Application of tobacco NtWRKY6 gene, encoding protein, vector and host cell

By cloning and expressing the tobacco NtWRKY6 gene or protein, and utilizing the transcription factor NtWRKY6 to regulate the expression of key genes in polyphenol synthesis, the problem of unclear regulation of polyphenol synthesis in tobacco has been solved, achieving effective regulation of polyphenol content and improving the aroma and quality of tobacco products.

CN122012572APending Publication Date: 2026-05-12CHINA TOBACCO HUNAN IND CORP
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
CHINA TOBACCO HUNAN IND CORP
Filing Date
2024-11-11
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

In the prior art, the involvement of ABA-induced WRKY6 in the regulation of polyphenol synthesis in tobacco is unclear, which affects the synthesis of polyphenols and tobacco quality.

Method used

By cloning and expressing the tobacco NtWRKY6 gene or protein, the transcription factor NtWRKY6 can be used to regulate the expression of key genes in polyphenol synthesis, thereby promoting or inhibiting the increase or decrease of polyphenol content. Overexpression vectors or gene editing vectors can be used to regulate polyphenol content in tobacco.

Benefits of technology

It achieves effective regulation of tobacco polyphenol content, promotes or reduces polyphenol synthesis accumulation, and enhances the aroma and quality of tobacco products.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012572A_ABST
    Figure CN122012572A_ABST
Patent Text Reader

Abstract

The invention discloses applications of a tobacco NtWRKY6 gene, a coding protein, a vector and a host cell. It is found for the first time that NtWRKY6 promotes synthesis and accumulation of tobacco polyphenols through NtPAL and NtWRKY41. A genetic material of which the expression level and the polyphenol content of related genes synthesized by polyphenols are remarkably increased due to over expression of the NtWRKY6 gene is obtained by utilizing a transgenic technology. A genetic material with the polyphenol content remarkably reduced due to NtWRKY6 function deletion is obtained by using a gene editing technology. And a new way is provided for regulating and controlling beneficial metabolites of tobacco and obtaining a new variety.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically, it relates to the application of the tobacco NtWRKY6 gene, its encoded protein vector, and host cells in regulating polyphenol synthesis. Background Technology

[0002] Polyphenols in tobacco are important aroma precursors in tobacco leaves, significantly influencing leaf color, cigarette aroma, and smoke quality, and are a crucial indicator of tobacco quality. Polyphenol content is also positively correlated with the grade of tobacco products; higher-grade tobacco leaves have higher polyphenol content, while lower-grade tobacco leaves have lower content. Under appropriate processing and aging conditions, polyphenolic compounds undergo a series of reactions to degrade into a series of degradation products, which impart an elegant aroma to tobacco products, increasing the aroma intensity and playing a vital role in improving tobacco product quality.

[0003] Tobacco contains various phenolic substances, mainly polyphenolic compounds such as chlorogenic acid, rutin, and hyoscyamine, with trace amounts of simple phenols. The content of polyphenols varies considerably among different types of tobacco, with flue-cured tobacco having the highest content, reaching up to 7%, while sun-cured tobacco has a very low content, around 0.5%. The total amounts of chlorogenic acid, hyoscyamine, rutin, and polyphenols in flue-cured tobacco leaves differ significantly between different aroma-producing regions. The polyphenol content varies considerably among different genotypes of flue-cured tobacco varieties. While the total polyphenol content of the same genotype variety in the same region does not vary much from year to year, different genotype varieties in the same region exhibit certain differences in polyphenol content. Genetic factors are the main reason for the differences in polyphenol content in flue-cured tobacco leaves among different genotype varieties. Variety, as a genetic factor, directly affects the polyphenol content of flue-cured tobacco. Differences in the content and composition of polyphenols among different genotypes of flue-cured tobacco varieties can be inherited by offspring; genotypes with high polyphenol content will also have offspring with high polyphenol content. Because different tobacco varieties have different genotypes, their polyphenol metabolism-related enzyme activities and gene expression levels also differ, resulting in variations in polyphenol levels. The greater the genotypic difference between varieties, the greater the difference in polyphenol content. Therefore, variety largely determines the metabolism and content of polyphenols in tobacco leaves.

