Creation and application of ZmRap2.7 regulatory region edition-based corn early flowering yield-preserving material

By editing the transcriptional regulatory elements of the maize ZmRap2.7 gene, the problem of premature flowering and reduced yield was solved, enabling maize to flower early without reducing yield, thus adapting to the growth needs of high-latitude and high-altitude regions.

CN122012587APending Publication Date: 2026-05-12CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610216039.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-14
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing technologies make it difficult to produce corn that flowers early without reducing yield; early flowering leads to a decrease in corn yield.

Method used

Gene editing of transcriptional regulatory elements of the ZmRap2.7 gene in maize, including the Vgt1 enhancer and the ZmRap2.7 promoter, was performed using the CRISPR/Cas system. Specific operations included deleting certain nucleotides and inserting adenine deoxyribonucleotides into the Vgt1 enhancer, or inserting guanine deoxyribonucleotides and deleting other nucleotides into the ZmRap2.7 promoter, to regulate the flowering period of maize.

Benefits of technology

It achieves early flowering without reduced yield, shortens the flowering period without reducing yield, adapts to the growth needs of high latitude and high altitude regions, and avoids high temperature, drought or disease stress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention belongs to the technical field of genetic engineering, particularly relates to creation and application of a ZmRap2.7 regulatory region edition-based corn early blossoming and yield conservation material, and more particularly relates to a method for regulating and controlling corn early blossoming and yield conservation, a biological material used by the method and application of the biological material. The technical problem to be solved by the invention is how to prepare the corn with early flowering and yield conservation. In order to solve the technical problem, the invention provides a method for preparing the corn with the early blossoming and yield keeping functions, the method comprises a step of performing gene editing on a transcription regulation element of a ZmRap2.7 gene in target corn to obtain the corn with the early blossoming and yield keeping functions, and the transcription regulation element comprises a Vgt1 enhancer or / and a ZmRap2.7 promoter. According to the application, the expression of the ZmRap2.7 gene is specifically regulated and controlled by precisely regulating and controlling the Vgt1 enhancer or the ZmRap2.7 promoter, and the goal of early flowering and yield conservation in agricultural production is achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of genetic engineering technology, specifically relating to the creation and application of maize early flowering and yield protection materials based on ZmRap2.7 regulatory region editing. More specifically, this application relates to a method for regulating early flowering and yield protection in maize, the biological materials used, and their applications. Background Technology

[0002] Maize (Zea mays ssp. mays) is one of the most widely cultivated crops in the world. Flowering time is a key trait determining maize's adaptability; appropriately early flowering helps maize adapt to the shorter growing season in high-latitude, high-altitude regions, promoting its spread from its low-latitude, low-altitude origins to higher latitude, high-altitude areas. However, changes in flowering time can impact yield. Early-flowering materials typically shorten the growing season, reducing dry matter accumulation time and leading to significantly lower yields.

[0003] Vegetative to generative transition 1 (Vgt1) is the first maize flowering QTL to be cloned, located in a 2kb interval approximately 70kb upstream of ZmRap2.7.

[0004] The flowering period of maize refers to the number of days from sowing to the shedding of pollen from the tassel. Pollen shedding occurs when half or more of the anthers of the main tassel emerge, indicating flowering on that day. Shortening the flowering period of maize can advance its reproductive growth cycle and shorten its overall growth cycle. This is beneficial for selectively mitigating climate risks (such as summer heat and drought stress, and rainy season diseases) and can also increase the multiple cropping index and resource efficiency. However, in practice, advancing the flowering period of maize often leads to reduced yield. Therefore, developing early-flowering, high-yield maize varieties that advance the flowering period without reducing yield has significant industrial value. Summary of the Invention

[0005] The technical problem this application aims to solve is: how to prepare maize that flowers early and maintains yield. To solve this technical problem, this application provides the following technical solution:

[0006] This application provides a method for preparing early-flowering and yield-preserving maize, the method comprising the step of gene editing the transcriptional regulatory element of the ZmRap2.7 gene in the target maize to obtain early-flowering and yield-preserving maize, wherein the transcriptional regulatory element includes a Vgt1 enhancer and / or a ZmRap2.7 promoter, the nucleotide sequence of the Vgt1 enhancer is as shown in SEQ ID NO:5 or has more than 70% identity with SEQ ID NO:5 and has the same function, and the nucleotide sequence of the ZmRap2.7 promoter is as shown in SEQ ID NO:4 or has more than 70% identity with SEQ ID NO:4 and has the same function.

[0007] In this application, the flowering period of the early-flowering, yield-preserving corn is shorter than that of the target corn, and its yield is not lower than that of the target corn.

[0008] In this application, the flowering period of maize refers to the number of days from sowing to the shedding of pollen from the tassel. The shedding of pollen from the tassel means that when half or more of the anthers of the main tassel of the maize are exposed, it can be considered that the tassel is flowering on that day.

[0009] The early flowering and yield protection described in this application are comparisons made under comparable conditions. "Comparable conditions" refer to the same or similar environmental conditions and agronomic practices used to make meaningful comparisons between two or more maize genotypes, such that neither the environmental conditions nor the agronomic practices significantly promote or explain any differences observed between the two or more maize genotypes. Environmental conditions include, for example, light, temperature, water, humidity, soil, and nutrients (e.g., nitrogen and phosphorus).

[0010] This application also provides a method for shortening the flowering period of maize while maintaining the yield, the method comprising the step of gene editing the transcriptional regulatory element of the ZmRap2.7 gene in the recipient maize to shorten the flowering period of the recipient maize while maintaining the yield, the transcriptional regulatory element comprising the Vgt1 enhancer and / or the ZmRap2.7 promoter mentioned above.

[0011] Furthermore, the method includes the step of performing at least one of the following gene edits on the Vgt1 enhancer to obtain the early-flowering and yield-preserving maize: A1) Provide a CRISPR / Cas genome editing system, the CRISPR / Cas genome editing system including a gene for a guide RNA targeting the Vgt1 enhancer and a gene for an RNA-directed nuclease; introduce the CRISPR / Cas genome editing system into the target maize, so that the CRISPR / Cas genome editing system transcribes the guide RNA and expresses the RNA-directed nuclease in the target maize, thereby achieving gene editing of the Vgt1 enhancer; A2) Delete the nucleotides (ACGT) at positions 702 to 705 of SEQ ID NO:5 in the genome of the target maize and insert an adenine deoxyribonucleotide (A) between positions 985 and 986 of SEQ ID NO:5.

[0012] In this application, the target site of the guide RNA targeting the Vgt1 enhancer is the reverse complementary sequence of positions 700 to 718 of SEQ ID NO:5 and / or positions 970 to 988 of SEQ ID NO:5.

[0013] Furthermore, the method also includes the step of performing at least one of the following gene edits on the ZmRap2.7 promoter to obtain the early-flowering and yield-preserving maize: B1) Provide a CRISPR / Cas genome editing system, the CRISPR / Cas genome editing system comprising a gene for a guide RNA targeting the ZmRap2.7 promoter and a gene for an RNA-directed nuclease; introduce the CRISPR / Cas genome editing system into the target maize, causing the CRISPR / Cas genome editing system to transcribe the guide RNA and express the RNA-directed nuclease in the target maize, thereby achieving gene editing of the ZmRap2.7 promoter; B2) Perform any of the following mutations on the genome sequence of the recipient maize: B2-1) Insert a guanine deoxynucleotide (G) between positions 2261 and 2262 of SEQ ID NO:4 in the maize genome and delete nucleotides from positions 2566 to 2582 and from position 2584 of SEQ ID NO:4; B2-2) Insert a guanine deoxynucleotide (G) between positions 2261 and 2262 of SEQ ID NO:4 in the maize genome, delete nucleotides from positions 2573 to 2581 of SEQ ID NO:4, and insert a guanine deoxynucleotide (G) between positions 2583 and 2584.

