Method for improving production of citrulline from escherichia coli
By knocking out specific non-essential sequences DLP12, Part4, and CP4-57 in Escherichia coli MG1655 using a genome simplification strategy, a high-yield citrulline-producing engineered strain was constructed. This solved the problem of limited citrulline yield improvement in existing technologies and achieved efficient and stable citrulline fermentation production.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HUARUI BIOTECHNOLOGY (CHUZHOU) CO LTD
- Filing Date
- 2026-01-23
- Publication Date
- 2026-05-12
AI Technical Summary
The genome of the Escherichia coli MG1655 strain in the existing technology contains a large number of non-essential large fragments, which results in limited improvement in citrulline production and cannot meet the needs of industrial production. Furthermore, the existing modification methods cannot achieve the optimal allocation of global carbon and nitrogen metabolic flux, leading to the accumulation of intermediate products and insufficient energy supply.
By systematically knocking out specific non-essential sequences DLP12, Part4, and CP4-57 in the genome of Escherichia coli MG1655 using a genome simplification strategy, a high-citrulline-producing engineered strain was constructed, optimizing intracellular resource allocation and reducing redundant metabolic consumption.
It significantly increased citrulline production to 128.66 g/L, a 27.42% increase compared to the basic strain, while maintaining stable biological characteristics of the strain, making it suitable for industrial production.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology and relates to a method for improving the production of L-citrulline by Escherichia coli. Background Technology
[0002] Citrulline is an important non-protein amino acid with unique physiological functions and chemical properties, making it widely used in food, medicine, and health products, with market demand continuously rising. In the food industry, citrulline can be added to meat products, beverages, and baked goods as a natural flavor enhancer, not only improving the umami and richness of the products but also supplementing the body with essential nitrogen nutrients, improving the nutritional value and taste of food. In the pharmaceutical field, as a key intermediate product of the urea cycle, it can effectively regulate the body's nitrogen metabolism balance, promote the detoxification and excretion of ammonia, and can be used to prepare drugs for treating hepatic encephalopathy, liver damage, hypertension, and cardiovascular diseases. It also shows good application potential in wound repair and immune regulation. In the health product field, citrulline can promote the synthesis of nitric oxide by vascular endothelial cells, dilate blood vessels, improve blood circulation, thereby enhancing exercise endurance and relieving post-exercise fatigue, making it one of the core ingredients of high-end sports nutrition supplements. With the rapid development of the global health industry, the market demand for high-purity citrulline has maintained an average annual growth rate of 8%-12%. Developing efficient, low-cost, and environmentally friendly citrulline production technologies has become the key to ensuring the sustainable development of related industries and has significant economic and social value.
[0003] Currently, the main methods for producing citrulline include chemical synthesis, enzymatic methods, and microbial fermentation. Chemical synthesis suffers from drawbacks such as demanding reaction conditions, numerous byproducts, severe environmental pollution, and low product purity, and is gradually being phased out by the market. Enzymatic production of citrulline offers advantages such as high reaction specificity and high product purity, but the enzyme preparation cost is high and its stability is poor, making large-scale industrial production difficult. Microbial fermentation, due to its advantages of wide availability of raw materials, mild reaction conditions, environmental friendliness, and ease of scale-up, has become the mainstream direction for the industrial production of citrulline.
[0004] In the research of citrulline production via microbial fermentation, strain selection and modification are crucial for increasing yield. *Escherichia coli*, as a classic model microorganism, possesses unique advantages such as a clear genetic background (a complete genome of approximately 4.6 Mb, containing 4405 coding genes, with fully resolved sequences), rapid growth and reproduction (logarithmic doubling time of only 20-30 minutes), well-defined metabolic regulation mechanisms, and ease of precise modification through genetic engineering techniques (such as CRISPR-Cas9 and Red homologous recombination). It is widely used in the fermentation production of various amino acids, including glutamic acid, lysine, and threonine, as well as organic acids and enzyme preparations. Among these, *Escherichia coli* MG1655 is a typical representative of the wild-type *Escherichia coli* K-12 strain, characterized by the absence of plasmids and resistance markers, and metabolic stability. Its genome sequence was fully resolved in 1997, and related gene manipulation tools and metabolic regulation databases are well-established. It is an ideal starting strain for constructing high-yield engineered strains and has an irreplaceable application foundation in the field of constructing high-yield amino acid strains.
[0005] In research on citrulline production via E. coli fermentation, existing technologies mainly focus on local gene modification of the citrulline synthesis pathway and its branched metabolic pathways. The core idea is to enhance citrulline accumulation by strengthening the expression of key enzymes in the synthesis pathway, blocking product degradation, or modifying the branched metabolic pathway. For example, by overexpressing key genes such as N-acetylglutamate synthase (argA), N-acetylornithine transaminase (argD), and ornithine carbamoyltransferase (argF) in the arginine synthesis pathway, the allocation of carbon and nitrogen metabolic flux to citrulline can be strengthened; or by knocking out genes such as arginine synthase (argG) and arginase (speA), the conversion of citrulline to arginine and the degradation of arginine can be blocked. However, these local modification methods still have many insurmountable shortcomings: On the one hand, modifying only a single or a few genes cannot achieve the optimal allocation of global carbon and nitrogen metabolic flux within the cell, often leading to the accumulation of intermediate products or insufficient energy supply, increasing the metabolic burden on the strain, and ultimately resulting in limited improvement in citrulline production and yield. The concentration of citrulline produced by E. coli fermentation reported in the present paper is insufficient to meet the needs of industrial production. On the other hand, the E. coli MG1655 genome contains a large number of non-essential large sequence fragments, which account for about 10%-15% of the total genome length. These fragments mainly include redundant metabolic pathway genes (such as secondary metabolite synthesis genes), transposon elements, phage residual sequences, pseudogenes, and repetitive sequences with unknown functions. The presence of these non-essential fragments will continuously consume a large amount of intracellular resources, such as nucleotides required for nucleic acid synthesis, amino acids required for protein synthesis, and ATP generated by energy metabolism. This not only occupies the metabolic load of the cell but may also interfere with the regulatory stability of core metabolic pathways, significantly affecting the synthesis efficiency of the target product. Summary of the Invention
[0006] In their research on the fermentation production of L-citrulline using *E. coli* strain MG1655 as the substrate bacteria, the inventors obtained the industrial strain SH2833 for L-citrulline production by knocking out the argG gene encoding arginine succinate synthase, the argR gene encoding the transcriptional regulator, and overexpressing the argCJBDF and lysE genes, which are related to the L-citrulline synthesis pathway and originated from *Corynebacterium glutamicum* 13032. To further improve the fermentation efficiency of this strain, we continued to explore genetic engineering modifications.
