Rape cold-resistant gene BnaMYBL17 and application thereof
By knocking out the BnaMYBL17 gene in rapeseed using gene editing technology, the cold resistance of rapeseed was improved, which solved the problems of slow growth and low germination rate of rapeseed at low temperatures, and provided gene resources and theoretical support for highly cold-resistant rapeseed.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- OIL CROPS RES INST CHINESE ACAD OF AGRI SCI
- Filing Date
- 2026-02-24
- Publication Date
- 2026-05-12
AI Technical Summary
Existing rapeseed varieties grow slowly, have low emergence rates, and are susceptible to low-temperature damage due to delayed sowing, making it difficult to achieve effective yields. They also lack effective cold-resistant gene resources.
By knocking out the BnaMYBL17 gene in rapeseed using gene editing technology, resulting in the loss of its expressed protein function, the cold resistance of rapeseed is improved. sgRNA was designed using the CRISPR-Cas9 system and the recombinant vector PV58KN was constructed for gene editing to cultivate highly cold-resistant rapeseed.
Under cold damage conditions, the survival rate of the BnaMYBL17 knockout mutant rapeseed lines was significantly higher than that of the wild type, providing valuable genetic resources and molecular mechanism analysis for cold-resistant varieties, and enhancing the cold resistance of rapeseed.
Smart Images

Figure CN122012588A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a cold-resistant gene in rapeseed. BnaMYBL17 And its applications. Background Technology
[0002] Rapeseed is one of the important oil crops. Vigorously developing rapeseed production not only has a significant impact on agricultural production and the national economy, but also plays an important role in ensuring the security of edible oil supply.
[0003] Due to significant regional climate differences, different rapeseed varieties have varying requirements for light and temperature, thus rapeseed is divided into two major production areas: winter rapeseed and summer rapeseed. The Yangtze River Basin, as the main winter rapeseed growing area, accounts for 90% of the total planting area and 91% of the total yield. Simultaneously, the Yangtze River Basin is also an important rice-producing area, implementing a rice-rapeseed rotation system. The suitable sowing period for direct-seeded rapeseed is mid-to-late October. Timely sowing ensures that rapeseed seedlings fully utilize the pre-winter light and temperature resources to achieve a large biomass, laying the foundation for all growth stages after overwintering. Therefore, growth temperature is a crucial factor affecting rapeseed seedling growth, photosynthetic efficiency, and yield. Currently, to ensure high yield and quality of rice, longer-growing-period varieties are often selected in production, leading to a continuous delay in rice maturity and a corresponding postponement of rapeseed sowing. Late-sown rapeseed experiences lower temperatures after sowing, resulting in a decrease in effective accumulated temperature, low emergence rate, slow emergence, slow plant growth, and susceptibility to low-temperature damage, making it difficult to achieve effective yields. Therefore, in order to address the adverse effects caused by the delayed sowing period, research on the cold resistance of rapeseed is not only a key focus in production practice, but also one of the important goals of breeders in resistance breeding.
[0004] Currently, there is relatively little research on the discovery of cold-resistant genes in rapeseed and related molecular mechanisms. There is an urgent need for abundant gene resources to improve the cold resistance of rapeseed. Summary of the Invention
[0005] The purpose of this invention is to provide a cold-resistant gene for rapeseed. BnaMYBL17 And its applications, to solve the problems existing in the above-mentioned prior art, BnaMYBL17 The gene knockout mutant rapeseed lines had a significantly higher survival rate than the wild type under cold damage treatment.
[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides knockout BnaMYBL17 The application of genes in any of the following: (1) Improve the cold resistance of rapeseed; (2) Cultivating highly cold-resistant rapeseed; The BnaMYBL17 The cDNA nucleotide sequence of the gene is shown in SEQ ID NO.1.
[0007] The present invention also provides the aforementioned BnaMYBL17 The application of gene-encoded proteins in any of the following: (1) Improve the cold resistance of rapeseed; (2) Cultivate rapeseed with high cold resistance.
