Transcription factor ZmbHLH180 gene, encoding protein thereof and application of transcription factor ZmbHLH180 gene in plant flowering phase regulation
By providing the transcription factor ZmbHLH180 gene and its encoded protein, the expression of the floriculture gene ZCN8 in maize was regulated, which solved the deficiency in maize flowering period regulation, achieved significant regulation of flowering period, and supported plant breeding.
Patent Information
- Application Number
- CN202610192728.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-10
- Publication Date
- 2026-05-12
AI Technical Summary
In maize, existing technologies have limited research on the regulatory mechanisms of bHLH transcription factors during flowering, resulting in a lack of effective gene regulation methods to control maize flowering time, which affects breeding and the selection of varieties with optimal flowering time.
The transcription factor ZmbHLH180 gene and its encoded protein are provided. By knocking out or overexpressing the expression of the floriculture gene ZCN8 in maize, the flowering period of maize can be regulated, including delaying or shortening the flowering period.
Significantly regulates maize flowering time by knocking out the ZmbHLH180 gene to delay flowering time and overexpressing the ZmbHLH180 gene to shorten flowering time, providing a technical basis for plant flowering time regulation and supporting the genetic improvement of new plant varieties.
Smart Images

Figure CN122012522A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a transcription factor ZmbHLH180 gene and its encoded protein and its application in the regulation of plant flowering period. Background Technology
[0002] Flowering is a crucial stage in plant growth and development and is one of the factors that determine yield. During the flowering process, it is precisely regulated by multiple genes. ZEA CENTRORADIALIS 8 (ZCN8 gene) encodes a flowering protein that is synthesized in the leaves and transported over long distances to the floral organs to regulate the flowering process. It plays a core role in the transition and adaptation of flowering time. Overexpression of the ZCN8 gene in plants can effectively promote early flowering.
[0003] As a monoecious crop, maize (Zea mays) determines its crop rotation time, natural pollination efficiency, and maturity period based on its suitable flowering period. The breeding of maize varieties often tends to favor shorter flowering periods. The ZCN8 gene regulates the flowering time of maize by integrating multiple signaling pathways such as hormones, photoperiod, and temperature. Therefore, identifying the upstream transcription factors that regulate the expression of the ZCN8 gene is of great reference value for breeding varieties with suitable flowering periods.
[0004] bHLH transcription factors, possessing a basic helical-loop-helical structure and a basic region, play a crucial role in regulating plant flowering, growth and development, and responses to stress. Previous studies have shown that bHLH can regulate flowering time through multiple complex pathways. In Arabidopsis thaliana, iron deficiency-induced AtbHLH38, AtbHLH100, and AtbHLH101 can interact with CONSTANS (CO), thereby affecting CO transcriptional activity and subsequently regulating FT expression. Similarly, CRYPTOCHROME-INTERACTING bHLH1 (CIB1) directly binds to the promoter region of FT to regulate photoperiodic flowering. Likewise, the rice homolog CIB1-LIKE regulates flowering time by binding to the Early Heading Date 1 promoter. However, there are few reports on the regulatory mechanism of bHLH on flowering time in maize. In-depth analysis of the regulatory mechanism of bHLH in maize not only enriches the network of flowering time regulation but also provides a theoretical basis for breeding work. Summary of the Invention
[0005] The purpose of this invention is to provide a transcription factor ZmbHLH180 gene and its encoded protein, and its application in the regulation of plant flowering period, in order to solve the above-mentioned problems.
[0006] The present invention achieves the above objectives through the following technical solutions: In order to overcome the shortcomings of the prior art, the purpose of this invention is to provide a transcription factor ZmbHLH180 gene and its encoded protein and its application in the regulation of plant flowering period.
[0007] The present invention achieves the above objectives through the following technical solutions: This invention provides a transcription factor ZmbHLH180 gene, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0008] The present invention also provides a protein encoded by the transcription factor ZmbHLH180 gene as described above, the amino acid sequence of which is shown in SEQ ID NO.2.
[0009] This invention also provides an application of the transcription factor ZmbHLH180 gene as described above in the regulation of plant flowering period.
[0010] As a further optimization of the present invention, knockout of the transcription factor ZmbHLH180 gene inhibits corn tasseling, silking, and pollen shedding, thus delaying the corn flowering period; overexpression of the transcription factor ZmbHLH180 gene promotes corn tasseling, silking, and pollen shedding, thus shortening the corn flowering period.
