Application of LOCOs03g28130 gene in rice character prediction

Abstract

The invention relates to the field of agriculture, in particular to application of a LOCOs03g28130 gene in rice character prediction. The invention provides the application of the LOCOs03g28130 gene in any of the following items: rice character prediction; rice breeding; preparing a product for predicting the characters of the rice; and preparing a product for rice breeding. According to the invention, a key candidate gene LOCOs03g28130 for controlling the length-width ratio of rice grains is positioned through whole genome correlation analysis, the gene encodes F-box structural domain protein and is positioned in a third chromosome, the LOD value of a correlation site is 6.408, and the contribution rate of the correlation site to phenotypic variation is 23.65%. Further functional verification shows that the gene has a key regulation effect on grain traits.

Description

Technical Field

[0001] This invention relates to the agricultural field, and more particularly to the application of the LOC_Os03g28130 gene in the prediction of rice traits. Background Technology

[0002] With changing market demands, there are increasing requirements for rice quality while ensuring yield. Rice grain shape, as an important agronomic trait, plays a crucial role in improving both yield and quality. Grain shape mainly includes grain length, grain width, and length-to-width ratio. Currently, over 500 QTLs related to rice grain shape have been identified through genetic mapping, association analysis, and population sequencing analysis. These QTLs are distributed across the 12 chromosomes of rice, and over 30 have been cloned and functionally validated. Although extensive research has been conducted on rice grain shape-related QTLs, grain shape is a complex quantitative trait controlled by multiple loci, and its genetic mechanisms remain largely unclear. With the continuous improvement of genomics theories and methods, and the increasing maturity of sequencing technology, more and more rice varieties have completed gene sequencing. These data provide fundamental information for studying the molecular mechanisms and genetic variation of rice. Summary of the Invention

[0003] In view of this, the present invention provides the application of the LOC_Os03g28130 gene in rice trait prediction. Through genome-wide association analysis, the present invention located a key candidate gene controlling the length-to-width ratio of rice grains, LOC_Os03g28130. This gene encodes an F-box domain protein (OsFBX94) located on chromosome 3, with a LOD value of 6.408 at its associated locus, contributing 23.65% to phenotypic variation. Further functional validation showed that this gene plays a crucial regulatory role in grain traits. Loss-of-function mutants of this gene were created using CRISPR / Cas9 technology. Two independent homozygous mutant lines (qLWR3-1 and qLWR3-2) consistently exhibited a phenotype with a highly significant increase in grain length and a highly significant decrease in grain width, confirming the function of the gene. Most importantly, the qLWR3-1 mutant, while improving grain shape, also showed synergistic high-yield potential with a highly significant increase in panicle length, a highly significant decrease in the number of empty grains, and a significant increase in thousand-grain weight.

[0004] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides the application of the LOC_Os03g28130 gene in any of the following: (a) Prediction of rice traits; (b) Rice breeding; (c) Prepare products for predicting rice traits; (d) Preparation of products for rice breeding; The LOC_Os03g28130 gene has the nucleotide sequence shown in SEQ ID NO:1.

[0005]

[0006] In some embodiments of the present invention, the above application is obtained by knocking out the LOC_Os03g28130 gene.

[0007] In some embodiments of the present invention, in the above application, knocking out the LOC_Os03g28130 gene includes the following steps: obtaining an expression vector that knocks out the LOC_Os03g28130 gene, transferring it into recipient material, obtaining callus tissue, and obtaining the rice through resistance screening, differentiation culture, and hardening and transplanting.

[0008] In some embodiments of the present invention, in the above applications, the knockout is performed using the CRISPR-Cas9 system, wherein the sgRNA sequence is shown in SEQ ID NO:2.

[0009] In some embodiments of the present invention, the sequence of SEQ ID NO:2 is: CGACGTTCTGGAGCGCGTCC.

[0010] In some embodiments of the present invention, in the above applications, the rice traits include one or more of the following: grain length, grain width, thousand-grain weight, and panicle length.