[0014] In this application, the target site of the guide RNA targeting the ZmRap2.7 promoter is the reverse complementary sequence of positions 2258 to 2276 of SEQ ID NO:4 or / and the reverse complementary sequence of positions 2573 to 2591 of SEQ ID NO:4.

[0015] This application also provides early-flowering, yield-preserving maize obtained by the above method.

[0016] In one embodiment, the early-flowering and yield-preserving maize is a gene-edited maize obtained by deleting nucleotides (ACGT) at positions 702 to 705 of SEQ ID NO:5 in the genome of the target maize and inserting an adenine deoxyribonucleotide (A) between positions 985 and 986 of SEQ ID NO:5.

[0017] In another embodiment, the early-flowering and yield-preserving maize is a gene-edited maize obtained by inserting a guanine deoxynucleotide (G) between positions 2261 and 2262 of SEQ ID NO:4 in the maize genome and deleting nucleotides from positions 2566 to 2582 and 2584 of SEQ ID NO:4.

[0018] In another embodiment, the early-flowering and yield-preserving maize is a gene-edited maize obtained by inserting a guanine deoxynucleotide (G) between positions 2261 and 2262 of SEQ ID NO:4 in the maize genome, deleting nucleotides from positions 2573 to 2581 of SEQ ID NO:4, and inserting a guanine deoxynucleotide (G) between positions 2583 and 2584.

[0019] The gene-edited corn refers to the whole corn plant or a part of it (cells, tissues and / or organs).

[0020] The cells include original knockout cells (T0 generation cells), cells regenerated or developed from T0 generation cells, cells from any progeny or descendant of T0, including seed or embryo cells, or cultured cells, callus cells, etc.

[0021] The tissues and / or organs may be original knockout T0 generation, meristematic tissues regenerated or developed from T0 generation, bud organs / structures (e.g., leaves, stems, or nodes), roots, flowers or floral organs / structures (e.g., flowers, bracts, sepals, petals, stamens, carpels, anthers, and ovules), seeds (e.g., embryos, endosperm, and seed coats), fruits (e.g., mature ovaries), propagules, or other plant tissues (e.g., vascular tissue, dermal tissue, ground tissue). The tissues and / or organs may also be tissues and / or organs from any progeny or descendant of T0.

[0022] This application also provides biomaterials related to the above-described Vgt1 enhancer editing, said biomaterials being at least one of the following: C1) Guide RNA for the CRISPR / Cas genome editing system that targets the Vgt1 enhancer; C2) Transcription of the guide RNA described in C1) is a transcribed DNA molecule; C3) A recombinant vector containing the transcribed DNA molecule described in C2 and an expression cassette for the effector protein (RNA-directed nuclease) of the CRISPR / Cas genome editing system; C3) Recombinant microorganisms containing the recombinant vector described in C2; C4), transcription of C1) of the plant as the guide RNA; C5), plants containing the DNA molecules described in C2); C6), plants containing the recombinant vector described in C3); C7) and plants containing the recombinant microorganisms described in C4).

[0023] This application also provides biological materials related to the ZmRap2.7 promoter editing described above, wherein the biological materials are at least one of the following: D1) The guide RNA of the CRISPR / Cas genome editing system that targets the ZmRap2.7 promoter; D2) Transcription of the guide RNA described in D1) is a transcribed DNA molecule; D3), ​​a recombinant vector containing the transcribed DNA molecule described in D2 and the effector protein (RNA-directed nuclease) expression cassette of the CRISPR / Cas genome editing system; D3), ​​recombinant microorganisms containing the recombinant vector described in D2; D4), transcription D1), and the plant that directs RNA; D5), plants containing the DNA molecules described in D2); D6), plants containing the recombinant vector described in D3); D7) Plants containing the recombinant microorganisms described in D4).

[0024] In this application, the target of the guide RNA described in C1) is the reverse complementary sequence of positions 700 to 718 of SEQ ID NO:5 or / and positions 970 to 988 of SEQ ID NO:5.

[0025] In this application, the target of the guide RNA described in D1) is the reverse complementary sequence of positions 2258 to 2276 of SEQ ID NO:4 or / and the reverse complementary sequence of positions 2573 to 2591 of SEQ ID NO:4.

[0026] This application also provides the application of the above-mentioned biomaterials in the preparation of plants that flower early and maintain yield.

[0027] In this application, the plant is a monocotyledonous plant.

[0028] In this application, the monocotyledonous plants are selected from the Poaceae family.

[0029] In this application, the grasses are selected from cereal plants.

[0030] In this application, the cereal plants are selected from plants of the genus *Zea*.

[0031] In this application, the *Zea* species is selected from maize (Zea mays L.).

[0032] The beneficial technical effects achieved by this application are as follows: This application aims to achieve early flowering and yield preservation in agricultural production by precisely regulating the expression of the ZmRap2.7 gene through the Vgt1 enhancer or ZmRap2.7 promoter. Specifically, gene editing or molecular marker-assisted breeding techniques are used to directionally modify the Vgt1 regulatory sequence, promoting earlier flowering of maize without affecting yield. This strategy enables maize to adapt to the shorter growing season in high-latitude, high-altitude regions, advancing reproductive growth to avoid high temperature, drought, or disease stress in the later stages of growth, while also preventing insufficient biomass accumulation due to premature flowering. This balances the relationship between flowering time and yield, and has significant application value in agricultural production. Attached Figure Description

[0033] Figure 1 The distribution of target sites in the coding region of the ZmRap2.7 gene and the editing status of knockout lines.

[0034] Figure 2 Editing status of ZmRap2.7 promoter-edited strains.

[0035] Figure 3 Editing status of Vgt1 enhancer edited lines.

[0036] Figure 4 Flowering phenotype of the ZmRap2.7 knockout line.

[0037] Figure 5 Flowering phenotype of the ZmRap2.7 promoter-edited line.

[0038] Figure 6 The flowering phenotype of the Vgt1 edited line.

[0039] Figure 7 The yield phenotype of the ZmRap2.7 knockout system.

[0040] Figure 8 The yield phenotype for the ZmRap 2.7 promoter editing system.

[0041] Figure 9 The yield phenotype of the Vgt1 enhancer editing system. Detailed Implementation

[0042] I. Terminology in this application: Examples of resources describing many of the molecular biology-related terms used in this article can be found in the following literature: Alberts et al., Molecular Biology of The Cell, 5th ed., Garland Science Publishing, Inc.: New York, 2007; Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed., Springer-Verlag: New York, 1991; King et al., A Dictionary of Genetics, 6th ed., Oxford University Press: New York, 2002; and Lewin, GenesIX, Oxford University Press: New York, 2007.

[0043] Any references cited in this article, including, for example, all patents, published patent applications and non-patent publications, are incorporated in their entirety by reference.

[0044] For ease of understanding this application, several terms and abbreviations used herein are defined as follows: In this application, "identity" refers to the similarity of amino acid or nucleotide sequences. The similarity of amino acid sequences (or nucleotide sequences) can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Perresidue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search for the similarity of a pair of amino acid sequences, the similarity value (%) can be obtained.

[0045] Specifically, the consistency of 70% or more can be 75% or more. Specifically, the consistency of 75% or more can be 80% or more. Specifically, the consistency of 80% or more can be 85% or more. Specifically, the consistency of 85% or more can be 90% or more. Specifically, the consistency of 90% or more can be 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more. More specifically, the consistency of 70% or more can be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% consistency.

[0046] When used in a list of two or more items, the term "and / or" means that any of the listed items can be used alone or in combination with any one or more of the listed items. For example, the expression "A and / or B" is intended to mean either or both of A and B, i.e., A alone, B alone, or a combination of A and B. The expression "A, B and / or C" means A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B and C.

[0047] The term "comprising" is not intended to be restrictive, but rather inclusive and implies the presence of other elements besides those listed, and can be interpreted as "including but not limited to". The term "comprising" also encompasses the terms "consisting of" and "substantially consisting of". In this document, the terms "including" and "comprise" are used interchangeably.

