Separated nucleic acid molecule, recombinant bacterium and application of separated nucleic acid molecule and recombinant bacterium in cultivation of high-sugar tobacco variety
By knocking out the NtTD1 gene in tobacco using CRISPR/Cas9 technology, the problem of difficulty in increasing the sugar content of flue-cured tobacco leaves in existing technologies has been solved, resulting in a significant increase in total sugar and reducing sugar in tobacco, which improves the quality of tobacco leaves without affecting plant development.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SICHUAN BRANCH OF CHINA TOBACCO
- Filing Date
- 2026-02-25
- Publication Date
- 2026-05-12
AI Technical Summary
Existing technologies make it difficult to stably increase the total sugar and reducing sugar content of flue-cured tobacco leaves through genetic breeding, and directly regulating sugar metabolism genes may lead to abnormal tobacco development.
The NtTD1 gene, specifically expressed in tobacco glandular trichomes, was knocked out using CRISPR/Cas9 gene editing technology. By constructing a gene knockout vector and infecting tobacco with recombinant bacteria such as Agrobacterium, the NtTD1 gene was knocked out, thereby increasing the total sugar and reducing sugar content of tobacco.
This method significantly increases the total sugar and reducing sugar content of flue-cured tobacco leaves, improving leaf quality without affecting plant development, and provides a stable method for breeding high-sugar tobacco varieties.
Smart Images

Figure CN122012555A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic improvement technology for tobacco quality, and more specifically, to isolated nucleic acid molecules, recombinant bacteria, and their application in cultivating high-sugar tobacco varieties. Background Technology
[0002] Tobacco is an important economic crop in my country. The chemical composition of flue-cured tobacco leaves is the main factor determining its intrinsic quality and use value. Among the many chemical components, the content of total sugar and reducing sugar in flue-cured tobacco leaves, as well as their ratio and difference, are key chemical indicators for measuring the intrinsic quality and industrial usability of tobacco leaves. They play a crucial role in improving the sensory and style characteristics of cigarette products. The contribution of sugars to tobacco quality is mainly reflected in the following aspects: (1) Improving the taste and aroma quality of tobacco leaves. Sugars in tobacco leaves produce an acidic reaction when burned, which can neutralize the alkaline substances in the smoke, reduce the irritation, and make the smoke more mellow and smooth. The content of reducing sugar and total sugar is significantly positively correlated with the aroma quantity, aroma quality, concentration, and other smoking quality indicators of tobacco leaves. When the ratio of the two sugars (reducing sugar / total sugar) increases and the difference between the two sugars decreases, the aroma quantity and concentration of tobacco leaves will be significantly improved. (2) Improving appearance quality. Tobacco leaves with high sugar content usually have better appearance quality. Studies have shown that the ratio of the two sugars is significantly positively correlated with the appearance quality indicators of tobacco leaves, such as color depth, maturity, softness, and oiliness. Sugars can also make tobacco leaves softer, more elastic, brighter in color, and more resistant to pressure and less prone to breakage. (3) Promote the formation of aroma substances. Sugars are important precursors for the formation of aroma substances. Under high temperature conditions above 300℃, sugars can be pyrolyzed alone to form carbonyl compounds such as furan derivatives, ketones, and aldehydes. In addition, sugars react with amino acids in Maillard reactions to generate a variety of aroma substances, giving tobacco its unique aroma characteristics. Therefore, exploring methods to increase the reducing sugar and total sugar content of flue-cured tobacco leaves is of great significance for improving the quality of tobacco leaves.
[0003] Methods to increase the sugar content of tobacco leaves generally include three approaches: cultivation, curing, and breeding. Cultivation and curing typically involve optimizing planting and harvesting methods, precise fertilization, soil carbon and nitrogen regulation, and optimizing curing techniques. However, these methods require high technical standards and are difficult to implement, making it hard for tobacco farmers to achieve effective results if they lack the necessary expertise. Developing high-sugar varieties through genetic breeding is the most economical and stable method; however, since sugar metabolism is primary metabolism, directly regulating genes involved in sugar synthesis may lead to abnormal tobacco development. Therefore, research on increasing sugar content by regulating specific target genes is currently scarce.