[0011] In some embodiments of the present invention, in the above applications, knocking out the LOC_Os03g28130 gene results in rice grains that are longer, narrower, have a greater thousand-grain weight, or have a longer panicle length.

[0012] In some embodiments of the present invention, in the above applications, the rules for predicting rice traits include: (e) If the deletion of one or more bases in the LOC_Os03g28130 gene results in a frameshift mutation, then the rice grains are longer, the grain width is narrower, the thousand-grain weight is greater, or the panicle length is longer; or (f) If a base T or a base G is inserted after the 307th base of the LOC_Os03g28130 gene, the rice grains will be longer, the grain width will be narrower, the thousand-grain weight will be greater, or the panicle length will be longer.

[0013] In some embodiments of the present invention, in the above application, positions 304 to 308 of the LOC_Os03g28130 gene described in (a) are deleted.

[0014] The present invention also provides a method for predicting rice traits, based on the LOC_Os03g28130 gene prediction described in the above applications; The prediction rules include: (g) If a deletion at positions 304 to 308 of the LOC_Os03g28130 gene results in a frameshift mutation, then the rice grains will be longer, the grain width will be narrower, the thousand-grain weight will be greater, or the panicle length will be longer; or (h) If a base T or a base G is inserted between the 307th and 308th bases of the LOC_Os03g28130 gene, the rice grains will be longer, the grain width will be narrower, the thousand-grain weight will be greater, or the panicle length will be longer.

[0015] The present invention also provides a method for rice breeding, based on the LOC_Os03g28130 gene described in the above application; The selection and breeding rules include: (i) Select rice varieties with deletions at positions 304 to 308 of the LOC_Os03g28130 gene for cultivation; or (j) Rice varieties in which a base T or a base G is inserted between the 307th and 308th bases of the LOC_Os03g28130 gene are selected for cultivation.

[0016] This invention, through genome-wide association analysis, located a key candidate gene controlling the length-to-width ratio of rice grains, LOC_Os03g28130. This gene encodes an F-box domain protein (OsFBX94), located on chromosome 3, with a LOD value of 6.408 and a contribution rate of 23.65% to phenotypic variation. Further functional validation showed that this gene plays a crucial regulatory role in grain traits. Loss-of-function mutants of this gene were created using CRISPR / Cas9 technology. Two independent homozygous mutant lines (qLWR3-1 and qLWR3-2) consistently exhibited a phenotype with a highly significant increase in grain length and a highly significant decrease in grain width, confirming the gene's function. Most importantly, the qLWR3-1 mutant, while improving grain shape, also showed synergistic high-yield potential with a highly significant increase in panicle length, a highly significant decrease in the number of empty grains, and a significant increase in thousand-grain weight.

[0017] In summary, LOC_Os03g28130 is a key gene that simultaneously regulates the length-to-width ratio and yield potential of japonica rice grains. Its loss-of-function allelic variant provides important genetic resources and breeding materials for breeding new japonica rice varieties that combine high quality (long and thin grains) and high yield potential. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0019] Figure 1The frequency distributions of three grain shape-related traits are shown; where: A shows the frequency distribution of grain length; B shows the frequency distribution of grain width; and C shows the frequency distribution of length-to-width ratio. Figure 2 Manhattan plot and QQ plot showing the genome-wide association analysis of grain aspect ratio; where: A shows the aspect ratio Manhattan plot; B shows the aspect ratio QQ plot; Figure 3 Map of the LOC_Os03g28130 gene-targeted editing recombinant vector; Figure 4 The length and width of wild-type seeds are compared with those of mutants qLWR3-1 and qLWR3-2. Among them, A and B are comparisons of the length and width of wild-type seeds with those of mutants qLWR3-1 and qLWR3-2, n=10, Bars=1cm; C and D are bar charts comparing the length and width of wild-type seeds with those of homozygous mutants. The data are expressed as mean ± standard deviation (n=30). The difference between the representative and wild types was significant (P<0.05). The difference was highly significant (P<0.01). Detailed Implementation

[0020] This invention discloses the application of the LOC_Os03g28130 gene in predicting rice traits.