[0048] The terms “protein,” “peptide,” and “polypeptide” are used interchangeably herein and refer to polymers of amino acid residues linked together by peptide (amide) bonds. These terms refer to proteins, peptides, or polypeptides of any size, structure, or function. Typically, proteins, peptides, or polypeptides are at least 3 amino acids in length. Proteins, peptides, or polypeptides can refer to a single protein or a collection of proteins. One or more amino acids in a protein, peptide, or polypeptide can be modified, for example, by adding chemical entities such as carbohydrate groups, hydroxyl groups, phosphate groups, farnesyl groups, isofarnesyl groups, fatty acid groups, linkers for conjugation, functionalization, or other modifications. Proteins, peptides, or polypeptides can also be single molecules or can be multi-molecular complexes. Proteins, peptides, or polypeptides can simply be fragments of naturally occurring proteins or peptides. Proteins, peptides, or polypeptides can be naturally occurring, recombinant, or synthetic, or any combination thereof. Any protein provided herein can be produced by any method known in the art. For example, the proteins provided herein can be produced by recombinant protein expression and purification, which is particularly suitable for fusion proteins containing peptide linkers.

[0049] The term "biomaterial" refers to any material that carries genetic information and is capable of self-replication or replication within a biological system, such as genes, plasmids, microorganisms, animals, and plants.

[0050] As used in this article, "plant" includes explants, plant parts, seedlings, plantlets, or whole plants at any stage of regeneration or development.

[0051] As used in this article, “cereals” refers to monocotyledonous crops of the Poaceae or Gramineae family, and is typically harvested for their seeds, including, for example, corn, wheat, rice, millet, barley, sorghum, oats, and rye.

[0052] As used herein, "plant part" can refer to any organ or intact tissue of a plant, such as meristematic tissue, bud organs / structures (e.g., leaves, stems, or nodes), roots, flowers or floral organs / structures (e.g., flowers, bracts, sepals, petals, stamens, carpels, anthers, and ovules), seeds (e.g., embryo, endosperm, and seed coat), fruits (e.g., mature ovaries), propagules, or other plant tissues (e.g., vascular tissue, dermal tissue, ground tissue, etc.) or any part thereof. The plant part in this application can be viable, non-viable, renewable, and / or non-renewable. "Propagule" can include any plant part that can grow into a whole plant.

[0053] Plant cells are biological cells of plants, derived from plants or derived from cultures obtained by culturing cells taken from plants. As used herein, “transgenic plant cell” means any plant cell transformed with a stably integrated recombinant DNA molecule, construct, expression cassette, or sequence. Transgenic plant cells can include original transformed plant cells, transgenic plant cells regenerated or developed from R0 generation transgenic plant cells, transgenic plant cells cultured from another transgenic plant cell, or transgenic plant cells from any progeny or offspring of a transformed R0 generation plant, including cells of plant seeds or embryos, or cultured plant cells, callus cells, etc.

[0054] As is commonly understood in the art, the term "promoter" generally refers to a DNA containing an RNA polymerase binding site, a transcription start site, and / or a TATA box that assists or promotes the transcription of transcribed DNA. Promoters can be artificially synthesized, modified, or derived from known or naturally occurring promoters. Promoters can also include chimeric promoters comprising combinations of two or more heterologous sequences. Therefore, the promoters of this application may include variants of promoter sequences that are compositionally similar but not identical to other promoter sequences provided herein.

[0055] Promoters can be classified according to various criteria related to the expression patterns of the associated coding or transcribed sequences or genes (including transgenes) operably linked to them, such as constitutive, developmental, tissue-specific, and inducible promoters. A promoter that drives expression in all or most tissues of a plant is called a "constitutive" promoter. A promoter that drives expression at certain times or stages of development is called a "developmental" promoter. A promoter that drives enhanced expression in certain tissues of a plant relative to other tissues is called a "tissue-enhancing" or "tissue-preferred" promoter. Therefore, a "tissue-preferred" promoter elicits relatively high or preferential expression in a specific tissue of the plant, but lower expression levels in other tissues. A promoter that is expressed in a specific tissue of the plant but rarely or not expressed in other tissues is called a "tissue-specific" promoter. An "inducible" promoter is a promoter that initiates transcription in response to environmental stimuli (e.g., cold, drought, or light) or other stimuli (e.g., injury or chemical application). Promoters can also be classified according to their origin, such as heterologous, homologous, chimeric, synthetic, etc.

[0056] The term "transcribed DNA" refers to DNA that can be transcribed into RNA molecules.

[0057] The term "operationally ligated" can refer to a functional connection between a promoter and transcribed DNA, enabling the promoter to function and initiate transcription of the transcribed DNA. The term "operationally ligated" can also refer to a functional connection between other regulatory elements and a target gene to regulate the transcription and / or expression of the target gene.

[0058] The term "construct" refers to any recombinant DNA or recombinant RNA molecule. Recombinant DNA molecules can be plasmids, granules, viruses, bacteriophages, or linear or circular DNA. Constructs typically include one or more expression cassettes.

[0059] As used herein, an "expression cassette" refers to a cassette containing at least transcribed DNA operatively linked to one or more regulatory elements, typically at least a promoter and a 3' UTR (such as a terminator).

[0060] As used herein, the term "vector" refers to any construct that can be used for transformation purposes, i.e., to introduce heterologous DNA into a host cell. Examples include plasmids, granules, viruses, bacteriophages, or linear or circular DNA.

[0061] In this application, "editing" or "genome editing" means using targeted genome editing technology to produce a targeted mutation, deletion, inversion, or substitution of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 75, at least 100, at least 250, at least 500, at least 1000, at least 2500, at least 5000, or at least 10,000 nucleotides of endogenous plant genome nucleic acid sequence.

[0062] In this application, “editing” or “genome editing” also covers the use of targeted genome editing technology to target and insert or site-specifically integrate at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 75, at least 100, at least 250, at least 500, at least 750, at least 1000, at least 1500, at least 2000, at least 2500, at least 3000, at least 4000, at least 5000, or at least 10,000 nucleotides into the endogenous genome of a plant.

[0063] In this application, a “target site” for genome editing refers to a location within a plant genome of a polynucleotide sequence that is targeted and cleaved by a site-specific nuclease, thereby introducing a double-strand break (or single-strand nick) into the nucleic acid backbone and / or its complementary DNA strand. The site-specific nuclease may bind to the target site, for example, via a non-coding guide RNA (e.g., but not limited to CRISPR RNA (crRNA) or single-strand guide RNA (sgRNA)). The non-coding guide RNA provided herein may be complementary to the target site (e.g., complementary to the strand of a double-stranded nucleic acid molecule or the chromosome of the target site). A “target site” also refers to a location within the plant genome of a polynucleotide sequence that is bound and cleaved by another site-specific nuclease, which may not be guided by a non-coding RNA molecule, such as a broad-spectrum nuclease, zinc finger nuclease (ZFN), or transcription activator-like effector nuclease (TALEN), to introduce a double-strand break (or single-strand nick) into the polynucleotide sequence and / or its complementary DNA strand.

[0064] In this application, the term "guide RNA" or "gRNA" is a short RNA sequence comprising (1) a structural or scaffold RNA sequence required to bind or interact with RNA-guided nucleases and / or other RNA molecules (e.g., tracrRNA), and (2) an RNA sequence that is identical or complementary to a target sequence or target site (referred to herein as the "guide sequence"). A "single-stranded guide RNA" (or "sgRNA") is an RNA molecule comprising tracrRNA and crRNA covalently linked by a linker sequence, which may be expressed as a single RNA transcript or molecule. The guide RNA comprises a guide or target sequence ("guide sequence") identical or complementary to a target site within the plant genome, for example, at or near a GA oxidase gene. An interphase sequence adjacent motif (PAM) may be present immediately adjacent to the 5' end of a genomic target site sequence complementary to the guide RNA's target sequence and upstream of it in the genome, i.e., downstream (3') of the sense (+) strand immediately adjacent to the genomic target site (relative to the guide RNA's target sequence), as is known in the art. The genomic PAM sequence (relative to the target sequence of the guide RNA) on the sense (+) strand adjacent to the target site may contain 5'-NGG-3'. However, the corresponding sequence of the guide RNA (i.e., immediately downstream (3') of the target sequence of the guide RNA) is typically not complementary to the genomic PAM sequence. The guide RNA can usually be a non-coding RNA molecule that does not encode a protein.