[0004] In view of this, the present invention is proposed. Summary of the Invention
[0005] The purpose of this invention is to provide isolated nucleic acid molecules, recombinant bacteria, and their application in cultivating high-sugar tobacco varieties to increase the sugar content of tobacco varieties and improve tobacco quality.
[0006] This invention is implemented as follows: In a first aspect, the present invention provides an isolated nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO: 1.
[0007] Secondly, the present invention provides a carrier comprising isolated nucleic acid molecules.
[0008] Thirdly, the present invention provides a gRNA molecule for targeted isolation of nucleic acid molecules.
[0009] Fourthly, the present invention provides a gene knockout vector comprising the above-mentioned gRNA molecule.
[0010] Fifthly, the present invention provides a recombinant bacterium comprising the gene knockout vector described above.
[0011] Sixthly, the present invention provides the application of isolated nucleic acid molecules, vectors, gRNA molecules, gene knockout vectors or recombinant bacteria in the cultivation of high-sugar tobacco varieties.
[0012] In a seventh aspect, the present invention provides a method for increasing the sugar content of tobacco, comprising any one of the following four methods: (i) Knockout of tobacco NtTD1 Gene; (ii) Gene knockout targets are set for isolated nucleic acid molecules, gene knockout vectors are constructed, and then the gene knockout vectors are transferred into the target tobacco. (iii) Construct a gene knockout vector containing gRNA molecules, and then transfer the gene knockout vector into the target tobacco. (iv) Transfer the gene knockout vector into the target tobacco; (v) When the recombinant bacteria is Agrobacterium, the Agrobacterium is used to infect the target tobacco.
[0013] The present invention has the following beneficial effects: This invention is the first to clone a gene from tobacco that is specifically expressed in the glandular head of a pilosebaceous unit. NtTD1 Genes were knocked out in the flue-cured tobacco variety K326 using CRISPR / Cas9 gene editing technology. NtTD1 After genes, NtTD1 The homozygous mutant tobacco material showed significantly increased total sugar and reducing sugar content in the flue-cured tobacco leaves. Based on this, a method for editing flue-cured tobacco varieties using CRISPR / Cas9 technology was obtained. NtTD1 A method to stabilize and increase the total sugar and reducing sugar content of flue-cured tobacco leaves by studying genes. Due to... NtTD1The gene is specifically expressed in tobacco glandular trichomes. Knocking out this gene has no effect on the development of tobacco plants. Therefore, this method has important application value in the breeding of high-sugar tobacco varieties. The invention will help improve the quality of tobacco leaves. Attached Figure Description
[0014] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.
[0015] Figure 1 for NtTD1 Electrophoresis results of CDS clone fragments, with DL2000 as the marker; Figure 2 This is a sequence diagram showing the target site and the target site segment information for two types of mutant plants. Detailed Implementation
[0016] Reference will now be made to detailed embodiments of the present invention, one or more of which are described below. Each example is provided for explanation and not for limitation of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made to the invention without departing from its scope or spirit. For example, features described or illustrated as part of one embodiment may be used in another embodiment to produce further embodiments.
[0017] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. While any methods and materials similar to or equivalent to those described herein may be used in the practice or testing of formulations or unit doses herein, some methods and materials are described hereby. Unless otherwise stated, the techniques employed or considered herein are standard methods. Materials, methods, and examples are illustrative and not limiting in nature.
[0018] The term "nucleic acid molecule" refers to a sequence of nucleoside or nucleotide monomers composed of natural bases, sugars, and interglycosylation (backbone) bonds. The term also includes modified or substituted sequences containing non-naturally occurring monomers or portions thereof. The nucleic acid molecules of this invention can be deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) sequences and may contain natural bases, including adenine, guanine, cytosine, thymine, and uracil. Modified bases may also be present. Examples of these modified bases include nitrogenous and denitrogenated adenine, guanine, cytosine, thymine, and uracil; and xanthine and hypoxanthine.