[0008] The present invention also provides a method for knocking out the aforementioned BnaMYBL17 The application of gene recombinant vectors in any of the following: (1) Improve the cold resistance of rapeseed; (2) Cultivate rapeseed with high cold resistance.
[0009] The present invention also provides the use of recombinant microorganisms containing the recombinant vector in any of the following: (1) Improve the cold resistance of rapeseed; (2) Cultivate rapeseed with high cold resistance.
[0010] Optionally, the rapeseed described in the article can be mutated using gene editing technology. BnaMYBL17 Genes that lead to the aforementioned BnaMYBL17 The loss of function of the gene-expressed protein enhances the cold resistance of the rapeseed.
[0011] Optionally, the cause of the BnaMYBL17 Methods to eliminate the function of gene-expressed proteins include the insertion of bases into the target sequence.
[0012] Optionally, the rapeseed includes Brassica napus.
[0013] This invention also provides a method for improving the cold resistance of rapeseed, comprising the following steps: [The text abruptly ends here, likely due to an incomplete sentence or missing information.] BnaMYBL17 Gene editing is performed to make the aforementioned BnaMYBL17 The loss of function of the gene-expressed protein, thereby enhancing the cold resistance of the rapeseed; BnaMYBL17 The cDNA nucleotide sequence of the gene is shown in SEQ ID NO.1.
[0014] This invention also provides a method for cultivating highly cold-resistant rapeseed, comprising the following steps: [The text abruptly ends here, so the translation stops.] BnaMYBL17 Gene editing is performed to make the aforementioned BnaMYBL17 The loss of function of the gene-expressed protein, thereby enhancing the cold resistance of the rapeseed; BnaMYBL17 The cDNA nucleotide sequence of the gene is shown in SEQ ID NO.1.
[0015] The present invention discloses the following technical effects: This invention is the first to clone a novel gene related to cold resistance from rapeseed. BnaMYBL17 The present invention is provided in rapeseed. BnaMYBL17After site-specific gene editing, cold resistance assessment results showed... BnaMYBL17 The gene knockout mutant rapeseed lines showed a significantly higher survival rate than the wild type under cold damage treatment. In this invention... Bnamybl17 The acquisition of the mutant system provides valuable genetic resources for the breeding of cold-resistant varieties and is of great significance for elucidating the molecular mechanism of plant cold resistance. Attached Figure Description
[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0017] Figure 1 for BnaMYBL17 Two target sites of the gene; Figure 2 A schematic diagram of the gene editing vector PV58KN; Figure 3 for BnaMYBL17 Nucleotide sequences of T1 generation mutant strains; Figure 4 for BnaMYBL17 Sequencing peak diagram of a single T1 generation mutant strain; Figure 5 for BnaMYBL17 A schematic diagram of the growth status of the mutant line under artificially simulated cold stress; ZS6 is the wild type of rapeseed. Bnamybl17 -2、 Bnamybl17 -3、 Bnamybl17 -7 represents three independent homozygous mutant lines of rapeseed; Figure 6 for BnaMYBL17 A statistical chart showing the survival rate of mutant strains and wild-type plants one week after recovery from cold stress. Detailed Implementation
[0018] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0019] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0020] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0021] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0022] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0023] The culture medium formula used in this invention is as follows: LB medium (1L): 10 g tryptone, 5 g yeast extract and 10 g NaCl (8.5 g agar powder added to solid medium). DM medium (1L): 4.43 g MS medium and 30 g sucrose, pH adjusted to 5.6-5.8, after sterilization, add 1 mL AS (100 mmol / mL), 2 mL 2,4-D (0.5 mg / mL) and 1.5 mL KT (0.2 mg / mL). M0 medium (1L): 2.2g MS medium and 30g sucrose, adjust the pH to 5.6-5.8, and then add 8.5g agar powder; M1 medium (1L): 4.43 g MS medium, 30 g sucrose, 18 g mannitol and 1 mL (0.5 mg / mL) 2,4-D. After adjusting the pH to 5.6-5.8, add 8.5 g agar powder. When pouring the plates after sterilization, add 1 mL AS and 1 mL KT. M2 medium (1L): 4.43 g MS medium, 30 g sucrose, 18 g mannitol, 1 mL 2,4-D (0.5 mg / mL) and 1.5 mL KT (0.2 mg / mL). After adjusting the pH to 5.6-5.8, add 8.5 g agar powder. After sterilizing at 121℃, add 213 µL AgNO3 (20 mM / L), 1 mL termetidine (300 mg / mL) and 500 µL kanamycin (50 mg / mL) when pouring the plates. M3 medium (1L): 4.43 g MS medium, 10 g glucose, 0.25 g xylose and 0.6 g MES, adjust pH to 5.6-5.8, add 8.5 g agar powder, sterilize at 121℃, then add 200 µL IAA (0.5 mg / mL), 4 mL zeatin (0.5 mg / mL), 1 mL termethin (300 mg / mL) and 500 µL kanamycin (50 mg / mL). Rooting medium: 3.21g B5 medium and 20g sucrose, adjust the pH to 5.6-5.8, and then add 8.5g agar powder.