[0065] In this application, "RNA-directed nuclease" refers to RNA-directed DNA endonucleases associated with the CRISPR system. Non-restricted examples of RNA-directed nucleases include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, their homologs or modified forms thereof. In one aspect of the implementation, the RNA-directed nuclease is Cas9. In another aspect, the RNA-directed nuclease comprises N-terminal and C-terminal nuclear localization sequences (NLS).

[0066] In some embodiments of this application, the composition for genome editing may be co-delivered with a DNA molecule containing a selection or screening marker gene.

[0067] Furthermore, the Cas9 protein described in this application is not limited to a specific protein, as long as it can be used in conjunction with the sgRNA described in this application. Furthermore, the Cas9 protein described herein is selected from Streptococcus pyogenes Cas9 (spCas9, subtype II-A), spCas9HF (high fidelity), nicked Cas9 (nCas9), Staphylococcus aureus Cas9 (saCas9, subtype II-A), Neisseria meningitidis Cas9 (NmCas9, subtype II-C), Francisella novicida Cas9 (FnCas9, subtype II-B), Streptococcus thermophilus Cas9 (St1Cas9, St3Cas9), Campylobacter jejuni Cas9 (CjCas9), and Treponema sp. Cas9, as well as other orthologs of Cas9 from other organisms, but not limited to these. The Cas9 protein may also include high-fidelity Cas9 mutants (such as SpCas9-HF1, eSpCas9-1.1, and TrueCut™ HiFiCas9 protein).

[0068] II. Implementation Examples The genomic sequence of the ZmRap2.7 gene is shown in SEQ ID NO:3. The ZmRap2.7 gene commonly has three transcripts (…). Figure 1 (T01, T02 and T03), wherein the coding sequence of the ZmRap2.7 gene shown in T02 is as shown in SEQ ID NO:1, and the coding amino acid sequence of the ZmRap2.7 protein is as shown in SEQ ID NO:2.

[0069] The nucleotide sequence of the ZmRap2.7 promoter is shown in SEQ ID NO:4.

[0070] The nucleotide sequence of the Vgt1 enhancer is shown in SEQ ID NO:5.

[0071] Currently, it is known that ZmRap2.7, in addition to its role in flowering, is also related to root development and seed germination. To further explore the pleiotropic effects of ZmRap2.7, we constructed two gene-edited ZmRap2.7 lines. The results showed that maize in the ZmRap2.7 gene-edited lines exhibited phenotypes including earlier flowering, reduced leaf number, decreased plant height and ear height, shortened internodes, increased leaf angle, smaller ears and kernels, and reduced yield.

[0072] How to break the coupling between early flowering and reduced yield? We continued to edit the upstream regulatory elements of the ZmRap2.7 gene, the Vgt1 enhancer and the ZmRap2.7 promoter, respectively, obtaining Vgt1 enhancer-edited lines and ZmRap2.7 promoter-edited lines. Phenotypic validation was unexpected; the flowering period of the Vgt1 enhancer-edited lines and the ZmRap2.7 promoter-edited lines was significantly earlier than that of the wild type, but the yield phenotypes (100-kernel weight and single-ear kernel weight) were not significantly different from those of wild-type maize, and even showed an increasing trend.

[0073] The present application will now be described in further detail with reference to specific embodiments. The embodiments given are merely illustrative of the present application and are not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the present application in any way.

[0074] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0075] In the following embodiments, the pCBC-MT1T2 and pBUE411 vectors were kindly provided by Professor Chen Qijun's research group at the College of Biological Sciences, China Agricultural University, as described in the literature "Xing, HL, Dong, L., Wang, ZP, Zhang, HY, Han, CY, Liu, B., Wang, XC, & Chen, QJ (2014). A CRISPR / Cas9 toolkit for multiple genome editing in plants. BMC plant biology, 14, 327." The public can obtain the above-mentioned biological materials from the applicant. The obtained biological materials can only be used for the verification of the technical solution of this application and cannot be used for other purposes.

[0076] In the following embodiments, the recipient corn LH244 (please specify the name) is owned by the applicant. The public can apply to obtain the above-mentioned biological material from the applicant. The obtained biological material can only be used for the technical solution verification of this application and cannot be used for other purposes.

[0077] Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0078] The experimental results of the following examples are expressed as mean ± standard deviation, and the t-test was used. 0.01 <P<0.05( () indicates a significant difference, P < 0.01. () indicates a highly significant difference.

[0079] Example 1: Preparation of ZmRap2.7 gene knockout line, ZmRap2.7 promoter editing line and Vgt1 editing line 1.1 Preparation of ZmRap2.7 gene knockout lines (a) Target screening: Log in to the website http: / / crispr.hzau.edu.cn / CRISPR2 / to screen for dual target sites. The screening criteria mainly include the target site being located near the target fragment, high target site specificity, low off-target rate, high efficiency in evaluating the binding of the target site to the target sequence, and a target site GC content of 55%-60%.

[0080] The nucleotide sequences of the ZmRap2.7 target sites obtained through screening are as follows: ZmRap2.7-T1: 5'-AGCTAGATCCCTCCTCCGC-3'; ( Figure 1 The inverse complementary sequence of the target sequence GCGGAGGAGGGATCTAGCT, i.e., the inverse complementary sequence of positions 839 to 857 of SEQ ID NO:3. ZmRap2.7-T2:5'-CTTCTCGAGAGGCAGCTCC-3' (SEQ ID NO:3, bits 1760 to 1778).

[0081] (II) Obtaining DNA fragments carrying two target sequences and constructing CRISPR / Cas9 gene knockout vectors (1) Obtaining DNA fragments carrying two target sequences Two target sequences were introduced into the pCBC-MT1T2 template using PCR amplification. Using pCBC-MT1T2 as a template, PCR amplification was performed using primers ZmRap2.7-MT-F and ZmRap2.7-MT-R. The amplification system is shown in Table 1. After adding the components in order, the mixture was briefly centrifuged to mix, and then the first PCR amplification was performed.

[0082] The nucleotide sequences of ZmRap2.7-MT-F and ZmRap2.7-MT-R are shown below: ZmRap2.7-MT-F: 5'-TG AGCTAGATCCCTCCTCCGC GTTTTAGAGCTAGAAATAGC-3'; ZmRap2.7-MT-R: 5'-AAC GGAGCTGCCTCTCGAGAAG CGCTTCTTGGTGCC-3'.

[0083] Table 1: First PCR amplification system

[0084] After PCR, 5 μL of sample was loaded for agarose gel electrophoresis. Electrophoresis was performed at 200 V and 180 mA for 30 min. The gel was scanned using a gel imaging system. The fragments were specific and as expected. Using the first PCR product as a template, PCR amplification was performed using primers ZmRap2.7-MT Bs-F and ZmRap2.7-MT Bs-R. A second PCR amplification was performed after adding the reagents according to the PCR system shown in Table 2.

[0085] The nucleotide sequences of ZmRap2.7-MT-F and ZmRap2.7-MT-R are shown below: ZmRap2.7-MT-Bs-F: 5'-ATATATGGTCTCTGGCG AGCTAGATCCCTCCTCCGC GTT-3'; ZmRap2.7-MT-Bs-R: 5'-ATTATTGGTCTCTAAAC GGAGCTGCCTCTCGAGAAG C-3'.