[0019] The term "vector" also includes any intermediate medium for nucleic acids that enables the nucleic acids to be introduced, for example, into prokaryotic and / or eukaryotic cells, and, where appropriate, integrated into the genome. Vectors of this type preferably replicate and / or are expressed in cells. The term "vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. The term "plasmid," as used herein, generally refers to a construct of extrachromosomal genetic material, typically a circular double-stranded DNA that can replicate independently of chromosomal DNA. Any plasmid and vector can be used as long as it can replicate and remain stable within the host.
[0020] In a first aspect, the present invention provides an isolated nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO: 1. The nucleotide sequence shown in SEQ ID NO: 1 is from tobacco. NtTD1 cDNA of a gene. NtTD1 The functions of genes are as follows: NtTD1 The gene encodes an enzyme that is a threonine dehydratase, which catalyzes the conversion of L-threonine to α-ketobutyrate. This is based on tobacco genome sequencing data from Huazhong Agricultural University, available at http: / / lifenglab.hzau.edu.cn / Nicomics / . NtTD1 The gene's location on the chromosome is Chr20:26360458-26368443.
[0021] By knocking out tobacco NtTD1 Genes can increase the total sugar and reducing sugar content of flue-cured tobacco leaves, and because NtTD1 The gene is specifically expressed in tobacco glandular trichomes. Knocking out this gene has no effect on the development of tobacco plants. Therefore, this method has important application value in the breeding of high-sugar tobacco varieties.
[0022] The nucleotide sequence shown in SEQ ID NO: 1 is as follows:
[0023] Secondly, the present invention provides a carrier comprising isolated nucleic acid molecules.
[0024] In one alternative embodiment, the vector is an expression vector, and an important feature of an expression vector is that it typically contains an origin of replication, a promoter, a marker gene, and translation control elements.
[0025] Thirdly, the present invention provides a gRNA molecule for targeted isolation of nucleic acid molecules.
[0026] In a preferred embodiment of the present invention, it includes a nucleotide sequence as shown in SEQ ID NO: 2 or SEQ ID NO: 3.
[0027] SEQ ID NO: 2: ccgaattcgttacggtgtgagcc; SEQ ID NO: 3: gaacgggtttcagtatctagtgg.
[0028] Both SEQ ID NO: 2 and SEQ ID NO: 3 target tobacco. NtTD1 The first exon of a gene.
[0029] Fourthly, the present invention provides a gene knockout vector comprising the above-mentioned gRNA molecule.
[0030] Fifthly, the present invention provides a recombinant bacterium comprising the gene knockout vector described above; In a preferred embodiment of the present invention, the recombinant bacteria are *Escherichia coli* or *Agrobacterium*. *Agrobacterium* is selected from *Agrobacterium tumefaciens*.
[0031] Sixthly, the present invention provides the application of isolated nucleic acid molecules, vectors, gRNA molecules, gene knockout vectors or recombinant bacteria in the cultivation of high-sugar tobacco varieties.
[0032] In a preferred embodiment of the present invention, the application includes at least one of the following application methods: (1) Gene knockout target sites were set for the isolated nucleic acid molecules, gene knockout vectors were constructed, and then the gene knockout vectors were transferred into the target tobacco. (2) Construct a gene knockout vector containing the above-mentioned gRNA molecules, and then transfer the gene knockout vector into the target tobacco. (3) The above gene knockout vector was transferred into the target tobacco; (4) When the recombinant bacteria is Agrobacterium, Agrobacterium will infect the target tobacco.
[0033] Methods for transferring the target tobacco include, but are not limited to, Agrobacterium-mediated gene transformation, gene gun transformation, and pollen tube pathway transformation.
[0034] Preferably, a gene knockout target is set for at least one of exons 1 to 8 of the isolated nucleic acid molecule, a gene knockout vector is constructed, and then the gene knockout vector is transferred into the target tobacco. For example, a gene knockout target is set for exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, or exon 8 of the isolated nucleic acid molecule, and a gene knockout vector is constructed.
[0035] Preferably, a gene knockout target is set for the first exon of the isolated nucleic acid molecule, a gene knockout vector is constructed, and then the gene knockout vector is transferred into the target tobacco.