[0021] It should be understood that the expression “one or more of…” individually includes each of the objects described after the expression, as well as various different combinations of two or more of the described objects, unless otherwise understood from the context and usage. The expression “and / or” combined with three or more described objects should be understood to have the same meaning, unless otherwise understood from the context.

[0022] The terms “including,” “having,” or “containing,” including the use of their grammatical synonyms, should generally be understood as open-ended and non-restrictive, for example, not excluding other unstated elements or steps, unless otherwise specifically stated or understood from the context.

[0023] It should be understood that the order of the steps or the order in which certain actions are performed is not important as long as the invention remains operational. Furthermore, two or more steps or actions can be performed simultaneously.

[0024] The use of any and all instances or exemplary language such as “e.g.” or “including” in this document is merely intended to better illustrate the invention and is not intended to limit the scope of the invention unless the claims are made. No language in this specification should be construed as indicating that any unclaimed element is essential to the practice of the invention.

[0025] Furthermore, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as precisely as possible. However, any value inevitably contains standard deviations due to individual test methods. Therefore, unless explicitly stated otherwise, it should be understood that all ranges, quantities, values, and percentages used in this disclosure are modified with the word "approximately". Here, "approximately" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a specific value or range.

[0026] The present invention relates to a catalog of 100 japonica rice resources: Table 1

[0027] Aspect ratio data: Table 2

[0028]

[0029]

[0030] In Examples 1-2 and Effect Examples 1-2 of the present invention, the raw materials and reagents used can all be purchased from the market.

[0031] The present invention will be further illustrated below with reference to the embodiments: Example 1 1.1 Materials The material used in this study for identifying new loci for grain type-related traits in genome-wide association analysis was a natural population of 100 japonica rice varieties, all of which are widely collected japonica rice resources in China.

[0032] 1.2 Methods 1.2.1 Material Cultivation All materials were planted in 2023 at the Changshu Agricultural Science Research Institute base in Jiangsu Province. Each material was planted in 6 rows with 6 plants per row, with a row spacing and plant spacing of 30.0cm × 14cm. Single-plant transplanting was used. All materials were managed with standard water and fertilizer. Plants with good and relatively uniform growth were selected, and 3 packets of seeds were collected from each plant, while one packet of seeds was collected from each plant for phenotypic observation and propagation.

[0033] 1.2.2 Trait Survey The harvested seeds were air-dried and stored. Ten plump seeds were randomly selected, and their length and width were measured using calipers (accuracy 0.01 mm). The length-to-width ratio of the rice grains was calculated based on the grain length and width. This was repeated three times, and the average value was used as the phenotypic value of the trait. Phenotypic data analysis was performed using IBM SPSS Statistics 25, and the minimum, maximum, average, standard error, coefficient of variation, skewness, and kurtosis of the grain length, width, and length-to-width ratio were calculated using Excel 2010.

[0034] 1.3 Genome-wide association analysis Total DNA was extracted from leaves of natural populations using a plant genomic DNA extraction kit. After passing the tests, the DNA was used for library construction and resequencing by Shanghai Yuanxin Biotechnology Co., Ltd. A total of 1,252,864 SNPs meeting the criteria (minimum allele frequency ≥5%, deletion rate ≤20%) were screened for subsequent analysis. Population structure analysis, phylogenetic analysis, and linkage disequilibrium analysis of 100 japonica rice varieties had already been completed previously. We used a mixed linear model in GEMMA (version 0.98.1) software for genome-wide association analysis (GWAS), incorporating phylogenetic relationships as a random effect and population structure (PCA) as a fixed effect. Based on the P-value calculation formula for association analysis: P = 1 / number of independent SNPs, the GWAS threshold in this study was calculated to be P = 7.12 × 10⁻⁶. -6 (-Log) 10 P=5.15 was used as the significance threshold for GWAS analysis. Important association sites were determined based on the LD method: sites near the most significant marker (peak signal) and at the LD level (r) of the most significant marker were considered. 2 A value greater than 0.2 is considered to belong to the same QTL as the most significant marker. The Manhatan and QQ plots of the association analysis results are plotted using the R package qqman. QTL naming follows McCouch et al.