[0011] As a further optimization of the present invention, the transcription factor ZmbHLH180 gene promotes tasseling, silking, and pollen shedding in maize by positively regulating the expression of the floriculture gene ZCN8, thereby shortening the maize flowering period.
[0012] As a further optimization of the present invention, the corn is the corn inbred line B104.
[0013] This invention also provides a method for obtaining new maize germplasm, wherein the transcription factor ZmbHLH180 gene as described above is introduced into the maize genome for overexpression, and the obtained positive seedlings are the new maize germplasm. The new maize germplasm has earlier tasseling, silking, and pollination than wild-type maize, and the maize flowering period is shortened.
[0014] The beneficial effects of this invention are as follows: 1) This invention provides a transcription factor ZmbHLH180 gene, whose full-length CDS is 864 bp, encoding 287 amino acids, and is mainly located in the cell nucleus. Transgenic knockout of the ZmbHLH180 gene mutant maize lines significantly reduces the expression of the florigen synthesis gene ZCN8, leading to late flowering in maize; transgenic overexpression of the ZmbHLH180 gene maize lines significantly promotes the expression of the florigen synthesis gene ZCN8, promoting early flowering in maize. This provides a certain technical basis for the regulation of plant flowering cycle, provides selection for the genetic improvement of new plant varieties, and has important application value. 2) The results of yeast one-hybrid experiments in this invention show that ZmbHLH180 can bind to the promoter of the ZCN8 gene. Gel migration experiments show that ZmbHLH180 can bind to the promoter of the ZCN8 gene. Dual-luciferase reporter assays also show that ZmbHLH180 can promote the expression of the ZCN8 gene. The ZmbHLH180 gene provided by this invention can be used in the future to regulate crop flowering time using gene editing technology. Attached Figure Description
[0015] Figure 1 This is a knockout pattern diagram of transgenic maize lines (maize lines KO#2 and KO#4 with the ZmbHLH180 gene knocked out); Figure 2 This is a comparison of the ZCN8 gene expression levels in transgenic maize lines (Maize lines KO#2 and KO#4 with the ZmbHLH180 gene knocked out) and wild-type maize B104. Figure 3 This is a comparison of the flowering phenotypes of transgenic maize lines (Maize lines KO#2 and KO#4 with the ZmbHLH180 gene knocked out) and wild-type maize B104 at the same stage. Figure 4 A statistical chart showing the flowering time (tasseling, silking, pollen shedding) of transgenic maize lines (Maize lines KO#2 and KO#4 with the ZmbHLH180 gene knocked out) and wild-type maize B104; Figure 5 This is a comparison of the ZmbHLH180 gene expression levels in transgenic maize lines (maize lines OE#3 and OE#5 overexpressing the ZmbHLH180 gene) and wild-type maize B104. Figure 6 This is a comparison of the ZCN8 gene expression levels in transgenic maize lines (maize lines OE#3 and OE#5 overexpressing the ZmbHLH180 gene) and wild-type maize B104. Figure 7This is a comparison of the detection results of ZmbHLH180 protein expression in transgenic maize lines (maize lines OE#3 and OE#5 overexpressing the ZmbHLH180 gene) and wild-type maize B104. Figure 8 This is a phenotypic comparison of flowering time between transgenic maize lines (overexpressing the ZmbHLH180 gene maize lines OE#3 and OE#5) and wild-type maize B104 at the same stage. Figure 9 A statistical graph showing the flowering time (tasseling, silking, pollen shedding) of transgenic maize lines (maize lines OE#3 and OE#5 overexpressing the ZmbHLH180 gene) and wild-type maize B104; Figure 10 Figure showing the results of a dual-luciferase reporter assay; Figure 11 The image shows the results of a yeast one-hybrid (Y1H) experiment. Figure 12 Figure showing the results of the gel migration assay (EMSA); Figure 13 This is a phylogenetic tree of the ZmbHLH180 protein. Detailed Implementation
[0016] The present application will now be described in further detail with reference to the accompanying drawings. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.
[0017] 1. Materials Unless otherwise specified, the methods used in this embodiment are conventional methods known to those skilled in the art, and the reagents and materials used are commercially available products.