[0004] Polyphenols in plants are synthesized via the phenylpropanoid pathway, which begins with the aromatic amino acid phenylalanine produced by the shikimate pathway. Phenylalanine is then catalyzed by phenylalanine ammonia-lyase (PAL), cinnamate 4-hydroxylase (C4H), and p-coumaroyl coenzyme A ligase (4CL) to produce p-coumaroyl coA. Coumaric acid-co-A is a common precursor for the synthesis of various polyphenols. For example, chalcone synthase (CHS) catalyzes the formation of naringenin chalcone from one coumaric acid-co-A and three manolyl-CoA, which is the first step in the flavonoid biosynthesis pathway, subsequently producing flavonols, anthocyanins, and proanthocyanidins. Chlorogenic acid (CGA) in plants is also synthesized via the phenylpropane metabolic pathway, which may have three pathways. Pathways 1 and 2 both require coumaric acid-co-A as a substrate. In most Solanaceae plants, CGA is synthesized via pathway 1, where p-coumaric acid coenzyme A is catalyzed by hydroxycinnamoyl-CoAshikimate / quinate hydroxycinnamoyl transferase (HCT) to produce p-coumarylshikimate, which is further catalyzed by p-coumarate 3'-hydroxlase (C3H) and HCT to synthesize caffeoyl coenzyme A. Caffeoyl coenzyme A and quinic acid condense via hydroxycinnamoyl-CoA quinate hydroxycinnamoyl transferase (HQT) to produce CGA. Simultaneously, caffeoyl-CoA O-methyltransferase (CCoAOMT) can further catalyze the production of feruloyl-CoA from caffeoyl-CoA, a crucial precursor in the synthesis of 6'-hydroxyferruloyl-CoA catalyzed by feruloyl-CoA 6'-hydroxylase 1 (F6'H1). Hyoscyamine derivatives are generated through the isomerization and lactone formation of 6'-hydroxyferruloyl-CoA.

[0005] The phenylpropanoid biosynthesis pathway in plants is precisely regulated by a variety of transcription factors, including MYB, bHLH, WD40, ERF, and WRKY. For example, NtWRKY41 has been shown to regulate the synthesis of phenylpropanoid compounds such as chlorogenic acid, lignin, and flavonoids in tobacco. The expression of the WRKY6 gene is induced by ABA and also participates in regulating downstream ABA signal transduction. Exogenous ABA application can significantly induce the synthesis of polyphenols in plants, but whether ABA-induced WRKY6 participates in regulating polyphenol synthesis in plants remains unclear.

[0006] This invention demonstrates through a series of experiments that tobacco NtWRKY6 regulates the synthesis of polyphenols in tobacco leaves through NtPAL and NtWRKY41, and therefore a patent application is filed for protection. Summary of the Invention

[0007] The primary objective of this invention is to provide the application of the tobacco NtWRKY6 gene or protein in regulating plant polyphenol synthesis, wherein the NtWRKY6 gene sequence is shown in SEQ ID NO.1; and the NtWRKY6 protein sequence is shown in SEQ ID NO.2.

[0008] Furthermore, the plant mentioned includes tobacco. Specifically, it promotes or inhibits the accumulation of tobacco polyphenols.

[0009] Furthermore, overexpression of the tobacco NtWRKY6 gene or protein leads to increased polyphenol content; while inhibition of the expression of the tobacco NtWRKY6 gene or protein leads to decreased polyphenol content.

[0010] A second objective of this invention is to provide an overexpression vector containing the tobacco NtWRKY6 gene, a gene editing vector containing a gene that inhibits the tobacco NtWRKY6 gene (e.g., a CRISPR / Cas9 editing vector), or the application of the host cell of the vector in regulating plant polyphenol synthesis, wherein the NtWRKY6 gene sequence is shown in SEQ ID NO.1.

[0011] Furthermore, the plant mentioned includes tobacco. Specifically, it promotes or inhibits the accumulation of tobacco polyphenols.

[0012] Furthermore, the overexpression vector leads to an increase in polyphenol content. The gene editing vector leads to a decrease in polyphenol content.

[0013] A third object of the present invention is to provide the use of the aforementioned vector, or host cell, in the preparation of transgenic plants, particularly tobacco.