[0035] 1.4 Candidate gene prediction and haplotype analysis LD block analysis was performed using LDBlockShow software, and gene annotation was performed within the LD block regions by referring to the National Rice Gene Database (https: / / www.ricedata.cn / ). The expression patterns of genes within candidate segments (100 kb upstream and downstream of significant loci) were analyzed using publicly available data on the length-to-width ratio of rice grains, and candidate gene prediction was conducted.

[0036] Example 1 Results and Analysis 1. Investigation of grain type traits in japonica rice This study investigated grain morphology using a population of 100 japonica rice accessions with extensive genetic variation. Table 3 shows that the average values ​​of grain length, grain width, and length-to-width ratio in this natural population were 7.55 mm, 3.24 mm, and 2.34 mm, respectively, with ranges of 6.74–10.78 mm, 2.4–3.6 mm, and 1.91–4.02 mm. The coefficient of variation (CV%) ranged from 6.48% to 11.35%, indicating rich genetic variation in these three grain morphology-related traits. Frequency distribution analysis revealed that all three traits exhibited a continuous distribution with a large range. Skewness and kurtosis analysis of each trait showed a normal or approximately normal distribution, and all three grain morphology traits were quantitative traits (e.g., grain length, grain width, and length-to-width ratio). Figure 1 (As shown).

[0037] Table 3. Statistical analysis of the correlation between three grain types in japonica rice.

[0038] 2. Aspect Ratio Genome-Wide Association Analysis Genome-wide association analysis (GWAS) of grain length-width ratios in 100 japonica rice varieties was performed using a mixed linear model (MLM) in TASSEL 5.0 in 2023. Results were obtained at p < 7.12 × 10⁻⁶. -6 Under these conditions, a total of 23 SNP loci significantly associated with aspect ratio were detected. These SNP loci were located at different positions on chromosomes 1, 2, 3, 4, 5, 11, and 12 (e.g., ...). Figure 2 (As shown). Linkage-related loci exceeding the threshold and with a distance between SNP loci not exceeding 100 kb were identified as QTLs associated with the grain length-to-width ratio trait. A total of 7 grain length-to-width ratio QTL loci were identified, named qLWR1, qLWR2, qLWR3, qLWR4, qLWR5, qLWR11, and qLWR12. Further analysis of the 7 detected QTLs revealed that the minimum LOD value was 5.328, and the maximum was 11.192, with a contribution rate between 19.72% and 43.47% (Table 4). Among the detected loci, qLWR5 was located to the gene GW5, which is related to grain width, and qLWR2 was located to the gene AP59, which is related to disease resistance. The others were novel loci.

[0039] Table 4. Gene mapping and analysis of rice grain length-to-width ratio

[0040] 3. Analysis of candidate genes for rice grain length-width ratio Based on the above results, using the Nipponbare rice genome information as a reference, QTL intervals were defined by extending 100kb upstream and downstream of the SNP sites at both ends of each QTL. 27, 34, 29, 34, 24, and 36 genes were found in qLWR1, qLWR2, qLWR3, qLWR4, qLWR11, and qLWR12, respectively. To further screen for genes not involved in the aspect ratio within these intervals, the publicly available transcriptome database related to rice grain aspect ratio (PRJNA439157) was downloaded from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ). Simultaneously, referring to gene functional annotations, hypothetical proteins, reductotransposons, and transposons were excluded from the analysis of genes within the intervals, resulting in the identification of four candidate genes related to rice grain aspect ratio (Table 5). These genes are all involved in the synthesis, signal transduction, or metabolic regulation of plant hormones, providing important candidate targets for elucidating the molecular regulatory mechanism of rice grain aspect ratio.