[0024] Example 1 1. Brassica napus BnaMYBL17 Design of sgRNA for CRISPR-Cas9 and Construction of the BnaMYBL17-PV58KN Vector (1) sgRNA design Genes in Brassica napus BnaMYBL17 There are two copies. BnaMYBL17 The nucleotide sequence of the gene's cDNA is shown in SEQ ID NO.1. Sequence alignment analysis was performed on the two copies, and two sgRNAs were designed at conserved sequence positions in the second and third exons of both copies using an online website (http: / / crispr.hzau.edu.cn / CRISPR2 / ). BnaMYBL17 -sgRNA1 (PAM site is AGG, SEQ ID NO.2) and BnaMYBL17 -sgRNA2 (PAM site is GGG, SEQ ID NO.3). The target sites of the two sgRNAs are as follows: Figure 1 As shown.
[0025] SEQ ID NO.1: ; BnaMYBL17 -sgRNA1:GAATGCTGCACCGTGCCAAGAGG, SEQ ID NO.2; BnaMYBL17 -sgRNA2: GAGAAGAAACTCATGAAAATGGG, SEQ ID NO.3.
[0026] (2) Target site fragment amplification Based on the above design, adapter primers T1s (SEQ ID NO. 6) and T2as (SEQ ID NO. 7) containing 20bp target site sequences were synthesized by Tianyi Huiyuan Biotechnology Co., Ltd. Using a high-fidelity enzyme and PGTR as a template (containing an sgRNA-tRNA backbone sequence), the target fragments containing the T1 (SEQ ID NO. 4) and T2 (SEQ ID NO. 5) targets were amplified using the above primers. The PCR system is shown in Table 1.
[0027] Table 1 PCR system for target site fragment amplification The PCR program was 95℃ for 3 min; 95℃ for 20 s, 56℃ for 20 s, 72℃ for 10 s, 35 cycles; 72℃ for 3 min; 25℃ for 1 s.
[0028] T1: GAATGCTGCACCGTGCCAAG, SEQ ID NO.4; T2: GAGAAGAAACTCATGAAAT, SEQ ID NO.5; T1s:ttcccggctggtgcaGAATGCTGCACCGTGCCAAGgttttagagctagaaatagcaagt, SEQID NO.6; T2as:ttctagctctaaaacATTTTCATGAGTTTCTTCTCtgcaccagccgggaat, SEQ ID NO.7.
[0029] (3) The target site was ligated to the PV58KN editing vector. The PCR product was then mixed with the linearized editing vector PV58KN, which had been purified by enzyme digestion (vector pattern shown in Figure 1). Figure 2 As shown in the figure, the final CRISPR expression vector is formed. The specific operation is to add the PCR product and the linearized editing vector PV58KN, which has been purified by enzyme digestion, to the homologous recombination system at a molar ratio of 2:1: 5 μL of 2×Basic Assembly mix, and add water to 10 μL; place in a dry bath at 50℃ for 15 min.