[0007] Genome simplification has become a cutting-edge strategy for microbial strain modification in recent years. Its core principle is to systematically knock out non-essential large fragments in the genome, eliminating ineffective metabolic pathways and redundant sequences, thereby reducing ineffective metabolic consumption, optimizing intracellular resource allocation efficiency, and improving strain growth performance, environmental adaptability, and the ability to synthesize target products. Existing studies have shown that genome simplification has improved the growth rate and target product yield of microorganisms such as *Bacillus subtilis* and *Saccharomyces cerevisiae*, fully validating the effectiveness of this strategy. However, the application of genome simplification strategies exhibits significant strain and product specificity. The distribution of non-essential fragments and the association of core metabolic pathways differ among different strains, requiring precise genomic functional analysis and metabolic network regulation studies for screening simplified fragments for specific products. To date, there are no reports, domestically or internationally, on applying genome simplification strategies to *Escherichia coli* strain MG1655 to improve citrulline fermentation yield. The lack of systematic screening methods for non-essential large fragments in the *E. coli* MG1655 genome in current technologies makes it difficult for existing *E. coli* fermentation technology to overcome yield bottlenecks and meet the core demands of industrial production for high-yield, high-efficiency, and low-cost citrulline production. We screened and analyzed genomic sequence fragments related to or unrelated to the L-citrulline metabolic pathway, attempting to knock out some fragments to examine their impact on citrulline biosynthesis. Fermentation experiments confirmed the presence of three sequences, DLP12 (e.g., located between genomic coordinates 564755 and 586065), in genomic coordinates. Figure 1 The sequence Part 4 (as shown in the image above) is located between genomic coordinates 3110645 and 3134692. Figure 1 (as shown in the middle figure) and sequence CP4-57 located between genomic coordinates 2755941 - 2777971 (as shown in the middle figure) and the sequence CP4-57 located between genomic coordinates 2755941 - 2777971. Figure 1 The removal of the strain (as shown in the image below) achieved a "slimming and yield-increasing" effect without affecting the biological characteristics of strain SH2833. Based on this new discovery, the present invention provides the following technical solution.
[0008] A first aspect of the present invention provides a method for improving citrulline production in *Escherichia coli*, comprising the steps of: knocking out one, two, or three of three non-essential gene sequences selected from the group consisting of *E. coli* that produce L-citrulline:
[0009] The gene sequence DLP12 (2025 NCBI accession number RefSeq: NC_000913.3 version), located between genomic coordinates 564755 and 586065, is as follows: Figure 1 As shown in the image above,
[0010] The gene sequence Part 4 (2025 NCBI accession number RefSeq: NC_000913.3 version), located between genomic coordinates 3110645 and 3134692, is as follows: Figure 1 As shown in the middle figure,
[0011] The gene sequence CP4-57 (2025 NCBI accession number RefSeq: NC_000913.3), located between genomic coordinates 2755941 and 2777971, is as follows: Figure 1 The image below is shown.
[0012] As used in this article, the term "non-essential / non-required gene sequence" refers to a sequence that does not significantly affect the normal growth of *E. coli*, i.e., a "redundant" or "meaningless" sequence fragment for the normal growth of *E. coli*. However, this does not mean that the sequence has no other biological function, so it is still commonly referred to as a "gene," "gene sequence," or "gene fragment."
[0013] Preferably, the above method involves simultaneously knocking out three gene sequences, DLP12, Part4, and CP4-57, in the Escherichia coli genome.
[0014] Furthermore, the knockout of the three gene sequences DLP12, Part4, and CP4-57 was carried out sequentially, i.e., stepwise. First, one sequence was knocked out of the base strain genome to obtain strain A; then, another sequence was knocked out of strain A's genome to obtain strain B; and finally, the third sequence was knocked out of strain B's genome to obtain strain C. Compared to strains obtained by simultaneously knocking out all three gene sequences DLP12, Part4, and CP4-57, strain C exhibits higher genetic stability.
[0015] In one embodiment, the aforementioned *Escherichia coli* is *Escherichia coli* MG1655-derived strain SH2833, which is an engineered bacterium obtained through the following genetic engineering modification: using *Escherichia coli* MG1655 as the substrate bacterium, the argG gene encoding argamine succinate synthase in the genome is knocked out; the argR gene encoding the transcription regulatory factor is knocked out; and the L-citrulline synthesis pathway-related gene clusters argCJBDF and lysE genes derived from *Corynebacterium glutamicum* 13032 are overexpressed.
[0016] Optionally, in the above method, gene editing technology is used to knock out the gene sequences DLP12, Part4 and / or CP4-57.
[0017] The gene editing technologies mentioned above can be selected from the following group: homologous double crossover, Red homologous recombination, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, MuGENT (multiplex genome editing by natural transformation), and CRISPRi. The CRISPR-Cas9 gene editing system is preferred.
[0018] A second aspect of the present invention provides a method for constructing an L-citrulline-producing bacterium, comprising the following steps:
[0019] (1) Using Escherichia coli MG1655 as the substrate bacteria, an integration system was constructed to overexpress the argCJBDF gene cluster and the lysE gene (2025 NCBI gene id: 1019244, NC_003450.3 version) targeting the Escherichia coli MG1655 genome; CRISPR-Cas9 gene editing plasmids for knocking out genes were designed and constructed targeting the argG gene (2025 NCBI gene id: 947590), the argR gene (2025 NCBI gene id: 947816NC_000913.3 version), the DLP12 sequence, the Part4 sequence, and the CP4-57 sequence, respectively.
[0020] The argCJBDF gene cluster includes five genes: argC (2025 NCBI gene id: 1019370 NC_003450.3 version), argJ (2025 NCBI gene id: 1019371 NC_003450.3 version), argB (2025 NCBI gene id: 1019372 NC_003450.3 version), argD (2025 NCBI gene id: 1019373 NC_003450.3 version), and argF (2025 NCBI gene id: 1019374 NC_003450.3 version).
[0021] (2) The argG gene knockout system and argR gene knockout system, argCJBDF gene cluster overexpression vector and lysE gene overexpression vector constructed in step (1) were sequentially introduced into Escherichia coli MG1655. Through resistance screening and genotype verification, the basic strain SH2833 with argG and argR gene deletion and argCJBDF and lysE gene overexpression was obtained. This strain SH2833 can ferment to produce L-citrulline.
[0022] (3) The CRISPR-Cas9 gene editing plasmids with knockout sequences DLP12, Part4, or CP4-57 constructed in step (1) were introduced into the basic strain SH2833. Through resistance screening and genotype verification, single knockout strains with knockout sequences DLP12, Part4, and CP4-57 were obtained respectively.