[0014] The transcription factor protein NtWRKY6, which effectively regulates the synthesis of tobacco polyphenols, discovered in this invention belongs to the field of plant genetic engineering. This gene is derived from cultivated tobacco. The NtWRKY6 gene sequence is shown in SEQ ID NO.1 (italicized base sequences are gene exons, bolded bases are gene editing target sequences, and underlined sequences are sequences amplified during Hi-TOM assays to identify mutants), and the amino acid sequence is shown in SEQ ID NO.2.

[0015] The tobacco NtWRKY6 gene is 2,461 bp in length and contains 6 exons and 5 introns. Figure 1 A, 1B). The coding region is 1,497 bp in length, encoding 498 amino acids (SEQ ID NO.2). Phylogenetic analysis revealed that this gene clusters with NtomWRKY6 from Nicotiana fluff, NsylWRKY6 from Nicotiana scabra, CaWRKY6 from Capsicum annuum, and AtWRKY6 from Arabidopsis thaliana. Figure 1 C), and possesses typical WRKY family conservative functional domains ( Figure 1 (D), hence it was named NtWRKY6.

[0016] This invention is the first to discover that the transcription factor NtWRKY6 can promote the synthesis and accumulation of tobacco polyphenols by regulating the expression of key genes involved in polyphenol synthesis.

[0017] Genetic material with increased polyphenol content due to NtWRKY6 gene overexpression was obtained using transgenic technology. Genetic material with decreased polyphenol content due to NtWRKY6 gene loss of function was obtained using gene editing technology. This provides a new approach for regulating beneficial metabolites in tobacco cultivation and obtaining new varieties. Attached Figure Description

[0018] Figure 1 Cloning and sequence analysis of the tobacco NtWRKY6 gene; (A) Cloning of the full-length sequence of the tobacco WRKY6 gene and CDS; (B) Intron / exon structure of the tobacco WRKY6 gene; black boxes indicate exons, horizontal lines indicate introns, and numbers indicate the size (bp) of exons or introns; (C) Evolutionary analysis of tobacco WRKY6 with other plant homologous proteins; (D) Comparison of amino acid sequences of tobacco WRKY6 with other plant homologous proteins.

[0019] Figure 2Expression pattern and subcellular localization analysis of NtWRKY6 in tobacco; (A) Expression level analysis of NtWRKY6 gene in different tissues of tobacco; (B) Expression level analysis of NtWRKY6 in different floral organs. The expression level is the average of three independent replicates. The significance of differences between samples was detected by Tukey's test and expressed as letters; (C) Subcellular localization analysis of NtWRKY6-GFP fusion protein in tobacco protoplasts.

[0020] Figure 3 Identification of NtWRKY6 overexpression and gene-edited materials. (A) Expression levels of the NtWRKY6 gene in different transgenic lines. Expression levels are the average of three independent replicates. The Student t-test was used to detect the significant differences between each line and the wild type. ** indicates extremely significant differences (p<0.01); (B) Sequence differences of the NtWRKY6 gene in gene-edited mutants; (C) Differences in the protein encoded by the NtWRKY6 gene in gene-edited mutants.

[0021] Figure 4 NtWRKY6 promotes the synthesis of polyphenols in tobacco. (A) Polyphenol content in leaves of wild-type, NtWRKY6-overexpressing, and ntwrky6 mutant tobacco. (B) Polyphenol content in roots of wild-type, NtWRKY6-overexpressing, and ntwrky6 mutant tobacco. Content data are the mean of three independent replicates. The significance of differences between samples was detected using Tukey's test and is expressed as letters.

[0022] Figure 5 NtWRKY6 promotes the expression of multiple tobacco polyphenol synthesis-related genes. (A) Expression levels of polyphenol synthesis-related genes in wild-type, NtWRKY6-overexpressed, and ntwrky6 mutants; (B, C) ChIP analysis revealed that NtWRKY6 can directly bind to the promoter fragment of the NtPAL gene; (D, E) ChIP analysis revealed that NtWRKY6 can directly bind to the promoter fragment of the NtWRKY41 gene.