[0030] (4) Transformation of Escherichia coli Melt competent E. coli DH5α (WEIDI) cells stored at -80℃ in your palm. Add 5 μL of ligation product to 100 μL of competent cells, gently tap to mix, place on ice for 30 min, heat shock at 42℃ for 45 s, and immediately place on ice for 2 min. Add 500 μL of antibiotic-free LB liquid culture medium, tilt the plate on a shaker at 37℃, incubate at 200 rpm for 30 min, centrifuge at 4000 rpm for 2 min, and retain about 200 μL of bacterial culture. Take 100 μL, spread it on a Kan resistance plate, and incubate overnight at 37℃.
[0031] (5) Identification of positive clones Single colonies on the plate were picked and placed in Kan-resistant LB liquid medium. After shaking overnight at 200 rpm and 37°C, colony PCR was performed using the vector primers U626-IDF and inf-T2as. The PCR system is shown in Table 2.
[0032] Table 2 PCR system for identifying positive clones PCR program: 98℃ 3min; 95℃ 15s, 56℃ 15s, 72℃ 15s, 32 cycles; 72℃ 3min; 25℃ 1s.
[0033] After detection by 1% agarose gel electrophoresis, the bacterial culture containing positive clones was sent to Wuhan Qingke Biotechnology Co., Ltd. for sequencing. Samples with correct sequencing results were returned along with the plasmid (PV58KN-BnaMYBL17) and the bacterial culture.
[0034] U626-IDF: TGTCCCAGGATTAGAATGATTAGGC, SEQ ID NO.8; inf-T2as:ttctagctctaaaacATTTTCATGAGTTTCTTCTC, SEQ ID NO.9.
[0035] 2. Agrobacterium GV3101 transformed with PV58KN-BnaMYBL17 vector 1 μL of recombinant plasmid PV58KN-BnaMYBL17 was transferred into 100 μL of Agrobacterium competent cells GV3101 (WEIDI) that had been thawed in the palm of the hand. The mixture was gently patted and placed on ice for 5 min, then in liquid nitrogen for 5 min, then in a 37°C water bath for 5 min, and finally on ice for 5 min. 500 μL of antibiotic-free LB liquid medium was then added. The mixture was tilted on a shaker at 28°C and incubated at 200 rpm for 30 min. After incubation, the mixture was centrifuged at 4000 rpm for 2 min, and about 200 μL of bacterial culture was collected. 60 μL of the culture was spread onto LB solid culture dishes containing 50 mg / L kanamycin, 50 mg / L gentamicin, and 50 mg / L rifampin.
[0036] Select 6-12 single colonies from a petri dish and incubate them at 28°C for 2-3 days. Add the resulting plaques to LB liquid medium containing the three resistances mentioned above and incubate overnight at 28°C. Then, perform bacterial culture PCR to identify positive clones (the detection primers, reaction system, and reaction procedure are the same as in "(5) Identification of Positive Clones"). Subsequently, take 500 μL of fresh bacterial culture and add an equal volume of sterile 50% glycerol. Mix the mixture and store it at -80°C for a long period of time.
[0037] 3. Agrobacterium PV58KN-BnaMYBL17-mediated genetic transformation of Brassica napus (1) M0 culture hypocotyl The *Agrobacterium PV58KN-BnaMYBL17* obtained from “2. Transformation of *Agrobacterium* GV3101 with PV58KN-BnaMYBL17 vector” was transformed into *Brassica napus* using the hypocotyl immersion method: 200 plump *Zhongshuang 6* (ZS6) rapeseed seeds were selected and added to a pre-sterilized 50mL centrifuge tube. The seeds were soaked in 75% alcohol for 1 min in a clean bench, the alcohol was discarded, and 10mL of 1.5% mercuric chloride was added for 15 min. The seeds were shaken every few minutes, the mercuric chloride was discarded, and the seeds were washed 5 times with sterile distilled water. The seeds were then placed in M0 medium and cultured in the dark at 24℃ for 6-7 days.