[0023] (4) Using any of the single knockout strains obtained in step (3) as the starting strain, continue to knock out the remaining two non-essential sequences. Through resistance screening and genotype verification, obtain triple knockout recombinant Escherichia coli with simultaneous knockout of sequence DLP12, sequence Part4 and sequence CP4-57.
[0024] The nucleotide sequences of the argC gene are shown in SEQ ID NO: 1, the argJ gene in SEQ ID NO: 2, the argB gene in SEQ ID NO: 3, the argD gene in SEQ ID NO: 4, the argF gene in SEQ ID NO: 5, and the lysE gene in SEQ ID NO: 6.
[0025] Furthermore, the above construction method also includes the following steps:
[0026] (5) The obtained recombinant Escherichia coli was fermented and cultured, and the yield of citrulline was detected by high performance liquid chromatography. Strains with significantly increased yield were screened.
[0027] A third aspect of the present invention provides a recombinant Escherichia coli, which is constructed by the method described above.
[0028] Preferably, the recombinant Escherichia coli does not substantially alter the original biological characteristics of the L-citrulline-producing bacteria, including cell morphology and habits, growth cycle, proliferation rate, fermentation density, and other original features.
[0029] In one embodiment, the above-mentioned recombinant Escherichia coli is constructed by the following method: using Escherichia coli MG1655 derivative SH2833 as the base bacterium / chassis bacterium, three gene sequences DLP12, Part4 and CP4-57 in the genome are knocked out.
[0030] A fourth aspect of the present invention provides the use of the above-described recombinant Escherichia coli in the fermentation production of L-citrulline.
[0031] For example, under fermentation conditions, the above-mentioned recombinant Escherichia coli is cultured in a culture medium, and L-citrulline is extracted from the fermentation broth and / or bacterial cells.
[0032] Preferably, the carbon source used in the above fermentation includes glucose.
[0033] During the fermentation process described above, the pH should be controlled between 6 and 8, with a preferred pH of around 7.0.
[0034] This invention is the first to discover that the individual deletion of three specific non-essential sequences—DLP12, Part4, and CP4-57—in the genome of the basic strain SH2833 can increase citrulline production, and their combined deletion produces an unexpected synergistic effect, indicating that the genome simplification strategy reduces the metabolic load of the cells, allowing more carbon and energy to flow to the citrulline synthesis pathway. Experiments show that the recombinant engineered strain with the simultaneous knockout of these three sequences achieved a citrulline production of 128.66 g / L during fermentation, a 27.42% increase compared to the 100.97 g / L produced by the basic strain. This invention provides a novel genetic engineering strategy for the efficient microbial fermentation production of L-citrulline. Attached Figure Description
[0035] Figure 1 The image shows the genes contained in three sequence fragments—DLP12, Part4, and CP4-57—that serve as knockout targets in the *E. coli* MG1655 genome. The top image shows the DLP12 fragment, the middle image shows the Part4 fragment, and the bottom image shows the CP4-57 fragment.
[0036] Figure 2 This image shows the PCR verification electrophoresis images at each stage of constructing a high-L-citrulline-producing recombinant Escherichia coli from wild-type Escherichia coli MG1655. Specifically: A is the argG knockout PCR verification image; B is the argR knockout PCR verification image; C is the trc-lysE integration PCR verification image; D is the trc-argCJBDF integration PCR verification image; E is the DLP12 knockout PCR verification image; G is the Part4 knockout PCR verification image; and F is the CP4-57 knockout PCR verification image.
[0037] Figure 3 The graph shows a comparison of the citrulline production of L-citrulline-producing strain SH2833 with that of each single knockout strain (SH2833-ΔDLP12, SH2833-ΔPart4, SH2833-ΔCP4-57) and the triple knockout strain (SH2833-ΔDLP12-ΔPart4-ΔCP4-57) in fermentation medium. Detailed Implementation
[0038] This invention develops a method for targeted modification of L-citrulline-producing Escherichia coli MG1655-derived strains based on the concept of genome simplification. By screening and knocking out non-essential large fragments DLP12, Part4, and / or CP4-57 that are unrelated to L-citrulline synthesis, a high-yield citrulline-producing engineered strain with low metabolic load and high product synthesis efficiency is constructed. Furthermore, the fermentation level of L-citrulline-producing strains is improved. This method has significant theoretical and practical value for overcoming the limitations of traditional metabolic engineering models for optimizing the L-citrulline biosynthetic pathway and promoting the upgrading and development of the citrulline fermentation industry.
[0039] The study found that the knockout of three non-essential large fragments, DLP12, Part4, and / or CP4-57, can be implemented individually or in more than two, such as simultaneously. According to experimental results, the combined knockout of the three fragments, DLP12, Part4, and CP4-57, was more effective than knocking out any single fragment, resulting in higher citrulline fermentation yields.
[0040] As used herein, the terms “(L-citrulline fermentation yield) increase,” “enhancement,” or “enhancement” can mean an increase of at least 10% compared to a reference level (such as a base strain / starting strain), for example, an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100%, or any increase between 10% and 100%.
[0041] In this article, the terms “(E. coli) genetically engineered bacteria,” “engineered bacteria (strain)” and “recombinant (E. coli) strain” have the same meaning and can be used interchangeably.
[0042] Correspondingly, for ease of description, L-citrulline-producing strains such as SH2833 can be referred to as the "basic strain," and Escherichia coli MG1655 can be referred to as the "wild type" or "original strain."
[0043] In the description of the technical solutions of this invention, the terms "and / or" and "and / or" used in phrases such as "A and / or B" and "A and / or B" are intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" used in phrases such as "A, B and / or C" is intended to cover each of the following embodiments: A, B and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).
[0044] In summary, the advantages of the "genome simplification" scheme of this invention are reflected in the following aspects:
[0045] 1. Innovative Strategy: For the first time, a novel "slimming and yield-increasing" strategy was developed by specifically knocking out three non-essential sequences, DLP12, Part4, and CP4-57, in the genome of a basic strain to construct a high-yield citrulline-producing strain or improve the fermentation level of existing citrulline-producing strains. This strategy differs from the traditional concept of direct metabolic pathway optimization and modification.
[0046] 2. Significant Results: Experiments have shown that, compared with the basic strain SH2833, the citrulline yield of strains with any of the aforementioned non-essential sequences knocked out was increased to some extent. Furthermore, the recombinant strain with all three sequences knocked out simultaneously showed an even more significant increase in citrulline fermentation yield, rising by 27.42%, thus improving the economics of citrulline production.
[0047] 3. Reduce metabolic burden: By knocking out non-essential genes, the energy and substrate consumption of bacteria for maintaining and replicating redundant DNA are reduced, allowing the cell to direct more metabolic flow to the synthesis pathway of the target product citrulline, thereby improving carbon source utilization efficiency and product yield.