[0086] Table 2: Second PCR Amplification System

[0087] Simultaneously, PCR was repeated, with each reaction volume being 25 μL. After brief centrifugation to mix, PCR was performed using the same procedure as above. After completion, samples were loaded and analyzed by agarose gel electrophoresis. The fragments were bright, specific, and of the expected size, and the PCR products were purified. The harvested PCR product was a fragment containing two target sites, and its nucleotide sequence is shown in SEQ ID NO:6. In SEQ ID NO:6, the italicized text represents the BsaI restriction enzyme recognition site, and the bolded nucleotides represent the corresponding target sites.

[0088] SEQ ID NO:6: ATATAT GGTCTCTGGCGAGCTAGATCCCTCCTCCGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTTTTCGTTTTG CATTGAGTTTTCTCCGTCGCATGTTTGCAGTTTTATTTTCCGTTTTGAAATTTCTCCGTCTCATGTTTGCAGCGTGTTCAAAAAGTACGCAGCTGTATTTCACTTATTTACGG CGCCACATTTTCATGCCGTTTGTGCCAACTATCCCGAGCTAGTGAATACAGCTTGGCTTCACACAACACTGGTGACCCGCTGACCTGCTCGTACCTCGTACCGTCGTACGGCACAGC ATTTGGAATTAAAGGGTGTGATCGATACTGCTTGCTGCTCATGAATCCAAACCACACGGAGTTCAAATTCCCACAGATTAAGGCTCGTCCGTCGCACAAGGTAATGTGTGAATATTAT ATCTGTCGTGCAAAATTGCCTGGCCTGCACAATTGCTGTTATAGTTGGCGGCAGGGAGAGTTTTAACATTGACTAGCGTGCTGATAATTTGTGAGAAATAATTTGACAAGTAGAT ACTGACATTTGAGAAGAGCTTCTGAACTGTTATTAGTAACAAAAATGGAAAGCTGATGCACGGAAAAAGGAAAGAAAAAGCCATACTTTTTTTTAGGTGAAAAGAAAAAGCCATAC GAGACTGATGTCTCTCAGATGGGCCGGGATCTGTCTATCTAGCAGGCAGCAGCCCACCAACCTCACGGGCCAGCAATTACGAGTCCTTCTAAAAGCTCCCGCCGAGGGGCGCTGGCG CTGCTGTGCAGCAGCACGTTCTAACATTAGTCCCACCTCGCCAGTTTACAGGGAGCAGAACCAGCTTATAAGCGGAGGCGCGGCACCAAAGCGCTTCTCGAGAGGCAGCTCCGTTTA GAGACC AATAAT。

[0089] (2) Ligation of fragments containing dual target sites with vectors The fragment with dual target sites harvested in step (1) was constructed into the pBUE411 vector according to the enzyme digestion and ligation system shown in Table 3. The resulting ligation product contained a recombinant vector for CRISPR / Cas9 gene editing targeting the ZmRap2.7 gene, named the recombinant vector pBUE411-ZmRap2.7. The DNA fragment with the nucleotide sequence shown in SEQ ID NO:6 was digested with BsaI and contained a foreign fragment with sticky ends. The product of BsaI digestion of the pBUE411 vector contained a vector backbone with sticky ends. Sequencing results showed that the structure of the recombinant vector pBUE411-ZmRap2.7 was: the foreign fragment with sticky ends was ligated to the vector backbone with sticky ends, while keeping the other nucleotide sequences of the pBUE411 vector unchanged.

[0090] The recombinant vector pBUE411-ZmRap2.7 contains two transcribed DNA molecules of sgRNAs and an expression cassette for the Cas9 protein. Transcription yields sgRNA1 (targeting the inverse complementary sequence at positions 839-857 of SEQ ID NO:3), sgRNA2 (targeting positions 1760-1778 of SEQ ID NO:3), and the CRISPR / Cas9 effector protein Cas9. After introduction into the receptor, the two transcribed guide RNAs (sgRNA1 and sgRNA2) target the target sequence near the PAM region of the receptor genome (ZmRap2.7 gene) through base complementarity. The Cas9 protein causes a double-strand break at the target site of the ZmRap2.7 gene. Through the organism's own DNA damage repair response mechanism, a gene mutation occurs in the cleaved region during the repair process, thereby knocking out the ZmRap2.7 gene.

[0091] Table 3: Enzyme digestion and ligation system

[0092] (III) Preparation of ZmRap2.7 knockout lines and detection of positive plants (1) Escherichia coli transformation and bacterial detection sequence The ligation product obtained in step (II) was transformed into *E. coli* Trellef5α. After transformation, the cells were incubated overnight at 37°C. Single colonies were selected for sequencing; the sequencing primers are shown below. After successful sequencing verification, single colony propagation and plasmid extraction were performed.

[0093] OsU3-FD3:5'-GACAGGCGTCTTCTACTGGTGCTAC-3'; TaU3-FD2: 5'-TTGACTAGCGTGCTGATAATTTGTG-3'.

[0094] (2) Agrobacterium transformation Plasmids were extracted from positive Escherichia coli culture and transformed with Agrobacterium tumefaciens EHA105.

[0095] 8) Agrobacterium infection of LH244 maize embryonic callus completes the genetic transformation of maize.

[0096] (3) Identification of positive plants The editing status of T0 generation positive plants selected by herbicide screening was identified. Specific steps included: extraction of DNA from the leaves of T0 generation positive plants, PCR amplification, and sequencing to confirm gene editing. Two homozygous edited mutants were ultimately obtained and named ZmRap2.7-KO1 and ZmRap2.7-KO2, respectively.

[0097] The primers and their sequences used for PCR amplification are shown below: ZmRap2.7-CJ-1F: 5'-CACCAGTTCGCCAGGTAGTT-3'; ZmRap2.7-CJ-1R: 5'-TATGTACCTGCACCCAAGCA-3'.

[0098] Sequencing results show that: Compared to wild-type maize, the knockout line ZmRap2.7-KO1 exhibits the following genomic changes as shown in SEQ ID NO:3: nucleotide deletions occur at the T1 and T2 sites, specifically the deletion of guanine deoxynucleotide (G) at position 842 and cytosine deoxynucleotide at position 1775 in SEQ ID NO:3, thereby knocking out the ZmRap2.7 gene. Figure 1 ).

[0099] Compared to wild-type maize, the knockout line ZmRap2.7-KO2 exhibits the following genomic changes as shown in SEQ ID NO:3: a nucleotide deletion at position T1 and a nucleotide insertion at position T2. ​​Specifically, the guanine deoxynucleotide (G) at position 842 of SEQ ID NO:3 is deleted, and an adenine deoxynucleotide (A) is inserted between positions 1775 and 1776 of SEQ ID NO:3, thereby knocking out the ZmRap2.7 gene. Figure 1 ).

[0100] Homozygous mutants ZmRap2.7-KO1 and ZmRap2.7-KO2 were self-crossed for at least two generations to obtain homozygous mutant lines for phenotypic verification.

[0101] 1.2 Preparation of ZmRap2.7 promoter editing system The ZmRap2.7 promoter editing system was prepared according to the method in "1.1, Preparation of ZmRap2.7 Knockout System", with the following differences.

[0102] The nucleotide sequences of the ZmRap2.7 promoter target sites obtained through screening are as follows: pro-T1: 5'-CCCCAGTAATGAAAGCACG-3'( Figure 2 The inverse complementary sequence of CTGCTTTCATTACTGGGG, i.e., the inverse complementary sequence of positions 2258 to 2276 of SEQ ID NO:4. pro-T2: 5'-TTAGCTAGCTAAAGGCGGC-3'( Figure 2 The reverse complementary sequence of GCCGCCTTTAGCTAGCTAA, i.e., the reverse complementary sequence of positions 2573 to 2591 of SEQ ID NO:4.

[0103] The primer pairs and their sequences used in the first PCR amplification are shown below: CR-pro-MT-F: 5'-TG CCCCAGTAATGAAAGCACG GTTTTAGAGCTAGAAATAGC-3'; CR-pro-MT-R: 5'-AAC GCCGCCTTTAGCTAGCTAA CGCTTCTTGGTGCC-3'.