[0018] 2. Method 2.1 Experiments to knock out the ZmbHLH180 gene To investigate the function of the ZmbHLH180 gene, the ZmbHLH180 gene was knocked out in maize. The target sequence of the gene is as follows: SEQ ID NO.3: Target 1: GTTCTCGACACCTCCCCACGAGG; SEQ ID NO.4: Target 2: CCTGGTCCCTGGCTGTGATAAGG; See the types of knockout Figure 1 As shown.
[0019] Wild-type maize B104 and transgenic knockout maize lines (maize lines KO#2 and KO#4 with the ZmbHLH180 gene knocked out) were cultured and grown in a greenhouse under 12 hours of light (28℃) / 12 hours of darkness (22℃) conditions, and watered and fertilized regularly to ensure vigorous plant growth.
[0020] To detect the expression level of the ZCN8 gene (gene number Zm00001eb353250) in transgenic knockout maize lines, a real-time quantitative PCR experiment was performed (using ZmGAPDH as an internal reference gene, gene number Zm00001d049641). The results are as follows: Figure 2 As shown; photographs were taken to record the flowering phenotype of the plants, and the results are as follows. Figure 3 As shown; and statistically analyzing the flowering period data of the plants, including the cycles of stamen emergence, silking, and pollen shedding, such as... Figure 4 As shown; The real-time PCR primers used to detect the expression level of the ZCN8 gene are shown below: SEQ ID NO.5: qZCN8-F: 5'>TACAACAATAGGCTACTTCTGCCAA<3'; SEQ ID NO.6: qZCN8-R: 5'>TATCTGTCACCATCCAGTGCAAGT<3''; SEQ ID NO.7: qZmGAPDH-F: 5'>CCTGCTTCTCATGGATGGTTG<3'; SEQ ID NO.8: qZmGAPDH-R: 5'>CTGTCACAGATGGTAGCAGGAAGG<3' Experimental results: Figure 1 The results showed that the type of ZmbHLH180 gene knockout maize line KO#2 was a 2bp deletion after target site 1, resulting in a translocation mutation, while the type of ZmbHLH180 gene knockout maize line KO#4 was a 680bp large fragment deletion between target sites 1 and 2. Figure 2 The experimental results showed that, compared with wild-type maize, the expression level of the ZCN8 gene was significantly downregulated in transgenic knockout maize lines. Figure 3 The experimental results of 4 showed that, compared with the wild type, knocking out the ZmbHLH180 gene in maize could significantly prolong the time of tasseling, silking, and pollination, and delay the flowering period of maize.
[0021] 2.2 Experiments on overexpression of the ZmbHLH180 gene (1) Obtaining transgenic positive maize lines overexpressing the ZmbHLH180 gene To further verify the function of the ZmbHLH180 gene, the ZmbHLH180 gene was overexpressed in maize, as detailed below: Design specific primers to amplify the CDS sequence of the ZmbHLH180 gene (CDS sequence as shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein as shown in SEQ ID NO.2). The nucleotide sequences of the specific primers are shown below: SEQ ID NO.9: ZmbHLH180-F: 5'>ATGGCAAGCTTCCCACACC<3'; SEQ ID NO.10: ZmbHLH180-R: 5'>CTGGAAAGGGCACATGTGG<3'; The amplified fragment was ligated into the pCambia1305-Ubi-FLAG vector via homologous recombination to obtain the pCambia1305-Ubi:ZmbHLH180-FLAG recombinant plasmid. The recombinant plasmid was then transformed into wild-type (B104) maize using genetic transformation technology to obtain transgenic overexpressing plants. After identification and screening, positive transgenic overexpressing maize lines (OE#3, 5) were obtained.
[0022] Wild-type maize B104 and transgenic overexpressing maize lines (overexpressing the ZmbHLH180 gene maize lines OE#3 and OE#5) were cultured and grown in a greenhouse under 12 hours of light (28℃) / 12 hours of darkness (22℃) conditions, with timely watering and fertilization to ensure vigorous plant growth.