[0048] 4. Good genetic stability: The knockout is a permanent deletion of the genome, which does not require the addition of inducing agents or the application of selection pressure. It has high genetic stability and is suitable for large-scale industrial fermentation production.
[0049] 5. Implications for universality: The successful implementation of the strategy of this invention shows that customized genome simplification of chassis cells for the production of specific metabolites is a feasible strategy that can provide new ideas for the microbial manufacturing of other high-value-added chemicals.
[0050] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.
[0051] Example
[0052] The embodiments in this article involve the addition amount, content and concentration of various substances. Unless otherwise specified, the percentage content mentioned refers to the mass percentage content.
[0053] In the embodiments described herein, unless otherwise specified, the temperature generally refers to room temperature (15-30°C).
[0054] For experimental methods where specific conditions are not specified in the examples, follow the standard conditions or the manufacturer's recommended conditions.
[0055] Materials and methods
[0056] In the following examples, the primer synthesis and sequencing were all performed by Shanghai Qingke Biotechnology Co., Ltd.
[0057] The molecular biology experiments in the examples included plasmid construction, enzyme digestion, ligation, preparation of competent cells, transformation, and culture medium preparation, etc., mainly referring to "Molecular Cloning: A Laboratory Manual" (4th Edition), edited by M.R. Green and J. Sambrook (USA), translated by He Fuchu, Science Press, Beijing, 2017. Specific experimental conditions can be determined through simple experiments if necessary.
[0058] PCR amplification experiments should be performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. Adjustments can be made through simple experiments if necessary.
[0059] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, pH 7.2 (solid medium with an additional 20 g / L agar powder).
[0060] The fermentation medium formulation is shown in Table 1.
[0061] Table 1. Fermentation medium formulation for bacterial strains
[0062] Component Content g / L Glucose 20 Yeast extract 3 <![CDATA[MgSO4 7H2O]]> 1 <![CDATA[KH2PO4]]> 13.3 <![CDATA[(NH4)2SO4]]> 15 Monosodium glutamate 3 Citric acid monohydrate 3 Sodium carbonate 3 Arginine 5 VB1 0.001 VB3 0.001 VB5 0.001 VB12 0.001 VH 0.001 VB6 0.02 <![CDATA[FeSO4·7H2O]]> 0.01 <![CDATA[CaCl2]]> 0.0135 <![CDATA[ZnSO4·7H2O]]> 0.022 <![CDATA[MnSO4·4H2O]]> 0.0058 <![CDATA[CuSO4·5H2O]]> 0.01 <![CDATA[(NH4)6Mo7O 24 ·4H2O]]> 0.001 <![CDATA[Na2B4O7·H2O]]> 0.002
[0063] Method for determining L-citrulline content:
[0064] Preparation of the derivatizing agent: 0.1372g phthalaldehyde + 0.0589g N-acetyl-L-cysteine + 2ml anhydrous ethanol, sonicated for 1min until dissolved, then borate buffer to 10ml (volume flask).
[0065] Preparation of borate buffer solution: Weigh 6.183g of borate powder, add 250ml of distilled water, and sonicate until dissolved. Then adjust the pH to 9.5 with 6mol NaOH solution and filter for later use.
[0066] HPLC detection conditions: Agilent 1260II instrument; SB-C18 column; UV detector wavelength: 334 nm; 0-6 minutes: 70% sodium acetate (2.871 g anhydrous) + 700 ml water (adjusted pH 6.6-6.8 with acetic acid) and 30% methanol; 7-15 minutes: 55% sodium acetate (2.871 g anhydrous) + 700 ml water (adjusted pH 6.6-6.8 with acetic acid) and 45% methanol; 15-20 minutes: 70% sodium acetate (2.871 g anhydrous) + 700 ml water (adjusted pH 6.6-6.8 with acetic acid) and 30% methanol; flow rate: 1 mL / min; injection volume: 5 μL; column temperature: 40℃. Citrulline standards were dissolved in ddH2O, with concentrations ranging from 0.05 g / L to 1 g / L. The prepared standard solutions and sample solutions were analyzed by HPLC, and the peak areas were recorded. The citrulline content was calculated using the external standard method.
[0067] The CRISPR-Cas9 gene editing plasmid constructed in this embodiment and the L-citrulline-producing strain SH2833 used are preserved by Huarui Biotechnology (Chuzhou) Co., Ltd. Any unit or individual may obtain this plasmid for verification of this invention, but it may not be used for other purposes, including development, scientific research and teaching, without the permission of Huarui Biotechnology (Chuzhou) Co., Ltd.
[0068] Some of the PCR primers used in the examples are listed in Table 2.
[0069] Table 2. Some PCR primers used in the examples
[0070] Primer name Primer sequence sg-argG-F TAGTccgtggtatttacgaagctc sg-argG-R AAACgagcttcgtaaataccacgg argG-UF tgaaccgacgatcttcgggttatg argG-UR gtatcagtgatatccaggttacgcagcgataccaatacgttgacctac argG-DF gtaggtcaacgtattggtatcgctgcgtaacctggatatcactgatac argG-DR cgtgaccctacgaagaagaacgtc argG-CF AGCAACGGTGATGGGATCTTCAAC argG-CR TCAGACTTTCTGGCTAAGCTCGC sg-argR-F TAGTgctcgcctgctggactcact sg-argR-R AAACagtgagtccagcaggcgagc argR-UF ctggccaataccgccagcagc argR-UR gtcagaaacgacggggcagaggagaaacatgcctgcgtcacgg argR-DF ccgtgacgcaggcatgtttctcctctgccccgtcgtttctgac argR-DR cttacggatacggtcccgattgc argR-CF tggctcagatcgacagccacac argR-CR gtgtcaccgctacgagcttcag sg-trpR-F TAGTattgtcgaagagctgttgcg sg-trpR-R AAACcgcaacagctcttcgacaat trpR-UF gcctggaatccgaaagtgaaatcac trpR-UR GTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAAGTGCGGATCAGTAACGACGtcc trpR-DF aaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatTTATCCGTCCTACAAATACCCG trpR-DR gccctttggcagtgaggaaacg trpR-CF ctatgcgatggcgattgctcgtc trpR-CR ggatcctgccatattgcatccgttg lysE-UF GTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGGTGATCATGGAAATCTTCATTAc lysE-UR CACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGCTAACCCATCAACATCAGTTTGATG sg-yghX-F TAGTacttaagccgtcaggtgcca sg-yghX-R AAACtggcacctgacggcttaagt yghX-UF cgttaacgtgaccgaaattgtgcc yghX-UR GTGTGAAATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCaagctcatctttgcgggcttcac yghX-DF CTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATcggaactggacacccgaatcaac yghX-DR gatcaattttcgaggcgataaccg yghX-CF gatcgcacgctgtgattccagc yghX-CR tgcgatcgatgcgccatttacc argCJBDF-UF GTGAGCGGATAACAATTTCACACAGGAAACAGACcatgatcatgcataacgtgtatggtg argCJBDF-UR CAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGttacctcggctggttggccag sg-DLP12-F TAGTacgttgagtcatgaacacgt sg-DLP12-R AAACacgtgttcatgactcaacgt DLP12-UF accgcattgcggtatcaacgc DLP12-UR caagccattgcgaggccttagcagatggaacatcaacgcctgc DLP12-DF ggcgttgatgttccatctgctaaggcctcgcaatggcttgcaag DLP12-DR ctggaatctgcgaattgtcgccag DLP12-CF ttcttgattcagacgcgcagcgg DLP12-CR atcgcttgtcatagccgtacaccg sg-Part4-F TAGTcggtattgatgaacgccacg sg-Part4-R AAACcgtggcgttcatcaataccg Part4-UF cgtcgatgatggcagacttcagc Part4-UR ccagtggctgattggcatcgtgtcagtgctgctgagaagcctg Part4-DF gcttctcagcagcactgacacgatgccaatcagccactggaac Part4-DR tctgatacctccgcgaagctagcg Part4-CF ttacggcgatgatcttcgcctgc part4-CR tacgagccgttaagcgtgagtcag sg-CP4-57-F TAGTacagtagtcaggcaaatcag sg-CP4-57-R AAACctgatttgcctgactactgt CP4-57-UF ttgttagtggcgtgtccgtccg CP4-57-UR gcatcggccagagtgatacctaacagagtaagcccgtcaccgtc CP4-57-DF gtgacgggcttactctgttaggtatcactctggccgatgcagtc CP4-57-DR gtatagccatagtgccggtgtgg CP4-57-CF cctagcctccgctcttaggacg CP4-57-CR tggaagttgagccgtggctgaag
[0071] Note: The suffix "-F" in primer names indicates forward direction; "-R" indicates reverse direction.