[0104] The primer pairs and their sequences used in the second PCR amplification are shown below: CR-pro-MT-BsF: 5'-ATATATGGTCTCTGGCG CCCCAGTAATGAAAGCACG GTT-3'; CR-pro-MT-BsR: 5'-ATTATTGGTCTCTAAAC GCCGCCTTTAGCTAGCTAA C-3'.

[0105] The PCR amplification product obtained after two PC amplifications is a fragment containing two target sites targeting the ZmRap2.7 promoter region, and its nucleotide sequence is shown in SEQ ID NO:7. In SEQ ID NO:7, the italicized parts are BsaI restriction enzyme recognition sites, and the bolded nucleotides are the corresponding target sites.

[0106] SEQ ID NO:7: ATATAT GGTCTCTGGCGCCCCAGTAATGAAAGCACGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTTTTCGTTTTG CATTGAGTTTTCTCCGTCGCATGTTTGCAGTTTTATTTTCCGTTTTGAAATTTCTCCGTCTCATGTTTGCAGCGTGTTCAAAAAGTACGCAGCTGTATTTCACTTATTTACGG CGCCACATTTTCATGCCGTTTGTGCCAACTATCCCGAGCTAGTGAATACAGCTTGGCTTCACACAACACTGGTGACCCGCTGACCTGCTCGTACCTCGTACCGTCGTACGGCACAGC ATTTGGAATTAAAGGGTGTGATCGATACTGCTTGCTGCTCATGAATCCAAACCACACGGAGTTCAAATTCCCACAGATTAAGGCTCGTCCGTCGCACAAGGTAATGTGTGAATATTAT ATCTGTCGTGCAAAATTGCCTGGCCTGCACAATTGCTGTTATAGTTGGCGGCAGGGAGAGTTTTAACATTGACTAGCGTGCTGATAATTTGTGAGAAATAATTTGACAAGTAGAT ACTGACATTTGAGAAGAGCTTCTGAACTGTTATTAGTAACAAAAATGGAAAGCTGATGCACGGAAAAAGGAAAGAAAAAGCCATACTTTTTTTTAGGTGAAAAGAAAAAGCCATAC GAGACTGATGTCTCTCAGATGGGCCGGGATCTGTCTATCTAGCAGGCAGCAGCCCACCAACCTCACGGGCCAGCAATTACGAGTCCTTCTAAAAGCTCCCGCCGAGGGGCGCTGGCG CTGCTGTGCAGCAGCACGTTCTAACATTAGTCCCACCTCGCCAGTTTACAGGGAGCAGAACCAGCTTATAAGCGGAGGCGCGCACCAAGAAGCGTTAGCTAGCTAAAGGCGGCGTTTA GAGACC AATAAT。

[0107] Following the enzyme digestion and ligation system in Table 3, a fragment containing two target sites targeting the ZmRap2.7 promoter region was constructed into the pBUE411 vector. The resulting ligation product contained a CRISPR / Cas9 gene editing recombinant vector targeting the ZmRap2.7 promoter, named the recombinant vector pBUE411-pro. The DNA fragment with the nucleotide sequence shown in SEQ ID NO:7 was digested with BsaI, revealing a foreign fragment with sticky ends. The pBUE411 vector, after BsaI digestion, contained a vector backbone with sticky ends. Sequencing results showed that the structure of the recombinant vector pBUE411-ZmRap2.7 was: a foreign fragment with sticky ends ligated to a vector backbone with sticky ends, while keeping the other nucleotide sequences of the pBUE411 vector unchanged.

[0108] The recombinant vector pBUE411-pro contains two transcribed DNA molecules of sgRNAs and one Cas9 protein expression cassette. It can transcribe sgRNA1 (targeting the inverse complementary sequence at positions 2258-2276 of SEQ ID NO:4), sgRNA2 (targeting the inverse complementary sequence at positions 2573-2591 of SEQ ID NO:4), and the CRISPR / Cas9 effector protein Cas9. After introduction into the receptor, the two transcribed guide RNAs (sgRNA1 and sgRNA2) can target the target sequence near the PAM region of the receptor genome, specifically the ZmRap2.7 promoter, through base complementarity. The Cas9 protein causes a double-strand break at the target site of the ZmRap2.7 promoter. Through the organism's own DNA damage repair response mechanism, gene mutations occur in the cleaved region during the repair process, thereby achieving editing of the ZmRap2.7 promoter.

[0109] The Agrobacterium-mediated maize protoplast transformation was performed according to the method described in Section 1.1, "Preparation of ZmRap2.7 Edited Lines and Detection of Positive Plants." The editing status of the T0 generation positive plants, selected after herbicide screening, was identified. Specific steps included: extraction of DNA from the leaves of the T0 generation positive plants, PCR amplification, and sequencing to confirm gene editing. Two homozygous edited mutants were ultimately obtained and named CR-pro1 and CR-pro2, respectively.

[0110] The primer sequences used to verify the correct sequencing results for positive E. coli and positive Agrobacterium are shown below: OsU3-FD3:5'-GACAGGCGTCTTCTACTGGTGCTAC-3'; TaU3-FD2: 5'-TTGACTAGCGTGCTGATAATTTGTG-3'. The primers and their sequences used for PCR amplification to confirm gene editing are shown below: CR-pro-1F: 5'-GCTTCTGGGTGTGGGTTTAC-3'; CR-pro-1R: 5'-CCACTGTACTGTCGCTTCAC-3'.

[0111] Sequencing results show that: Compared to wild-type maize, the mutant CR-pro1 exhibits the following genomic changes as shown in SEQ ID NO:4: a nucleotide insertion occurs at the T1 site, and a nucleotide deletion occurs near the T2 site. Specifically, a guanine deoxynucleotide (G) is inserted between positions 2261 and 2262 of SEQ ID NO:4, and nucleotides from positions 2566 to 2582 and positions 2584 of SEQ ID NO:4 are deleted, thereby enabling ZmRap2.7 promoter editing. Figure 2 ).

[0112] Compared to wild-type maize, the mutant CR-pro2, as shown in SEQ ID NO:4, exhibits the following genomic changes: nucleotide insertion at the T1 site and nucleotide deletion near the T2 site. Specifically, a guanine deoxynucleotide (G) is inserted between positions 2261 and 2262 of SEQ ID NO:4, and nucleotides from positions 2573 to 2581 of SEQ ID NO:4 are deleted, with a guanine deoxynucleotide (G) inserted between positions 2583 and 2584, thereby enabling ZmRap2.7 promoter editing. Figure 2 ).

[0113] Homozygous mutants CR-pro1 and CR-pro2 were self-crossed for at least two generations to obtain homozygous mutant lines for phenotypic verification.

[0114] 1.3. Vgt1 Editing System Preparation The Vgt1 editing system was prepared according to the method in "1.1, Preparation of ZmRap2.7 Knockout System", with the following differences.

[0115] The nucleotide sequences of the Vgt1 target obtained through screening are as follows: pro-T1: 5'-TGAAGGTAGGCAAACGTAA-3'( Figure 3 The inverse complementary sequence of TTACGTTTGCCTACCTTCA, i.e., the inverse complementary sequence of positions 700 to 718 of SEQ ID NO:5). pro-T2: 5'-CGTACGTAGTTATTGCCGG-3'( Figure 3 The T2 target sequence, i.e., the sequence from position 970 to 988 of SEQ ID NO:5.

[0116] The primer pairs and their sequences used in the first PCR amplification are shown below: CR-Vgt1-MT-F: 5'-TG TGAAGGTAGGCAAACGTAA GTTTTAGAGCTAGAAATAGC-3'; CR-Vgt1-MT-R: 5'-AAC CCGGCAATAACTACGTACG CGCTTCTTGGTGCC-3'.