[0036] The nucleotide sequence of exon 1 is as follows: ATGGCAGGTCTAATTTTCACCCCTGCAAACTCACTTTTTTCCCGCCCCAAATTCCCGGCGAAAATATCAGCCATTACCGGCAATTACGACACCGTTAAAATCTCCACCGCCATGTCCAAAACGGCGGTGGAATTGTTTCCTAATTTACCGGCGACGGCCGTAGATACATTGACAATCAAAGTTTCACCACCATCTCCTCCTCCTCCGACTCCATTGCT AGTAGTTTCTCCGAATTCGTTACGTGTGAGCCTGGGTACTTGATACCGAATTATCCGGTGGGCGGTAATGGAGGTGAGAACGGGTTTCAGTATCTAGTGGATATATTGGGTACGAAAGTGTACGATGTAGCAAATGAATCGCCATTGCAGCTTGCCGAAGCTTTCACAGAAGTTGGGGGTTAACGTTTGGCTTAAACGAGAGGATCTTCAACCC.
[0037] In a seventh aspect, the present invention provides a method for increasing the sugar content of tobacco, comprising any one of the following four methods: (i) Knockout of tobacco NtTD1 Gene; (ii) Gene knockout targets are set for isolated nucleic acid molecules, gene knockout vectors are constructed, and then the gene knockout vectors are transferred into the target tobacco. (iii) Construct a gene knockout vector containing gRNA molecules, and then transfer the gene knockout vector into the target tobacco. (iv) Transfer the gene knockout vector into the target tobacco; (v) When the recombinant bacteria is Agrobacterium, Agrobacterium will infect the target tobacco.
[0038] Knockout tobacco NtTD1 Genetic methods include, but are not limited to: CRISPR / Cas9 system, zinc finger nuclease (ZFN) technology, and transcription activator-like effector nuclease (TALEN) technology. Any method that can enable the formation of [something] in tobacco glandular trichomes... NtTD1 Both are feasible if the gene is not expressed or cannot be fully expressed.
[0039] In a preferred embodiment of the present invention, the tobacco sugar content is the tobacco reducing sugar and / or the total tobacco sugar content.
[0040] In a preferred embodiment of this invention, the target tobacco is selected from flue-cured tobacco varieties K326, RG17, TN86, Basma, China Tobacco 100, Henan Tobacco 10, Hunan Tobacco 7, Yunnan Tobacco 85, Yunnan Tobacco 87, NC89, or Honghua Dajinyuan. Specifically for flue-cured tobacco variety K326, it can significantly increase the reducing sugar and total sugar content of K326, thereby improving the quality of K326.
[0041] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.
[0042] The features and performance of the present invention will be further described in detail below with reference to embodiments.
[0043] Example 1 This embodiment performs NtTD1 Gene cloning.
[0044] 1. Cloning primers KL-NtTD1-F: ATGGCAGGTCTAATTTTCACCC; KL-NtTD1-F: TCAATGCATTATAAGCTTGAAAGCAT.
[0045] 2. NtTD1 Cloning methods and steps NtTD1 The genes were identified through comparative analysis of transcriptome sequencing of tobacco glandular trichomes and leaves with glandular trichomes removed. NtTD1The gene is specifically expressed in the glandular trichomes of tobacco, but not in the leaves. The specific gene cloning method is as follows: Glandular trichomes of flue-cured tobacco K326 were isolated under liquid nitrogen conditions, RNA was extracted, reverse transcribed into cDNA, and used as a template for... NtTD1 Gene cloning primers were used for PCR amplification. The PCR reaction volume was 25 μL, including 0.5 μL cDNA template, 1 μL each of forward and reverse primers, 12.5 μL 2 × PhantaFlash Master Mix, and 9.5 μL ddH2O. The PCR program was set as follows: 95 ℃, 3 min; 95 ℃, 15 sec, 55 ℃, 15 sec, 72 ℃, 10 sec, 35 cycles; 72 ℃, 10 min, and storage at 4 ℃. After PCR, the gene fragment was detected by 1% agarose gel electrophoresis.
