was upregulated. This result indicates that, in addition to directly killing soybean thrips, biopesticides can also achieve synergistic insecticidal effects by targeting and interfering with the expression of key genes within soybean thrips.

[0078] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A double-stranded RNA molecule, characterized in that, The double-stranded RNA molecule targets the bean thrips. Muhsp68 Genes, the ones mentioned Muhsp68 The gene's coding sequence is SEQ ID NO:

1.

2. The double-stranded RNA molecule according to claim 1, characterized in that, The double-stranded RNA molecule consists of a sense strand and an antisense strand, the nucleotide sequence of the sense strand is SEQ ID NO:2, and the nucleotide sequence of the antisense strand is SEQ ID NO:

3.

3. A biomaterial relating to the double-stranded RNA molecule of claim 1 or 2, characterized in that, The biomaterial is selected from at least one of A1)-A5): A1) The DNA molecule encoding the double-stranded RNA molecule; A2) An expression cassette containing the DNA molecule described in A1); A3) A recombinant vector containing the DNA molecule described in A1) or a recombinant vector containing the expression cassette described in A2); A4) Recombinant microorganisms containing the DNA molecule described in A1), or recombinant microorganisms containing the expression cassette described in A2), or recombinant microorganisms containing the recombinant vector described in A3); A5) A transgenic cell line containing the DNA molecule described in A1), or a transgenic cell line containing the expression cassette described in A2), or a transgenic cell line containing the recombinant vector described in A3).

4. The product, characterized in that, Includes the double-stranded RNA molecule as described in claim 1 or 2.

5. The product according to claim 4, characterized in that, The product also includes double-stranded RNA molecule delivery vectors and / or insecticides.

6. The product according to claim 5, characterized in that, The double-stranded RNA molecule delivery vector is the polymer vector shown in Formula 1: ; In Equation 1, R1 and R2 are each independently selected from H, CH3, CH2CH3 or CH2CH2CH3; n1, n2, n3 and n4 each independently take values ​​from 1 to 100.

7. The product according to claim 5 or 6, characterized in that, The insecticide includes at least one of emamectin benzoate and spinosad.

8. The application of the double-stranded RNA molecule according to any one of claims 1-2, the biomaterial according to claim 3, or the product according to any one of claims 4-7, characterized in that, The application is selected from at least one of B1)-B6): B1) In reducing soybean thrips Muhsp68 Applications in gene expression levels; B2) In the preparation of thrips-reducing soybean thrips Muhsp68 Applications of gene expression levels in products; B3) Application in the prevention and control of plant damage by soybean thrips; B4) Application in the preparation of products for preventing and controlling plant damage by soybean thrips; B5) Application in reducing the survival rate of soybean thrips; B6) Application in the preparation of products that reduce the survival rate of soybean thrips.

9. A method for reducing the survival rate of bean thrips, characterized in that, include: When the double-stranded RNA molecule of claim 1 or 2 or the product of any one of claims 4-7 is fed to or comes into contact with soybean thrips, the survival rate of soybean thrips is reduced after the double-stranded RNA molecule enters the body of soybean thrips.

10. A method for preventing and controlling plant damage by soybean thrips, characterized in that, include: The double-stranded RNA molecule of claim 1 or 2 or the product of any one of claims 4-7 is applied to the surface of a plant. After the double-stranded RNA molecule is ingested or comes into contact with the bean thrips, it enters the bean thrips' body and prevents the plant from being damaged by bean thrips by reducing the survival rate of the bean thrips.