[0023] To detect the expression levels of ZmbHLH180 and ZCN8 genes and the amount of ZmbHLH180 protein in transgenic overexpressing maize lines, quantitative real-time PCR (using ZmGAPDH as an internal reference gene, gene number Zm00001d049641) and Western blot experiments were performed. The results are as follows: Figure 5-7 As shown; photographs were taken to record the flowering phenotype of the plants, and the results are as follows. Figure 8 As shown; and statistical data on the flowering period of the plants, including stamen emergence, silk thread emergence, and pollen shedding, such as... Figure 9 As shown; The real-time PCR primers used to detect the expression level of the ZmbHLH180 gene are shown below: SEQ ID NO.11: qZmbHLH180-F: 5'>GCTCGCTCCAAGGACTCAAA<3'; SEQ ID NO. 12: qZmbHLH180-R: 5'>GTGGTTGTCCGTTGCTTGTC<3''.
[0024] Experimental results: Figure 5-7 The experimental results showed that, compared with wild-type maize, the expression levels of ZmbHLH180 and ZCN8 genes were significantly upregulated in transgenic overexpression maize lines, and the Flag antibody significantly enriched the ZmbHLH180-Flag protein. Figure 8 The experimental results showed that the transgenic overexpression maize lines flowered earlier than wild-type maize, significantly advancing the time of tasseling, silking, and pollen shedding. Figure 9 The experimental results showed that overexpression of the ZmbHLH180 gene in maize can significantly shorten the time of tasseling, silking, and pollination, and shorten the flowering period of maize.
[0025] 2.2 Validation experiment on the regulation of the ZCN8 gene by the ZmbHLH180 gene (1) Transcriptional activity analysis of ZmbHLH180 To verify the regulatory role of ZmbHLH180 on the ZCN8 gene promoter, specific primers were designed to amplify the ZCN8 gene promoter proZCN8 (SEQ ID NO.15). The nucleotide sequences of the specific primers are shown below: SEQ ID NO.13: proZCN8-F: 5'>ggtaccCTAGGCGATCGATGTCTACGT<3'; SEQ ID NO.14: proZCN8-R: 5'>ctcgagATATTGCAGAAAAATAACTCGCTAATG<3'; Note: Lowercase letters are restriction enzyme sites; The amplified fragment proZCN8 was ligated into the pGreenII-0800-LUC vector using homologous recombination to obtain the pGreenII-0800-proZCN8:LUC recombinant plasmid. Wild-type maize B104 and transgenic maize lines (overexpressing the ZmbHLH180 gene maize lines OE#3 and OE#5) were cultured in a greenhouse under 28°C dark conditions for 24 hours to obtain healthy etiolated seedlings. After enzymatic hydrolysis with a solution of cellulose and pectinase in a 37°C incubator for 4 hours, the seedlings were filtered through a cell sieve to remove impurities and collected by centrifugation at 4°C (relative centrifugal force 100×g, 2 min, acceleration / deceleration 0). The recombinant plasmid pGreenII-0800-proZCN8:LUC was transformed into the protoplasts of wild-type maize B104 and transgenic overexpressing maize lines using PEG4000. After culturing for 20 hours, the LUC activity of the protoplasts was detected.
[0026] Experimental results: Figure 10The experimental results showed that quantitative LUC activity analysis of ZCN8 promoter activation indicated that overexpression of the ZmbHLH180 gene significantly promoted the transcriptional level of the ZCN8 gene promoter.
[0027] (2) Yeast one-hybrid (Y1H) experiment To verify that ZmbHLH180 can bind to the promoter region of the ZCN8 gene, specific primers (SEQ ID NO. 13-14) were designed to amplify the ZCN8 gene promoter proZCN8. This promoter was then cloned into the pAbAi vector via homologous recombination to obtain the recombinant pAbAi-proZCN8 bait plasmid. Specific primers (SEQ ID NO. 9-10) were designed to amplify the CDS sequence of the ZmbHLH180 gene. This CDS sequence was then linked to the transcriptional activation domain (AD) of the yeast GAL4 transcription factor via homologous recombination to construct the fusion expression protein ZmbHLH180-AD. Using ZmbHLH180-AD as the bait protein, pAbAi-proZCN8 was transformed into Y1H. Gold yeast cells were cultured for three days on SD medium lacking uracil to screen for single-clonal cells and prepare competent cells. ZmbHLH180-AD was transformed into these prepared competent cells. Cells containing pAbAi-proZCN8 were cultured for four days on SD medium lacking leucine with 300 ng / mL AbA added. The yeast clones were then imaged and analyzed.
[0028] Experimental results: Figure 11 The experimental results showed that yeast expressing ZmbHLH180-AD could grow on a medium containing 300 mmol / L basidiosin, indicating that ZmbHLH180 can bind to the promoter of the ZCN8 gene.