[0041] Table 5 Candidate genes for rice length-to-width ratio

[0042] In summary, japonica rice varieties are mainly grown in the northern rice-growing areas of my country. Japonica rice has short, round grains, while long, slender grains have less chalkiness and are more favored by consumers. Therefore, there is often a demand to improve the appearance quality of japonica rice by increasing grain length. Although indica rice has long, slender grains, the significant genetic differences between indica and japonica rice make hybridization breeding difficult. Therefore, identifying grain shape genes from japonica rice is of great significance for improving japonica rice grain shape. Genome-wide association analysis (GWAS) is an important method for identifying QTL loci controlling important traits in natural populations. In recent years, the development of sequencing technology and the reduction in costs have promoted large-scale rice genome sequencing. Based on this, Huang et al. used a mixed linear model to perform GWAS on 11 agronomic traits of 950 rice varieties, linking them to 10 quantitative trait loci related to grains, including GS3, which controls grain length and grain weight. Duan et al. determined the grain shape and performed whole-genome sequencing on 102 indica rice varieties with significant differences in grain size. They then used a mixed linear model to perform GWAS on the grain width of this indica rice population, which linked it to the gene GSE5, which can cause differences in grain width between indica and japonica rice varieties. Si et al. performed GWAS on 381 japonica rice materials and finally cloned the key gene GLW7 that controls rice grain shape.

[0043] This study used a natural population of 100 local japonica rice varieties from across China to conduct a genome-wide association analysis (GWA) of grain shape-related traits. A total of 23 SNP loci significantly associated with length-to-width ratio were detected, located at different positions on chromosomes 1, 2, 3, 4, 5, 11, and 12. Among the associated SNPs were previously reported grain shape-related genes GW5 and AP59. The GW5 protein is located on the cell membrane and interacts directly with GSK2, a key kinase in the brassinolide signaling pathway. This interaction leads to the accumulation of unphosphorylated BZR1 and DLT in the nucleus, regulating the expression of downstream BR response genes and thus controlling rice grain shape and other growth and development processes. Researchers also found that knocking out the GW5 gene using CRISPR technology increased grain width and weight in other rice varieties without the 1,212-bp deletion, resulting in increased yield. AP59, as an ethylene response factor, showed that overexpression of AP59 significantly improved rice's tolerance to drought and salt during the vegetative growth stage. In the field, overexpression of AP59 resulted in a 23%-43% reduction in yield compared to the control under normal and drought conditions.

[0044] This study newly identified four candidate genes related to the length-to-width ratio of rice grains (Table 5). The discovery of these genes provides new gene resources for elucidating the regulatory mechanism of japonica rice grain shape and for molecular breeding. Among the four newly identified candidate genes, LOC_Os03g28130 (OsFBX94) encodes an F-box protein. As a core component of the SCF ubiquitin ligase complex, the F-box protein can specifically degrade target proteins through the ubiquitin-proteasome pathway and is widely involved in key processes of plant growth and development. Its functional diversity is closely related to the specificity of trait regulation, suggesting that this gene may play an important role in the regulation of the length-to-width ratio of japonica rice grains. Based on this, this study will focus on LOC_Os03g28130 as the core research object for subsequent functional verification.

[0045] Example 2 1. Materials and Methods 1.1 Experimental Materials To further investigate whether LOC_Os03g28130 has a regulatory effect on the length and width of rice grains, Changnongjing 14, a popular japonica rice variety in Suzhou, was selected as the gene editing receptor. The LOC_Os03g28130 mutant was created using CRISPR-Cas9 technology. All experimental materials were grown in the experimental fields of the Changshu Agricultural Science Research Institute, employing standardized rice cultivation management methods and strictly controlling growth conditions such as water, fertilizer, and light to ensure the consistency and stability of the growth environment and the reliability of phenotypic identification results (Wang et al., 2019).