[0046] Recovery using an agarose gel recovery kit NtTD1 The target band of the gene ( Figure 1 After detecting the concentration, the gene fragment was ligated into the cloning vector TA / Blunt-Zero Cloning. The vector ligation reaction volume was 5 μL, including 1 μL of PCR product and 4 μL of TA / Blunt-Zero Cloning. After adding the reaction volume, the mixture was ligated in a metal bath at 37°C for 5 min.
[0047] (1) Add the ligation product to 50 μL of freshly thawed DH5α Escherichia coli competent cells, then gently mix with a pipette tip and incubate on ice for 30 min.
[0048] (2) After the ice bath is completed, place it in a 42°C water bath for 30 seconds for heat shock, and then immediately put it in an ice bath for 2 minutes.
[0049] (3) Add 600 μL of antibiotic-free LB liquid medium and place it on a shaker at 37 ℃ and incubate at 220 rpm for 1 h.
[0050] (4) Centrifuge at 5000 rpm for 1 min, discard part of the supernatant, and mix the remaining 200 μL with a pipette. Spread the bacterial culture evenly on an LB (containing 50 mg / L kan) solid plate using a spreader, and invert it in a 37°C incubator for overnight culture.
[0051] (5) Select white monoclonal bacteria and verify them using vector primers. Send the positive clones for sequencing, and then sequence the clones linked to the vector primers. NtTD1 The recombinant plasmid with the correct sequence and the bacterial culture were preserved.
[0052] NtTD1 The CDS sequence of the gene is shown in SEQ ID NO: 1:
[0053] Example 2 This embodiment provides NtTD1 The process of creating knockout mutant materials.
[0054] 1. Construction of the knockout vector right NtTD1 Gene structure was analyzed, and two specific target sites were designed on its first exon. Primers for the knockout vector were then designed and constructed based on the two target sites to obtain the gRNA fragment.
[0055] Table 1. NtTD1 Target sites for gene knockout
[0056] Table 2. Primers used to construct the intermediate vector
[0057] Using T4 DNA ligase, NtTD1B1 / A1 (B1 / A1 respectively correspond to...) NtTD1 The two target sites (Target 1 and Target 2) were respectively coupled to a dual-target vector digested with Bsmb I restriction endonuclease to construct a complete CRISPR / Cas9 dual-target knockout vector containing two target gRNAs. After transformation, colony PCR verification, and sequencing confirmation, the recombinant vector was stored at -20℃.
[0058] 2. Creation of knockout materials 2.1 Cultivation of sterile seedlings Place K326 seeds in 2 mL centrifuge tubes, soak in 75% ethanol for 30 seconds, soak in 15% H2O2 for 8 minutes, rinse three times with sterile water, blot dry, and then sow onto MS solid medium. Incubate for 16 hours in light and 8 hours in darkness. When the seeds germinate and reach the cruciferous stage, transfer them to MS tissue culture flasks. Select seedlings with leaves 4-5 weeks old and cut them into 1-2 cm sections. 2 Leaves about the same size.
[0059] 2.2 Preparation of bacterial culture (1) Transformation: The overexpression and knockout vector plasmids with correct sequencing results were transformed into LBA4404 Agrobacterium competent cells: 1 μg of recombinant plasmid was added to 50 μL of LBA4404 competent cells that had been thawed on ice, the tube was gently tapped to mix, and the mixture was incubated on ice for 5 min. The mixture was then rapidly frozen in liquid nitrogen for 5 min, then transferred to a 37°C water bath for 5 min of heat shock, and immediately returned to ice for another 5 min. Under aseptic conditions, 700 μL of LB liquid medium (containing 100 mg / ml Kan and 50 mg / ml Rif) was added, and the cells were incubated at 28°C and 220 rpm for 2 h. After incubation, the cells were centrifuged at 5000 rpm for 5 min, about 650 μL of supernatant was discarded, the cells were resuspended in the remaining medium, and evenly spread on LB agar plates containing the corresponding antibiotics. The cells were incubated upside down at 28°C for about 48 h.