[0023] Figure 6NtWRKY6 directly regulates the expression of NtPAL and NtWRKY41 genes. (A) Yeast one-hybrid assays showed that NtWRKY6 directly binds to the promoter fragments of NtPAL and NtWRKY41 genes; (B) Post-translational activation of NtWRKY6-GR protein significantly promoted the expression of NtPAL and NtWRKY41 genes. Expression levels are the average of three independent replicates. The significance of differences between samples was detected using Tukey's test and is expressed in letters; (C, D) Dual-LUC assays showed that NtWRKY6 promotes the expression of NtPAL and NtWRKY41 genes in tobacco. Signal values ​​are the average of three independent replicates. The significance of differences between treatments and controls was detected using Student's t-test, with ** indicating highly significant differences (p<0.01).

[0024] Figure 7 NtWRKY6 regulates polyphenol synthesis in tobacco through NtPAL and NtWRKY41. (A) Expression levels of NtWRKY6, NtPAL, and NtWRKY41 genes in different materials; (B) Polyphenol content determination in different materials. Values ​​are the average of three independent replicates. The significance of differences between samples was detected using Tukey's test and is expressed as letters. Detailed Implementation

[0025] The following implementation rules are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the examples are performed under conventional experimental conditions, such as those described in Sambrook et al.'s Molecular Cloning: A Laboratory Manual (Sambrook J & Russell DW, 2001), or as recommended in the manufacturer's instructions.

[0026] Example 1: Cloning and sequence analysis of the tobacco WRKY6 gene

[0027] 1. Cloning of the Tobacco WRKY6 Gene

[0028] Immediately after harvesting tobacco seedlings, they were flash-frozen in liquid nitrogen and thoroughly ground in liquid nitrogen. Total RNA was extracted from tobacco leaves using a rapid RNA extraction kit (Gene Answer, RT0110), strictly following the kit's instructions. During extraction, DNase I (Omega, #E1091-01) was added to digest and remove genomic DNA interference. The extracted RNA samples were first tested for integrity using agarose gel electrophoresis, and then the concentration was determined using Nanodrop. Quality samples were selected as templates for first-strand cDNA synthesis. Reverse transcription was performed using the PrimeScript™ II 1st Strand cDNA Synthesis Kit (TAKARA, 6210A). The resulting cDNA samples were then used for gene cloning or gene expression level analysis after concentration determination. Tobacco genomic DNA was extracted using a novel rapid plant genomic DNA extraction kit (Imagene, DE117), strictly following the kit's instructions.

[0029] To clone the WRKY6 gene from tobacco, the gene and protein sequences of Arabidopsis thaliana AtWRKY6 (AT1G62300) were first searched in the Chinese Tobacco Genome Database V4.0. The tobacco gene with the highest homology to the Arabidopsis gene was found to be Ntab0931830. Based on the gene sequence in the database, specific primers NtWRKY6-F: ATGGACAAAGCTGGATGGGG and NtWRKY6-R: CTACTGTTCTTTTTGAGAAC were designed. Subsequently, PCR amplification was performed using tobacco genomic DNA and cDNA as templates, and the results were analyzed by agarose gel electrophoresis. Figure 1 A) The target fragment was recovered using the AxyPrep DNA Gel Extraction Kit (Axygen, AP-GX-250G). The ligation system was prepared as follows: DNA fragment 0.1–0.3 pmol, pMDTM18-T Vector (Takara) 1 μl, Solution I 5 μl, dd-H2O up to 10 μl. The ligation reaction was carried out overnight at 16°C. The ligation product was added to competent E. coli cells, heat-shock transformed, and positive clones were selected for sequencing. Plasmids were extracted from correctly sequenced positive clones and stored at -20°C for subsequent vector construction.