[0117] The primer pairs and their sequences used in the second PCR amplification are shown below: CR-Vgt1-MT-BsF: 5'-ATATATGGTCTCTGGCG TGAAGGTAGGCAAACGTAA GTT-3'; CR-Vgt1-MT-BsR: 5'-ATTATTGGTCTCTAAAC CCGGCAATAACTACGTACG C-3'.

[0118] The PCR amplification product obtained after two PC amplifications is a fragment containing two target sites targeting Vgt1, and its nucleotide sequence is shown in SEQ ID NO:8. In SEQ ID NO:7, the italicized part represents the BsaI restriction enzyme recognition site, and the bolded nucleotides represent the corresponding target sites.

[0119] SEQ ID NO:8: ATATAT GGTCTCTGGCGTGAAGGTAGGCAAACGTAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTTTTCGTTTTG CATTGAGTTTTCTCCGTCGCATGTTTGCAGTTTTATTTTCCGTTTTGAAATTTCTCCGTCTCATGTTTGCAGCGTGTTCAAAAAGTACGCAGCTGTATTTCACTTATTTACGG CGCCACATTTTCATGCCGTTTGTGCCAACTATCCCGAGCTAGTGAATACAGCTTGGCTTCACACAACACTGGTGACCCGCTGACCTGCTCGTACCTCGTACCGTCGTACGGCACAGC ATTTGGAATTAAAGGGTGTGATCGATACTGCTTGCTGCTCATGAATCCAAACCACACGGAGTTCAAATTCCCACAGATTAAGGCTCGTCCGTCGCACAAGGTAATGTGTGAATATTAT ATCTGTCGTGCAAAATTGCCTGGCCTGCACAATTGCTGTTATAGTTGGCGGCAGGGAGAGTTTTAACATTGACTAGCGTGCTGATAATTTGTGAGAAATAATTTGACAAGTAGAT ACTGACATTTGAGAAGAGCTTCTGAACTGTTATTAGTAACAAAAATGGAAAGCTGATGCACGGAAAAAGGAAAGAAAAAGCCATACTTTTTTTTAGGTGAAAAGAAAAAGCCATAC GAGACTGATGTCTCTCAGATGGGCCGGGATCTGTCTATCTAGCAGGCAGCAGCCCACCAACCTCACGGGCCAGCAATTACGAGTCCTTCTAAAAGCTCCCGCCGAGGGGCGCTGGCG CTGCTGTGCAGCAGCACGTTCTAACATTAGTCCCACCTCGCCAGTTTACAGGGAGCAGAACCAGCTTATAAGCGGAGGCGCGCACCAAGAAGCGCGTACGTAGTTATTGCCGGGTTTA GAGACC AATAAT。

[0120] Following the enzyme digestion and ligation system in Table 3, a fragment targeting Vgt1 with two target sites was constructed into the pBUE411 vector. The resulting ligation product contained a CRISPR / Cas9 gene editing recombinant vector targeting Vgt1, named the recombinant vector pBUE411-Vgt1. The DNA fragment with the nucleotide sequence shown in SEQ ID NO:8 was digested with BsaI, revealing a foreign fragment with sticky ends. The product of BsaI digestion of the pBUE411 vector contained a vector backbone with sticky ends. Sequencing results showed that the structure of the recombinant vector pBUE411-ZmRap2.7 was as follows: a foreign fragment with sticky ends was ligated to a vector backbone with sticky ends, while keeping the other nucleotide sequences of the pBUE411 vector unchanged.

[0121] The recombinant vector pBUE411-pro Vgt1 contains two transcribed DNA molecules of sgRNA and an expression cassette of the Cas9 protein. It can transcribe sgRNA1 (targeting the inverse complementary sequence at positions 700-718 of SEQ ID NO:5), sgRNA2 (targeting positions 970-988 of SEQ ID NO:5), and the CRISPR / Cas9 effector protein Cas9. After introduction into the receptor, the two transcribed guide RNAs (sgRNA1 and sgRNA2) target the target sequence near the PAM of the receptor genome, i.e., Vgt1, through base complementarity. The Cas9 protein causes a double-strand break at the Vgt1 target site. Through the organism's own DNA damage repair response mechanism, gene mutations occur in the cleaved region during the repair process, thereby achieving Vgt1 editing.

[0122] The Agrobacterium-mediated transformation of maize protoplasts and the detection of positive plants were performed according to the method described in Section 1.1, "Preparation of ZmRap2.7 knockout lines and detection of positive plants." The editing status of the T0 generation positive plants, selected by herbicide screening, was identified. Specific steps included: extraction of DNA from the leaves of the T0 generation positive plants, PCR amplification, and sequencing to confirm gene editing. Two homozygous edited mutants were finally obtained and named CR-Vgt1-1 and CR-Vgt1-2, respectively.

[0123] The primer sequences used to verify the correct sequencing results for positive E. coli and positive Agrobacterium are shown below: OsU3-FD3: 5'-GACAGGCGTCTTCTACTGGTGCTAC-3'; TaU3-FD2: 5'-TTGACTAGCGTGCTGATAATTTGTG-3'.

[0124] The primers and their sequences used for PCR amplification to confirm gene editing are shown below: CR-Vgt1-1F: 5'-AGTTGTACCAGCTCCCTCTG-3'; CR-Vgt1-1R: 5'-TCAAAACCATAAGCGGACGG-3'.

[0125] Sequencing results show that: Compared to wild-type maize, the mutant CR-Vgt1-1 exhibits the following genomic changes as shown in SEQ ID NO:5: a nucleotide deletion at the T1 site and a nucleotide insertion at the T2 site, specifically a deletion of nucleotides (ACGT) at positions 702 to 705 of SEQ ID NO:5, and an insertion of an adenine deoxyribonucleotide (A) between positions 985 and 986 of SEQ ID NO:5, thereby achieving Vgt1 editing. Figure 3 ).

[0126] Compared to wild-type maize, the mutant CR-Vgt1-2 exhibits the following genomic changes as shown in SEQ ID NO:5: nucleotide deletion at the T1 site and nucleotide insertion and deletion at the T2 site. Specifically, nucleotide (C) at position 703 of SEQ ID NO:5 is deleted; a DNA fragment with the nucleotide sequence “ATCCATTCCATCCAT” is inserted between positions 961 and 962 of SEQ ID NO:5; and nucleotides (TGCACGTACGTACGTAGTTATTGCCGGCG) from position 962 to 990 of SEQ ID NO:5 are deleted, thereby achieving Vgt1 editing. Figure 3 ).

[0127] Homozygous mutants CR-Vgt1-1 and CR-Vgt1-2 were self-crossed for at least two generations to obtain homozygous mutant lines for phenotypic verification.

[0128] Example 2: Field planting and phenotypic identification of homozygous edited mutants 2.1 Field planting of homozygous edited mutants (a) Field sowing of ZmRap2.7 knockout line Seeds of the homozygous mutant lines ZmRap2.7-KO1 and ZmRap2.7-KO2 prepared in Example 1 and wild-type maize LH244 were planted in the field in Sanya. To eliminate the influence of the environment on the plant phenotype, a row planting method was adopted between wild-type and edited lines. Each mutant line was planted in 4 rows with 15 seeds per row, and the wild-type line was planted in 6 rows with 15 seeds per row. Single seeds were sown in the field, with a plant spacing of 25 cm and a row width of 50 cm.

[0129] (ii) Field sowing of ZmRap2.7 promoter editing line Seeds of the homozygous mutant lines CR-pro1 and CR-pro2 prepared in Example 1 and wild-type maize LH244 were planted in the field in Sanya. To eliminate the influence of the environment on the plant phenotype, a row planting method was adopted between wild-type and edited lines. Each mutant line was planted in 4 rows with 15 seeds per row, and the wild-type line was planted in 6 rows with 15 seeds per row. Single seeds were sown in the field, with a plant spacing of 25 cm and a row width of 50 cm.