[0060] (2) Pick a single positive colony and inoculate it into LB liquid medium (containing Kan and Rif) and incubate overnight at 28°C and 200 rpm. Take 100 μl of the bacterial culture after shaking and add it to 30 mL of LB liquid medium (containing 100 mg / ml Kan and 50 mg / ml Rif), and shake at 28°C and 200 rpm until OD=0.6~0.8.
[0061] (3) Collection and resuspension: Centrifuge at 5000 rpm for 5 min to collect the bacterial cells, discard the supernatant, and resuspend in sterile water to OD=0.6~0.8 for later use.
[0062] 2.3 Leaf Infection and Plant Culture (1) Co-culture: Immerse the cut leaf discs in the resuspended Agrobacterium bacterial solution for 10 min, remove the excess bacterial solution from the surface, and then lay the leaf discs flat on MS medium with the back side facing up. Incubate in the dark in an artificial climate chamber for three days.
[0063] (2) Differentiation culture: After co-culture, rinse the leaves once with sterile water, remove excess water from the surface, and lay the leaves flat with the upper surface facing up in a new MS medium (containing 100 mg / ml 6-BA, 0.1 mg / ml NAA, 200 mg / ml termethin, and 10 mg / ml hyg) and place them in an artificial climate chamber for 2-3 weeks.
[0064] (3) Rooting culture: The seedlings differentiated during the differentiation culture stage are cut and transferred to MS rooting medium (containing 200 mg / ml termethin and 10 mg / ml hyg). After the seedlings are established, the roots are washed with sterile water and transferred to substrate soil for culture.
[0065] 2.4 NtTD1 Identification of knockout materials Total DNA was extracted from fresh tobacco leaves of T0 generation plants obtained from plant tissue culture. Plants with the T0 knockout vector were screened using PCR and electrophoresis. Mutation type was detected using primers CX-NtTD1-F / R, and plants with the T0 knockout vector were selected. NtTD1 Mutant material that has been edited within the target site of a gene.
[0066] Ultimately, three homozygous knockout mutants of two mutation types were obtained in the T0 generation. One mutant (line number nttd1-1) had a 18 bp deletion at target site 1 and a 3 bp deletion at target site 2; the other two mutants (line numbers nttd1-2 and nttd1-3) had a total deletion of 79 bp from target sites 1 to 2. The target site sequence information for lines nttd1-1 and nttd1-2 is as follows: Figure 2 As shown in the figure, a homozygous knockout mutant plant was successfully constructed.
[0067] Primers for positive vaccine detection: zmpl-cas9-FGCACCCGGTGGAGAACACGC; zmpl-cas9-RGTTCAGGTACGGCTCATGGGC.
[0068] Target site sequencing primers: CX-NtTD1-FTGAACTCGAATTGGCTCGACT; CX-NtTD1-RTGTCTACGAGAAATAAAGCTGACA.
[0069] Experimental Example 1 This experimental example is... NtTD1 The sugar content of the homozygous mutant material after gene knockout was detected in the cured tobacco leaves.
[0070] Three species were planted at three different experimental sites. NtTD1 Gene knockout homozygous mutant lines nttd1-1, nttd1-2, and nttd1-3, and the control variety K326, were used. At maturity, samples of cured C3F grade tobacco leaves from the middle section of each of the four materials were prepared at each experimental site. Total sugar and reducing sugar content were determined using near-infrared spectroscopy. The detection method is as follows: Take 10 g of tobacco powder, evenly fill it into a sample cup with an inner diameter of 5 cm, compact it with a copper block, and then collect diffuse reflectance spectra on an FT-NIR analyzer. During spectral acquisition, the sample cup is rotated eccentrically relative to the light source entrance aperture, with 64 scans and a resolution of 8 cm⁻¹. -1 Scanning range 3800–12000 cm -1 The step length is 3.86 cm. -1Using the gold-plated inner wall of the integrating sphere as the background, the background was scanned before each sample was scanned, and the number of scans was also 64. The experimental temperature was controlled at 25±0.5℃ and the humidity was below 20%.