[0046] 1.2 Construction and transformation of the LOC_Os03g28130 gene editing vector The LOC_Os03g28130 gene encodes a protein containing an F-box domain, and its full-length CDS sequence is 1227 bp. Based on this CDS sequence, a specific sgRNA targeting the core functional region of the CDS region was designed using the CRISPR-P 2.0 online tool: CGACGTTCTGGAGCGCGTCC (as shown in SEQ ID NO:2). The sgRNA coding fragment was directionally inserted into the restriction site of the CRISPR-Cas9 expression vector to construct the LOC_Os03g28130 gene targeted editing recombinant vector (as shown in SEQ ID NO:2). Figure 3 (As shown). Using Agrobacterium-mediated transformation of rice callus (referencing the method of Hiei et al. in 1994 and optimizing the transformation conditions), the recombinant vector was introduced into the recipient material callus. After hygromycin resistance screening, differentiation culture, and hardening and transplanting, T0 generation transgenic plants were obtained (Toki et al., 2006; Zhang et al., 2018).

[0047] 1.3 Identification of gene-editing mutants Genomic DNA was extracted from T0 generation transgenic plants using a modified CTAB method. Specific identification primers (FP: TGGCGGCGAGAAGTAGCA (as shown in SEQ ID NO:3); RP: CGAGGCGGAAGAAGGTG (as shown in SEQ ID NO:4)) were designed around the upstream and downstream regions of the sgRNA target. Flanking sequences of the target were amplified using PCR. The PCR reaction volume was 20 μL, containing 2 μL of 10×PCR Buffer, 1.6 μL of 2.5 mmol / L dNTPs, 0.8 μL each of 10 μmol / L upstream and downstream primers, 0.2 μL of 5 U / μL Taq DNA polymerase, and 1 μL of genomic DNA template. The remainder was brought to 20 μL with ddH2O. The PCR amplification program was set as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, for 35 cycles; final extension at 72℃ for 10 min; and storage of the amplified products at 4℃. PCR products were sent to a biotechnology company for Sanger sequencing. The sequencing results were compared with wild-type gene sequences using DNAMAN 9.0 software to identify the mutation type and mutation site. Positive mutant plants were transplanted to experimental fields to breed the T1 generation. Homozygous mutants of the LOC_Os03g28130 gene were screened using the same sequencing method, and finally homozygous mutant lines were obtained (Liu et al., 2017; Chen et al., 2020; Zhang et al., 2019).

[0048] 1.4 Determination of length-to-width ratio and related traits in rice grains After the rice matured and was harvested, wild-type (WT) and two homozygous mutants of LOC_Os03g28130 (qLWR3-1 and qLWR3-2) were selected. The main panicle and two strong tillers at the top of each plant were selected and naturally dried until the grain moisture content stabilized at about 13%. Grain-related traits were measured, and three biological replicates were set up for each material. The specific measurement indicators and methods are as follows: 1) Grain length and width measurement: 30 plump grains were randomly selected from each material sample, and the grain length (maximum linear distance between the two ends of the grain) and width (linear distance at the widest point of the grain) were measured using an electronic vernier caliper with an accuracy of 0.01 mm; 2) Total grain number and seed setting rate measurement: The selected rice panicles were manually threshed, and the total number of grains per panicle (including plump grains, empty grains, and shriveled grains) was counted. Then, plump grains were screened and their number was counted. Seed setting rate = (number of plump grains / total number of grains) × 100%; 3) Thousand-grain weight measurement: 3 samples of 1000 grains each were randomly selected from the plump grains of each material sample, and weighed using an electronic balance with an accuracy of 0.001 g. The average of the 3 measurements was taken as the thousand-grain weight of the material (Li et al., 2018; Wang et al., 2020; Zuo & Li, 2014). All measurement data were recorded and compiled.

[0049] 1.5 Data Statistics and Chart Drawing SPSS 26.0 statistical software was used to perform statistical analysis on the data of wild-type and mutants. Independent samples t-tests were used to assess the significance of differences between the groups (P < 0.05 was defined as significant, and P < 0.01 as highly significant). Excel 2021 was used for data processing and summarization, and Origin 2023 software was used to create bar charts. Error bars in the charts represent the standard deviation of the data, and significance markers were used. (P<0.05) and (P<0.01) marked.