[0038] (2) Activation of Agrobacterium PV58KN-BnaMYBL17 PV58KN-BnaMYBL17 Agrobacterium was taken and, using a sterile pipette tip, 100 μL of bacterial culture was added to LB liquid medium containing 50 μg / mL kanamycin resistance and 25 μg / mL rifampicin resistance in a clean bench. The medium was then incubated at 28°C and 200 rpm until OD500 was reached. 600 =0.8~1.0. Then, centrifuge at 4000 rpm for 10 min to collect Agrobacterium, and resuspend the cells in DM liquid medium to achieve an OD value of 0.8~1.0. 600 The value is 0.2-0.3.
[0039] (3) Infection and co-culture Seedlings were removed from the dark culture medium, and hypocotyls were cut into approximately 0.8 cm fragments using sterilized forceps and a scalpel. These fragments were then moistened with DM medium. The fragments were then transferred to PV58KN-BnaMYBL17 Agrobacterium resuspended in DM medium and soaked for 30 minutes, shaking the Erlenmeyer flask approximately every 5 minutes. After inoculation, the hypocotyls were transferred to sterile filter paper to air dry, and then placed on M1 solid medium and incubated in the dark at 24°C for 48 hours.
[0040] (4) M2 selection culture After two days of co-culture, the hypocotyls were transferred to M2 solid medium and placed in a 24°C light incubator for about 3 weeks. At this time, callus tissue could be seen growing from the hypocotyls.
[0041] (5) M3 differentiation culture The callus tissue grown on M2 medium was transferred to M3 solid medium for budding culture. To ensure sufficient nutrition, the tissue was subcultured every half month until the differentiated seedlings were observed.
[0042] (5) B5 rooting culture On a sterile empty dish, the differentiated seedlings are cut from the callus tissue and transferred to B5 solid medium. After about a month of light culture, they are removed, the medium is washed off the roots with tap water, and then they are transferred to soil for further culture.
[0043] Example 2: Screening of positive transformed plants, identification of mutants, and phenotypic observation of T1 generation mutant plants. 1. Screening of positive strains Leaves were taken from 10 PV58KN-BnaMYBL17 transformed plants, and DNA was extracted using the CTAB method. Selection markers were then used to extract the DNA. Hpt PCR detection was performed using gene-specific primers. A positive transformation plant was identified by a 557 bp band. The primers used for amplification are as follows: hpt557-F: ACACTACATGGCGTGATTTCAT, SEQ ID NO.10; hpt557-R: TCCACTATCGGCGAGTACTTCT, SEQ ID NO. 11.
[0044] 2. Identification of mutant strains Mutation detection was performed on the positive strains selected above, at a distance BnaMYBL17 ( BnaC06g32180D ) and homologous copies ( BnaA07g29070D Specific primers were designed approximately 400 bp upstream and downstream of the two target sites for PCR amplification. The products were recovered, purified, and sent to Wuhan Aoke Biotechnology Co., Ltd. for sequencing. The sequencing results were consistent with... BnaMYBL17 The sequences of the transformed plants and their homologous copies were compared. The results showed that three positive transformed plants were found. BnaMYBL17 The sequence position of target site 1 and its homologous copy remained unchanged, while an insertion mutation occurred at the sequence position of target site 2. The nucleotide sequence alignment diagram of the mutation site is shown below. Figure 3 As shown, the target peak diagram is as follows: Figure 4 As shown, the primers for detecting mutation sites are as follows: BnaMYBL17 -F: AATAAGTGTGGTAAATGTGTTTCTGCT, SEQ ID NO.12; BnaMYBL17 -R: ATACTTTGACTAAGAGTTTCCTTGATC, SEQ ID NO.13; BnaA07g29070D -F:GATGTGTTCTTCTTCTTCCTCGTC, SEQ ID NO.14; BnaA07g29070D -R: AAAATTTCAAAAATCATTTTATTACCAA, SEQ ID NO.15.