[0030] 2. Tobacco WRKY6 gene sequence analysis

[0031] Homologous WRKY6 genes were obtained from tetraploid cultivated tobacco (Nicotiana tabacum) and its diploid ancestors, *Nicotiana sylvestris* and *Nicotiana tomentosiformis*, through sequencing. The exon and intron structures of these three WRKY6 genes were determined using DNAMAN software, and their CDS sequences were then translated into amino acid sequences for phylogenetic analysis with homologous proteins from species such as pepper and Arabidopsis thaliana. In constructing the phylogenetic tree, Clustal X was first used to align the amino acid sequences of tobacco WRKY6 with homologous proteins from Arabidopsis thaliana, pepper, and rice, followed by phylogenetic analysis using the Neighbor Joining algorithm in Mega 5 software. The analysis revealed that the three WRKY6 proteins in tobacco are closely related to CaWRKY6 in pepper and AtWRKY6 in Arabidopsis thaliana, while the cultivated tobacco NtWRKY6 is more closely related to NtomWRKY6 in the diploid ancestor *Nicotiana tomentosiformis*. Figure 1 C), indicating that it may originate from the fluffy tobacco plant. Simultaneously, sequence alignment analysis revealed that three tobacco WRKY6 proteins possess typical WRKY family domains (C). Figure 1 D).

[0032] Example 2: Expression pattern and subcellular localization analysis of NtWRKY6 in tobacco

[0033] Tissue samples from tobacco roots, stems, leaves, axillary buds, flower buds, flowers, capsules, and seeds were collected during the peak flowering period and immediately flash-frozen in liquid nitrogen. Total RNA was extracted from each tissue using a tobacco RNA rapid extraction kit (Gene Answer, RT0110). cDNA samples were obtained from each tissue using a PrimeScript™ II 1st Strand cDNA Synthesis Kit (TAKARA, 6210A). After determining the concentration of cDNA samples using Nanodrop, the expression level of the NtWRKY6 gene was quantitatively detected by qPCR. The results are as follows: Figure 2 As shown in Figure A, the expression level of the NtWRKY6 gene was high in tobacco flowers and capsule seeds, followed by the expression level in roots, stems, leaves, and seeds, and the lowest expression level in axillary buds and flower buds. Subsequently, the expression level of the NtWRKY6 gene in different parts of the floral organs was examined, and it was found that the expression level of this gene in the stamen was significantly higher than that in the pistil, calyx, and other parts. Figure 2(B) suggests that this gene may be related to the development of tobacco stamens. The primers used for quantitative PCR were: qNtWRKY6-F: GCTTTTCAGGTTCCATGCCAA and qNtWRKY6-R: TGTCCGCGCTATGAAATTCG; the internal control primers were NtL25-F: CAAAAGTTACATTCCACCG and NtL25-R: TTTCTTCGTCCCATCAGGC.

[0034] The full-length coding region sequence of NtWRKY6 without a terminator was ligated into the pCAMBIA1300 plasmid to form a 35S:NtWRKY6-GFP fusion expression vector. The fusion plasmid was propagated and collected in *E. coli*, and the target plasmid was introduced into tobacco protoplasts using a polyethylene glycol (PEG)-mediated method. The fluorescence signal was detected using a confocal laser scanning microscope (LEICA STELLARIS5, Germany). The results showed that the fluorescence signal of the NtWRKY6-GFP fusion protein completely matched the signal location of the nuclear localization protein RFP. Figure 2 (C) indicates that the NtWRKY6 protein is located in the cell nucleus and may exert transcription factor regulatory activity.

[0035] Example 3: Construction and transformation of NtWRKY6 gene overexpression and gene editing vector

[0036] Based on the sequence information obtained from sequencing, specific primers containing restriction enzyme sites were designed to amplify the full-length CDS sequence of the NtWRKY6 gene. The primer pairs used for overexpression vector construction were: NtWRKY6-OE-F: ATACACCAAATTGACTCTAGAATGGACAAAGCTGGATGGGG and NtWRKY6-OE-R: GCCCTTGCTCACCATGGTACCCTGTTCTTTTTGAGAACCAG. The amplified product was double-digested and ligated into the pCAMBIA1301 vector (HonorGene) to form a recombinant 35S:NtWRKY6-GFP plasmid. This plasmid was transformed into competent *E. coli* cells, and after sequencing identification, positive clones were selected for plasmid extraction. The plasmid was then transformed into competent *Agrobacterium* cells for tobacco transgenic applications. For gene editing vector construction, specific sgRNA primers were designed: NtWRKY6-F: ATTGGATGCCAGTGGAGAAAATA and NtWRKY6-R: AAACTATTTTCTCCACTGGCATC. After primer annealing, the primers were ligated into the pHSE401 vector (BioVector NTCC). Following sequencing verification, the plasmid was extracted and transformed into Agrobacterium for tobacco transformation. Tobacco transformation was performed using the leaf disc method. After obtaining positive seedlings, the expression level of the NtWRKY6 gene in each overexpression line was detected using quantitative real-time PCR. Five independent transgenic lines with significantly elevated NtWRKY6 gene expression levels were obtained. Figure 3 A). Gene-edited lines were identified using high-throughput detection and sequencing with Hi-tom library construction. Analysis revealed two homozygous edited lines, with the loss of one and two A bases, respectively. Figure 3 B), the loss of these bases led to premature termination of the NtWRKY6 gene encoding in both mutant lines. Figure 3 C), which may cause NtWRKY6 to lose its regulatory activity.