[0050] Example 2 2.1 Identification results of the LOC_Os03g28130 gene-edited homozygous mutant Sanger sequencing was used to identify the target region sequences in the T0 generation transgenic plants, successfully identifying two homozygous biallelic mutant lines of the LOC_Os03g28130 gene, named qLWR3-1 and qLWR3-2, respectively. Sequencing results showed that both lines contained two different frameshift mutation types (Table 4). The qLWR3-1 line contained two mutation types: Type 1 (52.77% of total sequencing reads, 1221 reads) was a 5-base deletion of "CGCGT" (5D); Type 2 (47.23% of total sequencing reads, 1093 reads) was a 1-base insertion of "T" (1I). The qLWR3-2 line contained two single-base insertion mutation types: Type 1 (2626 reads, 53.16%) was a "T" insertion; Type 2 (2314 reads, 46.84%) was a "G" insertion. All mutations occurred in the sgRNA target region, resulting in a frameshift of the open reading frame (ORF) of the LOC_Os03g28130 gene, suggesting that the gene in both mutant lines has lost its function.

[0051] 2.2 Effect of LOC_Os03g28130 on the length-width ratio of rice grains To investigate the effect of LOC_Os03g28130 on the length-to-width ratio of rice grains, the grain length, width, and length-to-width ratio of wild-type (WT) and two LOC_Os03g28130 biallelic homozygous mutants (qLWR3-1 and qLWR3-2) were measured and statistically analyzed (e.g., Figure 4 (As shown in the image). The results showed that, compared with the wild type, the grain morphology parameters of the two mutant lines exhibited a consistent variation trend: the grain length of the qLWR3-1 line increased significantly, from 7.37 cm in the wild type to 8.26 cm; the grain width decreased significantly, from 3.30 cm in the wild type to 3.07 cm. The qLWR3-2 line showed similar variation characteristics: the grain length increased significantly to 7.90 cm; the grain width decreased significantly to 2.91 cm. The consistent phenotypic variation of the two independent mutant lines indicates that the LOC_Os03g28130 gene is involved in the regulation of rice grain size.

[0052] Table 6. Statistics on correlation traits of ear length and yield between wild type and mutant.

[0053] This study used 100 natural populations of local japonica rice varieties as materials and detected 23 SNP loci significantly associated with grain length-to-width ratio using GWAS. In addition to validating the previously reported grain shape gene GW5, four new candidate genes were identified, providing new gene resources for elucidating the regulatory mechanism of japonica rice grain shape and for molecular breeding. Among them, the GW5 gene, as a classic gene regulating rice grain width, has been validated by multiple studies using GWAS, which also demonstrates the reliability of the GWAS results in this study.

[0054] Among the newly identified candidate genes, LOC_Os03g28130 (OsFBX94) encodes an F-box protein. This protein, a core component of the SCF ubiquitin ligase complex, can regulate target protein degradation via the ubiquitin-proteasome pathway and is widely involved in plant growth and development; therefore, it was identified as a core research subject for functional validation. Previous studies have shown that the F-box gene family has numerous members; over 600 F-box genes have been identified in rice. Some members are involved in the regulation of important traits such as grain size, grain weight, and heading date. For example, the OsFBL17 gene affects grain size by regulating the degradation of cell cycle-related proteins, while the OsFBX247 gene affects rice yield by regulating hormone balance. Gene editing revealed that while both LOC_Os03g28130 biallelic homozygous mutants achieved superior phenotypic improvements in grain length and narrowing, their yield-related traits showed significant differences: the qLWR3-1 line (containing a 5-base deletion + 1-base insertion mutation) exhibited a highly significant increase in ear length, a highly significant decrease in empty grains, and a significant increase in total grain number and thousand-grain weight, indicating high yield potential; the qLWR3-2 line (containing two single-base insertion mutations) showed only slight optimization in yield traits, failing to reach a significant level. The phenotypic differences between the two mutants stem primarily from the different degrees of gene function loss caused by the different mutation types: F-box protein function depends on domain integrity; base deletion causes more thorough domain destruction, while single-base insertion has a relatively milder effect, leading to differences in downstream regulatory pathway responses.