[0071] The results are shown in Table 3. According to the test results, the total sugar and reducing sugar in the knockout mutant materials at each test site were higher than those in the wild-type control variety K326. The three test sites were used as three ecological replicates for analysis of variance. The reducing sugar and total sugar content of the mutant were significantly higher than those of the K326 control. Moreover, the ratio of the two sugars in the knockout mutant materials was higher and the difference between the two sugars was smaller, which is conducive to improving the quality of tobacco leaves.
[0072] Table 3. Sugar content detection results of C3F tobacco leaf samples from different production areas and made from different materials after curing.
[0073] Experiment Example 2 At the experimental base, five representative plants were selected from each of the knockout mutant materials nttd1-1, nttd1-2, and nttd1-3, and the control variety. Approximately 10 days after topping, agronomic traits reflecting plant development, such as plant height, number of leaves, stem circumference, internode distance, length and width of the middle leaves, and length and width of the terminal leaves, were measured. The results (Table 4) showed no significant differences in agronomic traits between the three materials and the control K326, indicating... NtTD1 The knockout of the gene does not affect the growth and development of the tobacco plant.
[0074] Table 4. Results of agronomic trait survey of the knockout material and control K326 (mean values)
[0075] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. An isolated nucleic acid molecule, characterized in that, It has the nucleotide sequence shown in SEQ ID NO:
1.
2. A carrier, characterized in that, It includes the isolated nucleic acid molecules as described in claim 1.
3. A gRNA molecule that targets the isolated nucleic acid molecule of claim 1.
4. The gRNA molecule according to claim 3, characterized in that, It includes nucleotide sequences as shown in SEQ ID NO:2 or SEQ ID NO:
3.
5. A gene knockout vector, characterized in that, It includes the gRNA molecule as described in any one of claims 3-4.
6. A recombinant bacterium, characterized in that, It includes the gene knockout vector as described in claim 5; Preferably, the recombinant bacteria is Escherichia coli or Agrobacterium.
7. The application of the isolated nucleic acid molecule of claim 1, the vector of claim 2, the gRNA molecule of any one of claims 3-4, the gene knockout vector of claim 5, or the recombinant bacteria of claim 6 in the cultivation of high-sugar tobacco varieties.
8. The application according to claim 7, characterized in that, The application includes at least one of the following application methods: (1) Set gene knockout target sites for the isolated nucleic acid molecules as described in claim 1, construct a gene knockout vector, and then transfer the gene knockout vector into the target tobacco. (2) Construct a gene knockout vector comprising the gRNA molecule described in any one of claims 3-4, and then transfer the gene knockout vector into the target tobacco; (3) Transform the gene knockout vector of claim 5 into the target tobacco; (4) When the recombinant bacteria of claim 6 is Agrobacterium, the Agrobacterium is used to infect the target tobacco. Preferably, a gene knockout target is set for at least one of the exons 1 to 8 of the isolated nucleic acid molecule according to claim 1, a gene knockout vector is constructed, and then the gene knockout vector is transferred into the target tobacco. Preferably, a gene knockout target is set for the first exon of the isolated nucleic acid molecule according to claim 1, a gene knockout vector is constructed, and then the gene knockout vector is transferred into the target tobacco.
9. A method for increasing the sugar content of tobacco, characterized in that, It includes any one of the following four methods: (i) Knockout of tobacco NtTD1 Gene; (ii) Set gene knockout target sites for the isolated nucleic acid molecules as described in claim 1, construct a gene knockout vector, and then transfer the gene knockout vector into the target tobacco. (iii) Construct a gene knockout vector comprising the gRNA molecule of any one of claims 3-4, and then transfer the gene knockout vector into the target tobacco. (iv) Transform the gene knockout vector of claim 5 into the target tobacco; (v) When the recombinant bacteria of claim 6 is Agrobacterium, the Agrobacterium is used to infect the target tobacco.
10. The method according to claim 9, characterized in that, The tobacco sugar content refers to the reducing sugar content of tobacco and / or the total sugar content of tobacco. Preferably, the target tobacco is selected from flue-cured tobacco varieties K326, RG17, TN86, Basma, China Tobacco 100, Henan Tobacco 10, Hunan Tobacco 7, Yunnan Tobacco 85, Yunnan Tobacco 87, NC89, or Honghua Dajinyuan.