[0045] 3. Phenotypic observation of mutant T1 generation plants At the target site 2 sequence position, the strain Bnamybl17-2、 Bnamybl17 -3 and Bnamybl17 -7 all showed homozygous single-base insertions. After harvesting the T0 generation, the T1 generation was sown. PCR detection of the target sequence location in the T1 generation plants revealed that the T1 generation exhibited a homozygous mutation, consistent with the T0 generation mutation, and the peak plot showed a single peak. BnaMYBL17 Its homologous copies were knocked out.
[0046] Plump seeds from T1 generation homozygous single plants and wild-type ZS6 plants were selected and placed on moistened filter paper in a 25℃ light incubator for germination. After 4 days, seedlings with uniform germination were selected and transplanted into a nutrient soil mixture of vermiculite and substrate in a 1:1 volume ratio. These seedlings were then cultured in a 21℃ plant growth chamber until they developed three true leaves. Seedlings with uniform growth were then treated in a -2℃ incubator for 3.5 hours, after which they were removed and transferred to normal growing conditions for a week to recover. Results are as follows... Figure 5 As shown, one week after low-temperature treatment and recovery, wild-type plants exhibited significantly more pronounced leaf wilting, yellowing, or death phenotypes compared to mutant plants. Survival rate statistical analysis indicated that the mutant rapeseed plants showed a higher survival rate than the wild-type plants, exceeding 50%. Figure 6 As shown.
[0047] All the above data indicate that, relative to its recipient wild-type strain, BnaMYBL17 The knockout mutant lines exhibit enhanced adaptability to low temperatures, providing excellent germplasm resources and theoretical and technical support for the improvement of cold-resistant rapeseed varieties.
[0048] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. Knockout BnaMYBL17 The application of genes in any of the following: (1) Improve the cold resistance of rapeseed; (2) Cultivating highly cold-resistant rapeseed; The BnaMYBL17 The cDNA nucleotide sequence of the gene is shown in SEQ ID NO.
1.
2. As described in claim 1 BnaMYBL17 The application of gene-encoded proteins in any of the following: (1) Improve the cold resistance of rapeseed; (2) Cultivate rapeseed with high cold resistance.
3. For knocking out the device described in claim 1 BnaMYBL17 The application of gene recombinant vectors in any of the following: (1) Improve the cold resistance of rapeseed; (2) Cultivate rapeseed with high cold resistance.
4. The use of recombinant microorganisms containing the recombinant vector as described in claim 3 in any of the following: (1) Improve the cold resistance of rapeseed; (2) Cultivate rapeseed with high cold resistance.
5. The application as described in any one of claims 1-4, characterized in that, Mutating rapeseed using gene editing technology BnaMYBL17 Genes that lead to the aforementioned BnaMYBL17 The loss of function of the gene-expressed protein enhances the cold resistance of the rapeseed.
6. The application as described in claim 5, characterized in that, The cause of BnaMYBL17 Methods to eliminate the function of gene-expressed proteins include the insertion of bases into the target sequence.
7. The application as described in any one of claims 1-4, characterized in that, The rapeseed mentioned includes Brassica napus.
8. A method for improving the cold resistance of rapeseed, characterized in that, Includes the following steps: In rapeseed BnaMYBL17 Gene editing is performed to make the aforementioned BnaMYBL17 The loss of function of the gene-expressed protein, thereby enhancing the cold resistance of the rapeseed; BnaMYBL17 The cDNA nucleotide sequence of the gene is shown in SEQ ID NO.
1.
9. A method for cultivating highly cold-resistant rapeseed, characterized in that, Includes the following steps: In rapeseed BnaMYBL17 Gene editing is performed to make the aforementioned BnaMYBL17 The loss of function of the gene-expressed protein, thereby enhancing the cold resistance of the rapeseed; BnaMYBL17 The cDNA nucleotide sequence of the gene is shown in SEQ ID NO.1.