[0055] Changnongjing 14, as a high-quality japonica rice variety promoted in Suzhou, has good adaptability and agronomic traits, but there is still room for improvement in the length-width ratio of its grains.

[0056] This study used LOC_Os03g28130 as a gene editing vector to screen for the qLWR3-1 mutant, which possesses both high-quality (long and thin grains) and high-yield potential. This provides excellent germplasm resources for the molecular improvement of Changnongjing 14. Compared with traditional breeding methods, gene editing technology has the advantages of high precision and short breeding cycle. The practice of this study further verifies the feasibility of this technology in improving the appearance quality of japonica rice, providing an efficient technical path for molecular breeding of high-quality japonica rice. Furthermore, the next step is to deeply analyze the regulatory network of the LOC_Os03g28130 gene, identify its target proteins and upstream and downstream interacting genes, which can provide a more precise theoretical basis for the molecular improvement of rice grain shape and yield traits.

[0057] Table 7

[0058] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Application of the LOC_Os03g28130 gene in any of the following: (a) Prediction of rice traits; (b) Rice breeding; (c) Prepare products for predicting rice traits; (d) Preparation of products for rice breeding; The LOC_Os03g28130 gene has the nucleotide sequence shown in SEQ ID NO:

1.

2. The application as described in claim 1, characterized in that, The application was obtained by knocking out the LOC_Os03g28130 gene.

3. The application as described in claim 2, characterized in that, Knocking out the LOC_Os03g28130 gene includes the following steps: obtaining an expression vector that knocks out the LOC_Os03g28130 gene, transferring it into recipient material, obtaining callus tissue, and obtaining rice through resistance screening, differentiation culture, hardening and transplanting.

4. The application as described in claim 3, characterized in that, The knockout was performed using the CRISPR-Cas9 system, wherein the sgRNA sequence is shown in SEQ ID NO:

2.

5. The application as described in claim 4, characterized in that, The rice traits include one or more of the following: grain length, grain width, thousand-grain weight, and panicle length.

6. The application as described in claim 5, characterized in that, Knocking out the LOC_Os03g28130 gene results in rice grains that are longer, narrower, have a greater thousand-grain weight, or have a longer panicle length.

7. The application as described in claim 6, characterized in that, The rules for predicting rice traits include: (e) If the deletion of one or more bases in the LOC_Os03g28130 gene results in a frameshift mutation, then the rice grains are longer, the grain width is narrower, the thousand-grain weight is greater, or the panicle length is longer; or (f) If a base T or a base G is inserted after the 307th base of the LOC_Os03g28130 gene, the rice grains will be longer, the grain width will be narrower, the thousand-grain weight will be greater, or the panicle length will be longer.

8. The application as described in claim 7, characterized in that, The LOC_Os03g28130 gene described in (a) has deletions at positions 304 to 308.

9. A method for predicting rice traits, characterized in that, Based on the LOC_Os03g28130 gene prediction in any of the applications described in any one of claims 1 to 8; The prediction rules include: (g) If a deletion at positions 304 to 308 of the LOC_Os03g28130 gene results in a frameshift mutation, then the rice grains will be longer, the grain width will be narrower, the thousand-grain weight will be greater, or the panicle length will be longer; or (h) If a base T or a base G is inserted between the 307th and 308th bases of the LOC_Os03g28130 gene, the rice grains will be longer, the grain width will be narrower, the thousand-grain weight will be greater, or the panicle length will be longer.

10. A method for rice breeding, characterized in that, Breeding based on the LOC_Os03g28130 gene in any of the applications described in claims 1 to 8; The selection and breeding rules include: (i) Select rice varieties with deletions at positions 304 to 308 of the LOC_Os03g28130 gene for cultivation; or (j) Rice varieties in which a base T or a base G is inserted between the 307th and 308th bases of the LOC_Os03g28130 gene are selected for cultivation.

Images