[0037] Example 4: Determination of Tobacco Polyphenol Content

[0038] The content of polyphenols in tobacco tissue was accurately determined by ultra-high performance liquid chromatography-triple quadrupole tandem mass spectrometry. The specific operation was as follows: 50 mg of tobacco leaf sample was taken, transferred to 1.5 mL of ethanol-water extract (internal standard: vitexin 75 ng / mL), sonicated at room temperature for 1 h, and then centrifuged at 14000 rpm to collect the supernatant for analysis. The analytical conditions used were as follows: Chromatographic conditions: BEH Phenyl column (2.1 × 150 mm, 1.7 μm); mobile phase: 0.1% formic acid in water (A) and 0.1% formic acid in methanol (B); elution gradient: B phase increased from 5% to 15% within 0-2 min, B phase remained at 15% within 2-10 min, and B phase increased to 100% within 10.01-15 min; flow rate: 0.3 mL / min; column temperature: 35℃; injection volume: 1 μl; Mass spectrometry conditions: electrospray ionization source; capillary voltage: 4 kV; nebulizer gas pressure: 40 psi; drying gas flow rate: 12 L / min; drying gas temperature: 290℃; sheath gas flow rate: 11 L / min; sheath gas temperature: 200℃; real-time multiple reaction monitoring (dMRM) mode was used for scanning. The results showed that the polyphenol content (including chlorogenic acid, rutin, and hyoscyamine) in the leaves of the three NtWRKY6 overexpression lines was significantly increased by 45.2%, 18.5%, and 77.2% compared to the wild-type control, respectively, while the polyphenol content in the leaves of the two ntwrky6 mutant lines was significantly decreased by 25.1% and 30.7% compared to the wild-type control, respectively. Figure 4 A). Similarly, it was found that the polyphenol content in the roots of the three NtWRKY6 overexpressing lines was significantly higher than that in the wild-type control by 44.2%, 39.7%, and 64.1%, respectively, while the polyphenol content in the roots of the two ntwrky6 mutant lines was significantly lower than that in the wild-type control by 19.8% and 29.1%, respectively. Figure 4 B). These results indicate that NtWRKY6 can promote the synthesis and accumulation of polyphenols in tobacco.

[0039] Example 5: Transcriptome Sequencing and Data Analysis

[0040] Total RNA was extracted from tobacco leaf tissues using Trizol reagent (Invitrogen). After quality assessment, sequencing libraries were constructed using the Illumina TruSeq RNA Sample PreKit. Sequencing was performed using the Illumina Hiseq 2500 sequencing platform, and the quality of mRNA sequence reads was assessed using the FastQC method (http: / / www.bioinformatics.bbsrc.ac.uk / projects / FastQC / ). Low-quality (<20) bases at the 5' and 3' ends and adapter sequences were removed using Trimmomatic (v0.30). The reference genome for cultivated tobacco was obtained from ftp: / / ftp.solgenomics.net / genomes / Nicotiana_tabacum / , and the reads were mapped to this genome using HISAT2 (v2.1.0). Gene expression levels were calculated using Cufflinks (v2.2.1), and differentially expressed genes (DEGs) with log2 ratios ≥1.0 or ≤-1.0 (FDR<0.05) were identified using Cuffdiff software. The results showed that the expression levels of NtPAL, NtHCT, Nt4CLL10, NtGT3, NtCCR1, and NtWRKY41 genes were significantly upregulated in the NtWRKY6 overexpression line (Table 1).