[0029] (3) Gel migration (EMSA) experiment To verify that ZmbHLH180 can directly bind to the promoter region of the ZCN8 gene, specific primers were designed to amplify the CDS sequence of the ZmbHLH180 gene. Using homologous recombination, the sequence was cloned into the pGEX-6p-1 vector to construct the fusion expression protein GST-ZmbHLH180. Recombinant protein expression in *E. coli* BL21(DE3) was induced at 16°C with the addition of 1 mM isopropyl-β-D-1-thiogalactoside (IPTG) for 24 hours. Cells were collected by centrifugation (4000×g, 10 min, 4°C) and resuspended in ice-cold phosphate-buffered saline (PBS, pH 7.4). The GST-ZmbHLH180 was subjected to affinity purification using glutathione agarose resin and eluted in 50 mM Tris-HCl (pH 8.0) containing 10 mM reduced glutathione. Ultrafiltration was performed using a 30,000 Dalton cutoff ultrafiltration membrane by centrifugation (3400 × g, 5 h, 4 °C). In the preparation of fluorescein-labeled (FAM) DNA probes, complementary oligonucleotides (final concentration 10 μM) were heated to 95 °C for 5 minutes for annealing, followed by slow cooling to 25 °C. The binding reaction consisted of 300 ng of GST-ZmbHLH180 and 1 μM... DNA probe and 1 μg oligomer (dI-dC) were placed in binding buffer (100 mM Tris [pH 7.9], 5% [v / v] glycerol, 0.04 μg / μL bovine serum albumin, 10 mM MgCl2 and 100 mM DTT) and incubated at 25 °C for 30 min. The complex was then separated by natural gel electrophoresis in 0.5 × TBE buffer, and the fluorescence signal was detected using a Tanon MINI Space1000 imaging system.
[0030] Experimental results: Figure 12 The experimental results show that the recombinant protein GST-ZmbHLH180 can directly bind to the promoter of the ZCN8 gene.
[0031] 2.3 Homology Analysis A phylogenetic tree of the ZmbHLH180 protein was constructed using MEGA7 software, and evolutionary relationships were analyzed. The results are as follows: Figure 13 As shown, phylogenetic analysis revealed that it is distantly related to AtbHLH38, AtbHLH100, AtbHLH101, AtCIB1, GmCIB1, and ZmCIB1 (marked with black circles), which have been reported to regulate flowering time. This indicates that the ZmbHLH180 gene is a novel gene that regulates flowering time.
[0032] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.
Claims
1. A transcription factor ZmbHLH180 gene, characterized in that: The nucleotide sequence of the transcription factor ZmbHLH180 gene is shown in SEQ ID NO.
1.
2. The protein encoded by the transcription factor ZmbHLH180 gene as described in claim 1, characterized in that: The amino acid sequence of the protein encoded by the transcription factor ZmbHLH180 gene is shown in SEQ ID NO.
2.
3. The application of the transcription factor ZmbHLH180 gene as described in claim 1 in the regulation of plant flowering period.
4. The application according to claim 3, characterized in that, Knockout of the transcription factor ZmbHLH180 gene inhibits tasseling, silking, and pollen shedding in maize, thus delaying the flowering period. Overexpression of the transcription factor ZmbHLH180 gene promotes tasseling, silking, and pollen shedding in maize, thus shortening the flowering period.
5. The application according to claim 4, characterized in that, The transcription factor ZmbHLH180 gene promotes tasseling, silking, and pollen shedding in maize by positively regulating the expression of the floriculture gene ZCN8, thereby shortening the maize flowering period.
6. The application according to claim 5, characterized in that, The corn in question is the corn inbred line B104.
7. A method for obtaining new maize germplasm, characterized in that, Knocking out the transcription factor ZmbHLH180 gene as described in any one of claims 1-6 into the maize genome yields positive seedlings, which are new maize germplasm. The new maize germplasm exhibits later tasseling, silking, and pollination than wild-type maize, and its flowering period is prolonged. Similarly, overexpressing the transcription factor ZmbHLH180 gene as described in any one of claims 1-6 into the maize genome yields positive seedlings, which are new maize germplasm. The new maize germplasm exhibits earlier tasseling, silking, and pollination than wild-type maize, and its flowering period is shortened.