[0072] It should be noted that, for the sake of convenience, in the embodiments, the strain number, plasmid number, enzyme number, and enzyme-encoding gene number may share the same number. This is easily understood by those skilled in the art, that is, the same number can refer to different biological forms in different environments.
[0073] Example 1: Search for non-essential sequences for citrulline biosynthesis in the genome of Escherichia coli MG1655
[0074] The genome sequences of different *E. coli* strains were obtained from public databases such as EcoCyc and NCBI. The specific coordinates of three non-essential sequences from SH2833 were determined through genome alignment (using NCBI accession number RefSeq: NC_000913.3 in 2025 as a reference; genome LOCUS: NC_000913; length: 4641652 bp; DNA circular CON 09-DEC-2025).
[0075] Sequence DLP12: 564755 – 586065;
[0076] Sequence Part 4: 3110645 – 3134692;
[0077] Sequence CP4-57: 2755941 – 2777971.
[0078] The genes contained in the three sequences are as follows Figure 1 As shown.
[0079] Example 2: Construction of Citrulline-producing strain SH2833
[0080] The construction of the basic strain SH2833 includes the following steps.
[0081] 1. Construction of strain mg1655-ΔargG
[0082] The argG fragment was knocked out using CRISPR-Cas9.
[0083] The constructed plasmid pCassac containing the Cas9 protein was transformed into mg1655 competent cells via electroporation and plated on Kana-resistant plates. The cells were incubated overnight at 37°C for 18 h. Single colonies were selected and inoculated into liquid LB containing Kana, and incubated at 37°C and 220 rpm for 18 h. A 1% (v / v) inoculum was then transferred to fresh LB, along with 10 g / L arabinose. The cells were incubated at 37°C for 1.5–2 h until OD (Organic Demand) was reached. 600 When the pH reaches 0.6-0.8, collect the bacteria to prepare electrocompetent cells. The electrocompetent cells need to be washed twice with 10% sterile glycerol, then resuspended in 10% glycerol, and stored at -80℃ for later use.
[0084] After self-annealing, primers sg-argG-F and sg-argG-R were ligated to the Bsa I-digested sgRNA expression plasmid pTarget using T4 ligase to obtain the argG-sgRNA plasmid. Using E. coli mg1655 as a template, the upstream homologous fragment argG-Udonor was amplified by PCR using primers argG-UF and argG-UR, and the downstream homologous fragment argG-Ddonor was amplified by PCR using primers argG-DF and argG-DR. Then, overlap extension PCR was performed using primers argG-UF and argG-DR to obtain argG-donor.
[0085] Add the argG-donor and argG-sgRNA plasmid fragments to competent cells, gently pipette to mix, and incubate on ice for 20 min. Then, transfer the mixture to a 1 mm electroporation cuvette (pre-chilled on ice), electroporate at 1.8 kV for 5 ms, and add 800 μL of pre-chilled LB broth. After recovery at 37°C and 220 rpm for 1 h on a shaker, plate the mixture onto LB agar plates containing the appropriate antibiotics and incubate at 37°C for 24 h.
[0086] Colony PCR was performed using primers argG-CF / argG-CR to verify the bacterial culture and screen for positive transformants, resulting in strain mg1655-ΔargG.
[0087] 2. Construction of strain mg1655-ΔargG-ΔargR
[0088] The argR fragment was knocked out using CRISPR-Cas9.
[0089] The constructed plasmid pCassac containing the Cas9 protein was transformed into mg1655-ΔargG competent cells via electroporation. The cells were plated on Kana-resistant plates and incubated overnight at 37°C for 18 h. Single colonies were selected and inoculated into Kana-containing liquid LB agar, and incubated at 37°C and 220 rpm for 18 h. A 1% (v / v) inoculum was then transferred to fresh LB agar, along with 10 g / L arabinose. The cells were incubated at 37°C for 1.5–2 h until OD (digestive growth) was observed. 600 When the pH reaches 0.6-0.8, collect the bacteria to prepare electrocompetent cells. The electrocompetent cells need to be washed twice with 10% sterile glycerol, then resuspended in 10% glycerol, and stored at -80℃ for later use.
[0090] After self-annealing, primers sg-argR-F and sg-argR-R were ligated to the Bsa I-digested sgRNA expression plasmid pTarget using T4 ligase to obtain the argR-sgRNA plasmid. Using E. coli mg1655 as a template, the upstream homologous fragment argR-Udonor was amplified by PCR using primers argR-UF and argR-UR, and the downstream homologous fragment argR-Ddonor was amplified by PCR using primers argR-DF and argR-DR. Then, overlap extension PCR was performed using primers argR-UF and argR-DR to obtain argR-donor.