[0041]

[0042] The transcriptome sequencing results were then validated using real-time quantitative PCR. The results showed that the expression levels of NtPAL, NtHCT, Nt4CLL10, NtGT3, NtCCR1, and NtWRKY41 genes in the NtWRKY6 overexpression lines were significantly higher than those in the wild-type control; conversely, the expression levels of these genes in the ntwrky6 mutant were significantly lower than those in the wild-type control. Figure 5 A).

[0043] Example 6: Chromatin Immunoprecipitation (ChIP)

[0044] Chromatin immunoprecipitation (ChIP) experiments were performed using the EpiQuik Chromatin Immunoprecipitation (ChIP) Kit (Epigentek, New York, USA). Tobacco seedlings were fixed with 1.0% formaldehyde for 10 minutes under vacuum impregnation conditions, followed by cross-linking with glycine solution (final concentration 0.125 mg) under vacuum impregnation and cooling for 5 minutes. The tissues were ground into a fine powder in liquid nitrogen and dissolved using the dissolution buffer provided in the kit. The nuclei of the granules were centrifuged, resuspended, and their DNA was cleaved by sonication. The length of the cleaved DNA should be between 200-1000 bp. The granule nucleus solution was then added to strip wells containing reverse GFP (Abcam, ab290) to pull down the NtWRKY6-GFP fusion protein bound to its putative target DNA fragment. The collected DNA fragments were then reverse-engineered and purified for subsequent library construction, sequencing, and qRT-PCR analysis. After sequencing, annotation analysis was performed on the enriched peaks, and the results showed that the promoter fragments of the NtPAL (Nitab4.5_0005320g0020) and NtWRKY41 (Nitab4.5_0002944g0100) genes were significantly enriched. Figure 5 B and 5D). ChIP-PCR results further confirmed that the promoter fragments upstream of the ATG in the NtPAL and NtWRKY41 genes were significantly enriched (B and 5D). Figure 5 (C and 5E) indicates that NtWRKY6 can directly bind to the promoter regions of the NtPAL and NtWRKY41 genes in tobacco.

[0045] Example 7: Yeast One-Hybrid Analysis

[0046] The full-length CDS sequence of NtWRKY6 was ligated into the pJG4 vector, and the promoter fragments of the NtPAL and NtWRKY41 genes were ligated into the pLacZi2u vector. Using Clotech's small-scale transformation method, the recombinant pJG4-5 and pLacZi2u vectors were co-transformed into the EGY48 yeast strain. The yeast strains were plated on SC / -Trp-Ura medium and incubated at 30°C for 3-4 days. Positive clones were selected and spotted on SD / Gal / Raf / X-Gal–Trp / –Ura medium, and photographed after incubation at 30°C for 5-7 days. Figure 6 As shown in Figure A, yeast colonies co-transformed with NtWRKY6 and NtPAL or NtWRKY41 promoters exhibit a distinct blue color, indicating that NtWRKY6 can bind to NtPAL and NtWRKY41 gene promoter fragments.

[0047] Example 8: Activation analysis of NtWRKY6-GR fusion protein

[0048] Three-week-old tobacco 35S:NtWRKY6-GR seedlings were transferred to 1 / 2 MS medium containing DMSO (dimethyl sulfoxide, Mock), 10 μM DEX (dexamethasone), 5 μM CYC (cyclohexylamide), or 10 μM DEX + 5 μM CYC for 4 h. Seedlings were immediately collected for gene expression analysis. The results showed that exogenous DEX activation of the NtWRKY6-GR fusion protein significantly increased the expression levels of both NtPAL and NtWRKY41 genes. Furthermore, even in the presence of the protein synthesis inhibitor CYC, DEX application still upregulated the expression of these two genes. Figure 6 (B) indicates that the promoting effect of NtWRKY6 on the expression of both does not require the participation of intermediate protein synthesis, and may be a direct regulatory effect.