[0130] (III) Vgt1 editing system field sowing Seeds of the homozygous mutant lines CR-Vgt1-1 and CR-Vgt1-2 prepared in Example 1 and wild-type maize LH244 were planted in the field in Sanya. To eliminate the influence of the environment on the plant phenotype, a row planting method was adopted between wild-type and edited lines. Each mutant line was planted in 4 rows with 15 seeds per row, and the wild-type line was planted in 4 rows with 15 seeds per row. Single seeds were sown in the field, with a plant spacing of 25 cm and a row width of 50 cm.

[0131] The above three groups were sown at different times. The flowering phenotype of maize was observed and recorded at the flowering stage. After the maize kernels were fully mature, they were harvested, dried, and the yield-related phenotypes were statistically analyzed.

[0132] 2.2 Identification of flowering stage phenotype The criteria for the flowering period (DTA) phenotypic survey are described below: Flowering period: The number of days from sowing to pollen shedding from the tassel. Pollen shedding from the tassel refers to the time when half or more of the anthers of the main tassel of the corn are exposed, which is considered as flowering on that day.

[0133] (a) Identification results of flowering phenotype of ZmRap2.7 knockout line ZmRap2.7 knockout significantly advanced the flowering period of maize (Table 4 and 2010). Figure 4 ).

[0134] Table 4: Identification results of flowering-related phenotypes in ZmRap2.7 knockout lines

[0135] (II) Identification results of flowering-related phenotypes in ZmRap2.7 promoter-edited lines The results showed that editing the ZmRap2.7 promoter significantly advanced the flowering period of maize (Table 5 and 2010). Figure 5 ).

[0136] Table 5: Identification results of flowering phenotypes in ZmRap2.7 promoter-edited lines

[0137] (III) Identification results of flowering-related phenotypes in the Vgt1 edited line The results showed that the flowering period of maize in the Vgt1 edited line CR-Vgt1-1 was significantly advanced (Table 6 and...). Figure 6 (), while there is no significant difference between the Vgt1 editing system CR-Vgt1-2.

[0138] Table 6: Identification results of flowering phenotypes in the Vgt1 edited line

[0139] 1.3 Identification of yield-related phenotypes Maize yield is determined by the number of ears per unit area, the number of kernels per ear, and the kernel weight. A homozygous edited mutant of maize was planted in the field, and after the kernels were fully mature, they were harvested, dried, and the following phenotypic statistics were performed: 100-grain weight: The weight of 100 grains in the middle of the female ear.

[0140] Single ear kernel weight: The weight of all the kernels in a single corn ear.

[0141] (I) Identification results of yield-related phenotypes in ZmRap2.7 knockout lines The results showed that, except during the flowering period, the 100-kernel weight and ear yield of maize in the ZmRap2.7 gene knockout lines were reduced (Table 7 and 100-kernel weight). Figure 7 ).

[0142] Table 7: Identification results of yield-related phenotypes in the ZmRap2.7 knockout line

[0143] (II) Identification results of yield-related phenotypes of ZmRap2.7 promoter editing lines The results showed that, compared with the wild-type control, there was no significant difference in single-ear grain weight among the ZmRap2.7 promoter-edited lines, while the CR-pro1 100-grain weight was slightly higher than that of the wild type (Table 8 and 100-grain weight). Figure 8 ).

[0144] Table 8: Identification results of yield-related phenotypes in ZmRap 2.7 promoter editing lines

[0145] (III) Identification results of yield-related phenotypes in Vgt1 edited strains The results showed that, compared with the wild-type control, the single ear grain weight of the Vgt1 edited line CR-Vgt1-1 tended to be higher, while the 100-grain weight showed no significant difference (Table 9 and 100-grain weight). Figure 9 The single ear grain weight and 100-grain weight of the Vgt1 edited line CR-Vgt1-2 showed no significant difference (Table 9 and 100-grain weight). Figure 9These results indicate that, compared to wild-type maize, the Vgt1 edited line CR-Vgt1-1 has a significantly shorter flowering period and higher yield, demonstrating unexpected technical benefits.

[0146] Table 9: Identification results of yield-related phenotypes in the Vgt1 editing line

[0147] The present application has been described in detail above. Those skilled in the art will recognize that the present application can be implemented in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments are given in this application, it should be understood that further modifications can be made to the present application. In summary, in accordance with the principles of this application, this application is intended to include any changes, uses, or improvements to the present application, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method for preparing early-flowering and yield-preserving maize, characterized in that: The method includes the step of gene editing the transcriptional regulatory element of the ZmRap2.7 gene in target maize to obtain maize with early flowering and guaranteed yield. The transcriptional regulatory element includes the Vgt1 enhancer and / or the ZmRap2.7 promoter. The nucleotide sequence of the Vgt1 enhancer is as shown in SEQ ID NO:5 or has more than 70% identity with SEQ ID NO:5 and has the same function. The nucleotide sequence of the ZmRap2.7 promoter is as shown in SEQ ID NO:4 or has more than 70% identity with SEQ ID NO:4 and has the same function.

2. A method for shortening the flowering period of maize while maintaining the same yield, the method comprising the step of gene editing the transcriptional regulatory element of the ZmRap2.7 gene in recipient maize to shorten the flowering period of recipient maize while maintaining the same yield, wherein the transcriptional regulatory element comprises the Vgt1 enhancer and / or the ZmRap2.7 promoter as described in claim 1.

3. The method according to claim 1 or 2, characterized in that: The method includes providing a CRISPR / Cas genome editing system, the CRISPR / Cas genome editing system including a gene for a guide RNA targeting the Vgt1 enhancer and a gene for an RNA-directed nuclease; The CRISPR / Cas genome editing system is introduced into the target maize, causing the CRISPR / Cas genome editing system to transcribe the guide RNA and express the RNA-guided nuclease in the target maize, thereby achieving gene editing of the Vgt1 enhancer.

4. The method according to claim 1 or 2, characterized in that: The method includes providing a CRISPR / Cas genome editing system, the CRISPR / Cas genome editing system including a gene for a guide RNA targeting the ZmRap2.7 promoter and a gene for an RNA-directed nuclease; The CRISPR / Cas genome editing system is introduced into the target maize, causing the CRISPR / Cas genome editing system to transcribe the guide RNA and express the RNA-guided nuclease in the target maize, thereby achieving gene editing of the ZmRap2.7 promoter.

5. Early-flowering and yield-preserving maize obtained by any one of the methods described in claims 1-4.

6. A biomaterial related to the Vgt1 enhancer editing of claim 1, wherein the biomaterial is at least one of the following: C1) Guide RNA for the CRISPR / Cas genome editing system that targets the Vgt1 enhancer; C2) Transcription of the guide RNA described in C1) is a transcribed DNA molecule; C3) A recombinant vector containing the transcribed DNA molecule described in C2 and an expression cassette for the effector protein (RNA-directed nuclease) of the CRISPR / Cas genome editing system; C3) Recombinant microorganisms containing the recombinant vector described in C2; C4), transcription of C1) of the plant as the guide RNA; C5), plants containing the DNA molecules described in C2); C6), plants containing the recombinant vector described in C3); C7) and plants containing the recombinant microorganisms described in C4).

7. The biomaterial related to ZmRap2.7 promoter gene editing as described in claim 1, wherein the biomaterial is at least one of the following: D1) The guide RNA of the CRISPR / Cas genome editing system that targets the ZmRap2.7 promoter; D2) Transcription of the guide RNA described in D1) is a transcribed DNA molecule; D3) A recombinant vector containing the transcribed DNA molecule described in D2 and the effector protein expression cassette of the CRISPR / Cas genome editing system; D3), ​​recombinant microorganisms containing the recombinant vector described in D2; D4), transcription D1), and the plant that guides RNA; D5), plants containing the DNA molecules described in D2); D6), plants containing the recombinant vector described in D3); D7) Plants containing the recombinant microorganisms described in D4).

8. The application of the biomaterial according to claim 6 or 7 in the preparation of plants that flower early and maintain yield.

9. The plant described in any one of claims 6 to 8 is a monocotyledonous plant.