[0091] Add the argR-donor and argR-sgRNA plasmids to competent cells, gently pipette to mix, and incubate on ice for 20 min. Then, transfer the mixture to a 1 mm electroporation cuvette (pre-chilled on ice), electroporate at 1.8 kV for 5 ms, and add 800 μL of pre-chilled LB broth. After recovery at 37°C and 220 rpm for 1 h on a shaker, plate the mixture onto LB agar plates containing the appropriate antibiotics and incubate at 37°C for 24 h.
[0092] Colony PCR was performed using primers argR-CF / argR-CR to verify the bacterial culture and screen for positive transformants, resulting in strain mg1655-ΔargG-ΔargR.
[0093] 3. Construction of strain mg1655-ΔargG-ΔargR-ΔtrpR::trc-lysE
[0094] Ptrc-lysE was integrated using CRISPR-Cas9.
[0095] The constructed plasmid pCassac containing the Cas9 protein was transformed into mg1655-ΔargG-ΔargR competent cells via electroporation. The cells were plated on Kana-resistant plates and incubated overnight at 37°C for 18 h. Single colonies were selected and inoculated into Kana-containing liquid LB agar, and incubated at 37°C and 220 rpm for 18 h. A 1% (v / v) inoculum was then transferred to fresh LB agar, along with 10 g / L arabinose. The cells were incubated at 37°C for 1.5–2 h until OD (Organic Demand) was reached. 600 When the pH reaches 0.6-0.8, collect the bacteria to prepare electrocompetent cells. The electrocompetent cells need to be washed twice with 10% sterile glycerol, then resuspended in 10% glycerol, and stored at -80℃ for later use.
[0096] After self-annealing, primers sg-trpR-F and sg-trpR-R were ligated to the sgRNA expression plasmid pTarget, which had been digested with Bsa I, using T4 ligase to obtain the trpR-sgRNA plasmid. Using *E. coli* mg1655 as a template, the upstream homologous fragment *trpR-Udonor* was amplified by PCR using primers *trpR-UF* and *trpR-UR*, and the downstream homologous fragment *trpR-Ddonor* was amplified by PCR using primers *trpR-DF* and *trpR-DR*. Using *Corynebacterium glutamicum* 13032 as a template, the upstream homologous fragment *trc-lysE-donor* was amplified by PCR using primers *lysE-UF* and *lysE-UR*. Then, overlap extension PCR was performed on the upstream homologous fragment *trpR-Udonor*, the downstream homologous fragments *trpR-Ddonor*, and the *trc-lysE-donor* fragment using primers *trpR-UF* and *trpR-DR* to obtain *trpR-trc-lysE-donor*.
[0097] The trpR-trc-lysE-donor and trpR-sgRNA plasmids were added to competent cells, gently pipetted to mix, and incubated on ice for 20 min. The mixture was then transferred to a 1 mm electroporation cuvette (pre-chilled on ice), electroporated at 1.8 kV for 5 ms, and 800 μL of pre-chilled LB broth was added. After recovery at 37°C and 220 rpm for 1 h, the mixture was plated onto LB agar plates containing the appropriate antibiotics and incubated at 37°C for 24 h.
[0098] Colony PCR was performed using primers trpR-CF / trpR-CR to verify the bacterial culture and screen for positive transformants, resulting in strain mg1655-ΔargG-ΔargR-ΔtrpR::trc-lysE.
[0099] 4. Construction of strain mg1655-ΔargG-ΔargR-ΔtrpR::trc-lysE-ΔyghX::trc-argCJBDF
[0100] Ptrc-argCJBDF was integrated using CRISPR-Cas9.
[0101] The constructed plasmid pCassac containing the Cas9 protein was transformed into competent mg1655-ΔargG-ΔargR-ΔtrpR::trc-lysE cells via electroporation. The cells were plated on Kana-resistant plates and incubated overnight at 37°C for 18 h. Single colonies were selected and inoculated into liquid LB containing Kana, and incubated at 37°C and 220 rpm for 18 h. A 1% (v / v) inoculum was then transferred to fresh LB, along with 10 g / L arabinose. The cells were incubated at 37°C for 1.5–2 h until OD (digestive growth) was observed.600 When the pH reaches 0.6-0.8, collect the bacteria to prepare electrocompetent cells. The electrocompetent cells need to be washed twice with 10% sterile glycerol, then resuspended in 10% glycerol, and stored at -80℃ for later use.
[0102] After self-annealing, primers sg-yghX-F and sg-yghX-R were ligated to the sgRNA expression plasmid pTarget, which had been digested with Bsa I, using T4 ligase to obtain the yghX-sgRNA plasmid. Using *E. coli* mg1655 as a template, the upstream homologous fragment yghX-Udonor was amplified by PCR using primers yghX-UF and yghX-UR, and the downstream homologous fragment yghX-Ddonor was amplified by PCR using primers yghX-DF and yghX-DR. Using *Corynebacterium glutamicum* 13032 as a template, the upstream homologous fragment trc-argCJBDF-Udonor was amplified by PCR using primers argCJBDF-UF and argCJBDF-UR. Then, the upstream homologous fragment yghX-Udonor, the downstream homologous fragments yghX-Ddonor and trc-argCJBDF-Udonor were extended by PCR using primers yghX-UF and yghX-DR to obtain the yghX-trc-argCJBDF donor.
[0103] The yghX-trc-argCJBDF-donor and yghX-sgRNA plasmid were added to competent cells, gently pipetted to mix, and incubated on ice for 20 min. The mixture was then transferred to a 1 mm electroporation cuvette (pre-chilled on ice), electroporated at 1.8 kV for 5 ms, and 800 μL of pre-chilled LB broth was added. After recovery at 37°C and 220 rpm for 1 h, the culture was spread onto LB agar plates containing the appropriate antibiotics and incubated at 37°C for 24 h.
[0104] Colony PCR was performed using primers yghX-CF / yghX-CR to verify the bacterial culture and screen for positive transformants. The resulting strain was mg1655-ΔargG-ΔargR-ΔtrpR::trc-lysE-ΔyghX::trc-argCJBDF, which was named SH2833.
[0105] Example 3: Stepwise construction of strains with three non-essential fragment deletions
[0106] 1. Construction of strain SH2833-ΔDLP12
[0107] The DLP12 fragment was knocked out using CRISPR-Cas9.
[0108] The constructed plasmid pCassac containing the Cas9 protein was transformed into SH2833 competent cells via electroporation and plated on Kana-resistant plates. The cells were incubated overnight at 37°C for 18 h. Single colonies were selected and inoculated into liquid LB containing Kana, and incubated at 37°C and 220 rpm for 18 h. A 1% (v / v) inoculum was then transferred to fresh LB, along with 10 g / L arabinose. The cells were incubated at 37°C for 1.5–2 h until OD (digestive growth) was observed. 600 When the pH reaches 0.6-0.8, collect the bacteria to prepare electrocompetent cells. The electrocompetent cells need to be washed twice with 10% sterile glycerol, then resuspended in 10% glycerol, and stored at -80℃ for later use.