[0049] Example 9: Dual-luc transcriptional activation analysis

[0050] The promoter fragments of the NtPAL and NtWRKY41 genes were cloned into pGreenII 0800-LUC to construct a fusion reporter vector. The full-length CDS of the NtWRKY6 gene was ligated into the pGreenII 62-SK vector to form an effector vector. The reporter and effector vectors were introduced into Agrobacterium strain GV3101 (pSoup-p19). Agrobacterium was suspended in 10 mL of osmotic medium (10 mM MgCl2, 0.5 μM acetylsyleugenone, 10 mmol / L 2-N-morpholine ethanol sulfonic acid / MES) to OD600≈0.2 and incubated at room temperature for 2 hours. The Agrobacterium mixture containing the reporter and effector vectors was co-injected into the abaxial surface of Tobacco Benzoinus tobacco leaves. Three days later, the leaves were treated with 1 M D-luciferin (Sigma, L9504) and kept in the dark for 5 minutes to extinguish the fluorescence. Images of luciferase (LUC) activity were captured using a CCD imaging device. Results are shown below. Figure 6 As shown in C and 6D, co-transformation with NtWRKY6 and NtPAL or NtWRKY41 promoter-driven reporter vectors significantly increased the intensity of LUC signaling. These results further demonstrate the regulatory role of NtWRKY6 in the expression of NtPAL and NtWRKY41 genes.

[0051] Example 10: Virus-induced gene silencing (VIGS) in tobacco

[0052] A 400bp coding region fragment containing the key structural domains of NtPAL or NtWRKY41 was amplified and cloned into the pTRV2 vector. The correctly sequenced recombinant plasmid was transformed into Agrobacterium tumefaciens strain GV3101 and then injected into the leaves of 4-week-old Tobacco Benzoinium seedlings. Agrobacterium containing the pTRV2 and pTRV2-PDS vectors were used as negative and positive controls, respectively. The injected tobacco seedlings were placed in darkness overnight and then grown under normal conditions for 10 days. Agrobacterium containing the 35S:NtWRKY6-GFP plasmid was injected into the 3rd and 4th leaves above the injected leaves. The injected seedlings were placed in darkness overnight and then grown under normal conditions for 5 days. Leaves were then collected to detect gene expression levels and polyphenol content. The results showed that transient overexpression of NtWRKY6 promoted the expression of NtPAL and NtWRKY41 genes and the synthesis of polyphenols in tobacco leaves. However, silencing the NtPAL or NtWRKY41 gene using VIGS significantly inhibited the induction of polyphenol synthesis by NtWRKY6. Figure 7 (A and 7B). These results indicate that the promoting effect of NtWRKY6 on polyphenol synthesis in tobacco depends on the activities of NtPAL and NtWRKY41.

[0053] In summary, this invention reveals that NtWRKY6 can recognize and bind to the promoter fragments of the NtPAL and NtWRKY41 genes, promoting the expression of these two genes and thereby promoting the synthesis and accumulation of polyphenols in tobacco. Therefore, this invention confirms that NtWRKY6 can regulate the content of polyphenols in tobacco.

[0054]

[0055]

Claims

1. The application of the tobacco NtWRKY6 gene or protein in regulating plant polyphenol synthesis, wherein the NtWRKY6 gene sequence is shown in SEQ ID NO.1; and the NtWRKY6 protein sequence is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, The plants mentioned include tobacco.

3. The application according to claim 1 or 2, characterized in that, Specifically, it promotes or inhibits the accumulation of tobacco polyphenols.

4. The application according to claim 3, characterized in that, Overexpression of the tobacco NtWRKY6 gene or protein leads to increased polyphenol content; inhibition of the expression of the tobacco NtWRKY6 gene or protein leads to decreased polyphenol content.

5. The application of an overexpression vector containing the tobacco NtWRKY6 gene, a gene editing vector containing an inhibitory vector for the tobacco NtWRKY6 gene, or the host cell of the vector thereof in regulating plant polyphenol synthesis, wherein the NtWRKY6 gene sequence is shown in SEQ ID NO.

1.

6. The application according to claim 5, characterized in that, The plants mentioned include tobacco.

7. The application according to claim 5 or 6, characterized in that, Specifically, it promotes or inhibits the accumulation of tobacco polyphenols.

8. The application according to claim 5, 6, or 7, characterized in that, The overexpression vector resulted in an increase in polyphenol content.

9. The application according to claim 5, 6, or 7, characterized in that, The gene-editing vector resulted in a decrease in polyphenol content.

10. The use of the vector or host cell according to claim 5 in the preparation of transgenic plants, particularly tobacco.