[0109] After self-annealing, primers sg-DLP12-F and sg-DLP12-R were ligated to the Bsa I-digested sgRNA expression plasmid pTarget using T4 ligase to obtain the DLP12-sgRNA plasmid. Using E. coli mg1655 as a template, the upstream homologous fragment DLP12-Udonor was amplified by PCR using primers DLP12-UF and DLP12-UR, and the downstream homologous fragment DLP12-Ddonor was amplified by PCR using primers DLP12-DF and DLP12-DR. Then, overlap extension PCR was performed using primers DLP12-UF and DLP12-DR to obtain DLP12-donor.
[0110] Add the DLP12-donor and DLP12-sgRNA plasmid fragments to competent cells, gently pipette to mix, and incubate on ice for 20 min. Then, transfer the mixture to a 1 mm electroporation cuvette (pre-chilled on ice), electroporate at 1.8 kV for 5 ms, and add 800 μL of pre-chilled LB broth. After recovery at 37°C and 220 rpm for 1 h on a shaker, plate the mixture onto LB agar plates containing the appropriate antibiotics and incubate at 37°C for 24 h.
[0111] Colony PCR was performed using primers DLP12-CF / DLP12-CR to verify the bacterial culture and screen for positive transformants, resulting in the single-fragment knockout strain SH2833-ΔDLP12.
[0112] 2. Construction of strain SH2833-ΔPart4
[0113] CRISPR-Cas9 was used to knock out fragment Part4.
[0114] The constructed plasmid pCassac containing the Cas9 protein was transformed into SH2833 competent cells via electroporation and plated on Kana-resistant plates. The cells were incubated overnight at 37°C for 18 h. Single colonies were selected and inoculated into liquid LB containing Kana, and incubated at 37°C and 220 rpm for 18 h. A 1% (v / v) inoculum was then transferred to fresh LB, along with 10 g / L arabinose. The cells were incubated at 37°C for 1.5–2 h until OD (digestive growth) was observed. 600 When the pH reaches 0.6-0.8, collect the bacteria to prepare electrocompetent cells. The electrocompetent cells need to be washed twice with 10% sterile glycerol, then resuspended in 10% glycerol, and stored at -80℃ for later use.
[0115] After self-annealing, primers sg-Part4-F and sg-Part4-R were ligated to the Bsa I-digested sgRNA expression plasmid pTarget using T4 ligase to obtain the Part4-sgRNA plasmid. Using E. coli mg1655 as a template, the upstream homologous fragment Part4-Udonor was amplified by PCR using primers Part4-UF and Part4-UR, and the downstream homologous fragment Part4-Ddonor was amplified by PCR using primers Part4-DF and Part4-DR. Then, the upstream homologous fragment Part4-Udonor and the downstream homologous fragment Part4-Ddonor were extended by overlap PCR using primers Part4-UF and Part4-DR to obtain Part4-donor.
[0116] Add the homologous fragments Part4-donor and Part4-sgRNA plasmid to competent cells, gently pipette to mix, and incubate on ice for 20 min. Then, transfer the mixture to a 1 mm electroporation cuvette (pre-chilled on ice), electroporate at 1.8 kV for 5 ms, and add 800 μL of pre-chilled LB broth. After recovery at 37°C and 220 rpm for 1 h on a shaker, plate the mixture onto LB agar plates containing the appropriate antibiotics and incubate at 37°C for 24 h.
[0117] Colony PCR was performed using primers Part4-CF / Part4-CR to verify the bacterial culture and screen for positive transformants, resulting in the single-fragment knockout strain SH2833-ΔPart4.
[0118] 3. Construction of strain SH2833-ΔCP4-57
[0119] The CP4-57 fragment was knocked out using CRISPR-Cas9.
[0120] The constructed plasmid pCassac containing the Cas9 protein was transformed into SH2833 competent cells via electroporation and plated on Kana-resistant plates. The cells were incubated overnight at 37°C for 18 h. Single colonies were selected and inoculated into liquid LB containing Kana, and incubated at 37°C and 220 rpm for 18 h. A 1% (v / v) inoculum was then transferred to fresh LB, along with 10 g / L arabinose. The cells were incubated at 37°C for 1.5–2 h until OD (digestive growth) was observed. 600 When the pH reaches 0.6-0.8, collect the bacteria to prepare electrocompetent cells. The electrocompetent cells need to be washed twice with 10% sterile glycerol, then resuspended in 10% glycerol, and stored at -80℃ for later use.
[0121] After self-annealing, primers sg-CP4-57-F and sg-CP4-57-R were ligated into the Bsa I-digested sgRNA expression plasmid pTarget using T4 ligase to obtain the CP4-57-sgRNA plasmid. Using E. coli mg1655 as a template, the upstream homologous fragment CP4-57-Udonor was amplified by PCR using primers CP4-57-UF and CP4-57-UR, and the downstream homologous fragment CP4-57-Ddonor was amplified by PCR using primers CP4-57-DF and CP4-57-DR. Then, CP4-57-donor was obtained by overlap extension PCR using primers CP4-57-UF and CP4-57-DR.
[0122] Add the homologous fragments CP4-57-donor and CP4-57-sgRNA plasmid to competent cells, gently pipette to mix, and incubate on ice for 20 min. Then, transfer the mixture to a 1 mm electroporation cuvette (pre-chilled on ice), electroporate at 2.5 kV for 5.9 ms, and add 800 μL of pre-chilled LB broth. After recovery at 37°C and 220 rpm for 1 h on a shaker, plate the mixture onto LB agar plates containing the appropriate antibiotics and incubate at 37°C for 24 h.
[0123] Colony PCR was performed using primers CP4-57-CF / CP4-57-CR to verify the bacterial culture and screen for positive transformants, resulting in the single-fragment knockout strain SH2833-ΔCP4-57.
[0124] 4. Construction of three-fragment knockout recombinant strains
[0125] Repeat steps 2-3, starting with SH2833-ΔDLP12, and knock out sequence Part4 and sequence CP4-57 in sequence to finally obtain a three-fragment knockout recombinant strain, named SH2833-ΔDLP12-ΔPart4-ΔCP4-57.
[0126] Figure 2 The images show electrophoretic detection images of strains overexpressing genes argCJBDF and lysE identified by PCR, as well as electrophoretic detection images of gene knockout sequences argG, argR, DLP12, Part4, and CP4-57.
[0127] Example 4: Fermentation experiment and citrulline yield determination
[0128] Strains SH2833, SH2833-ΔDLP12, SH2833-ΔPart4, SH2833-ΔCP4-57 and SH2833-ΔDLP12-ΔPart4-ΔCP4-57 were fermented in a 5L fermenter (Shanghai Baoxing).
[0129] Streak the above-mentioned strains on a plate and incubate at 37°C in a constant temperature incubator for about 18 hours; pick 2-3 single clones into 5ml LB tubes and incubate at 37°C with shaking at 230rpm for 8 hours; inoculate into 100mL / 500mL LB flasks at a 5% v / v inoculation rate and incubate at 37°C with shaking at 230rpm for 16-18 hours; inoculate into 2L / 5L fermenters at a 5% v / v inoculation rate.
[0130] The pH of the fermenter was adjusted to 7.0 with ammonia water, the initial stirring was 400 rpm, the aeration rate was 2L / min, and the dissolved oxygen was controlled at 20-25%; the fermentation temperature was set to 30℃; after the initial sugar was exhausted, feeding was started, and the residual sugar was controlled at 0.4-0.8g / L.
[0131] Fermentation was carried out in a fermenter for 64 hours, and the fermentation broth was collected for citrulline content detection.
[0132] Take 1 mL of fermentation broth, centrifuge at 12000 rpm for 10 min, take the supernatant and dilute it appropriately, then filter it through a membrane, and detect the citrulline content by HPLC. See 3 for the results.
[0133] The results showed that the citrulline fermentation level of the basic strain SH2833 was 100.97 g / L. The fermentation levels of the single-fragment knockout strains SH2833-ΔDLP12, SH2833-ΔPart4, and SH2833-ΔCP4-57 were increased by approximately 9%, 5%, and 11.7%, respectively. The fermentation level of the three-fragment knockout strain SH2833-ΔDLP12-ΔPart4-ΔCP4-57 reached 128.66 g / L, an increase of 27.42%.
[0134] The specific embodiments of the present invention have been described above, but the scope of protection of the present invention is not limited to the specific embodiments described above. Those skilled in the art can make various changes or modifications within the scope of the claims, which do not affect the substantive content of the present invention.
Claims
1. A method for improving the production of citrulline by *Escherichia coli*, characterized in that, This includes the following steps: knocking out one, two, or three of the following three sequences from the genome of *E. coli* that produce L-citrulline: The sequence DLP12 is located between genomic coordinates 564755 and 586065 (2025 NCBI accession number RefSeq: NC_000913.3). Sequence Part 4 (2025 NCBI accession number RefSeq:NC_000913.3) located between genomic coordinates 3110645 and 3134692. The sequence CP4-57 is located between genomic coordinates 2755941 and 2777971 (2025 NCBI accession number RefSeq:NC_000913.3).
2. The method according to claim 1, characterized in that, Simultaneously, three gene sequences, DLP12, Part4, and CP4-57, were knocked out from the E. coli genome.
3. The method according to claim 1, characterized in that, The *Escherichia coli* strain mentioned is *Escherichia coli* MG1655 derivative SH2833, which is an engineered strain obtained through the following genetic engineering modifications: using *Escherichia coli* MG1655 as the substrate strain, the argG gene encoding arginine succinate synthase in the genome was knocked out; the argR gene encoding the transcription regulatory factor was knocked out; and the L-citrulline synthesis pathway-related gene clusters argCJBDF and lysE genes derived from *Corynebacterium glutamicum* 13032 were overexpressed.
4. The method according to claim 1, characterized in that, Gene editing technology is used to knock out the gene sequence DLP12, Part4, or CP4-57.
5. The method according to claim 4, characterized in that, The gene editing technology is selected from the following group: homologous double crossover, Red homologous recombination, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, MuGENT, CRISPRi, with CRISPR-Cas9 gene editing system preferred.
6. A method for constructing an L-citrulline-producing bacterium, characterized in that, Includes the following steps: (1) Using Escherichia coli MG1655 as the substrate bacteria, an integration system was constructed targeting the Escherichia coli MG1655 genome, overexpressing the argCJBDF gene cluster and the lysE gene (2025 NCBI gene id: 1019244, NC_003450.3 version, nucleotide sequence as shown in SEQ ID NO: 6); CRISPR-Cas9 gene editing plasmids for knocking out genes were designed and constructed targeting the argG gene (2025 NCBI gene id: 947590 NC_000913.3 version), the argR gene (2025 NCBI gene id: 947816 NC_000913.3 version), the DLP12 sequence, the Part4 sequence, and the CP4-57 sequence, respectively. The argCJBDF gene cluster includes five genes: argC (2025 NCBI gene id: 1019370 NC_003450.3, nucleotide sequence as shown in SEQ ID NO: 1), argJ (2025 NCBI gene id: 1019371 NC_003450.3, nucleotide sequence as shown in SEQ ID NO: 2), argB (2025 NCBI gene id: 1019372 NC_003450.3, nucleotide sequence as shown in SEQ ID NO: 3), argD (2025 NCBI gene id: 1019373 NC_003450.3, nucleotide sequence as shown in SEQ ID NO: 4), and argF (2025 NCBI gene id: 1019374 NC_003450.3, nucleotide sequence as shown in SEQ ID NO: 5). (2) The argG gene knockout system and argR gene knockout system, argCJBDF gene cluster overexpression vector and lysE gene overexpression vector constructed in step (1) were sequentially introduced into Escherichia coli MG1655. Through resistance screening and genotype verification, the basic strain SH2833 with argG and argR gene deletion and argCJBDF and lysE gene overexpression was obtained. (3) The CRISPR-Cas9 gene editing plasmids with knockout sequences DLP12, Part4, or CP4-57 constructed in step (1) were introduced into the basic strain SH2833. Through resistance screening and genotype verification, single knockout strains with knockout sequences DLP12, Part4, and CP4-57 were obtained respectively. (4) Using any single knockout strain obtained in step (3) as the starting strain, continue to knock out the remaining two sequences. Through resistance screening and genotype verification, obtain triple knockout recombinant Escherichia coli with simultaneous knockout of sequence DLP12, sequence Part4 and sequence CP4-57.
7. A recombinant Escherichia coli, characterized in that, It is constructed by the method of any one of claims 1-6.
8. The recombinant Escherichia coli according to claim 7, characterized in that, The recombinant Escherichia coli was constructed using the following method: using Escherichia coli MG1655 derivative SH2833 as the base / chassis bacterium, and knocking out three sequences DLP12, Part4 and CP4-57 in the genome.
9. Use of the recombinant Escherichia coli of claim 7 in the fermentation production of L-citrulline.
10. The use according to claim 9, characterized in that, Under fermentation conditions, the recombinant Escherichia coli of claim 8 is cultured in a culture medium, and L-citrulline is extracted from the fermentation broth and / or bacterial cells.